Mutation Screening of the Dopamine D1 ReceptorGene in Tourette’s Syndrome and AlcoholDependent Patients

Miles Thompson,1 David E. Comings,4 Leanne Feder,1 Susan R. George,1,2,3 and Brian F. O’Dowd1,2*1Department of Pharmacology, University of Toronto, Toronto, Ontario, Canada2Addiction Research Foundation, Toronto, Ontario, Canada3Department of Medicine, University of Toronto, Toronto, Ontario, Canada4Department of Medical Genetics, City of Hope Medical Center, Duarte, California

We report a single stranded conformationalpolymorphism (SSCP) analysis of the codingregion of the dopamine D1 receptor (DRD1)in Tourette’s syndrome (n = 50) and control(n = 50) subjects. Tourette’s syndrome popu-lations with comorbidity for attention defi-cit-hyperactivity disorder (AD-HD) (n = 35)and obsessive compulsive disorder (OCD) (n= 30) were also screened. As a related study,we also screened patients diagnosed with al-cohol dependence (n = 72). The presentstudy discovered no DRD1 coding regionmutations in any of the Tourette’s syndromeor alcohol dependent patients. One silentmutation, a C for a T at Ile49, was discov-ered in one control subject. The non-polymorphic structure of the DRD1 geneamong the Tourette’s syndrome, Tourette’ssyndrome comorbid with AD-HD and OCDand the alcohol dependent populationsscreened by SSCP suggests that coding re-gion mutations of the DRD1 gene are un-likely to contribute to the inheritance ofthese disorders. Am. J. Med. Genet. (Neuro-psychiatr. Genet.) 81:241–244, 1998.© 1998 Wiley-Liss, Inc.

KEY WORDS: neuropsychiatric; neuro-transmitter; receptor; poly-merase chain reaction; SSCP

INTRODUCTIONThe dopamine D1 (DRD1) gene is a candidate gene in

the study of the etiology of neuropsychiatric diseases

that may involve dopaminergic abnormalities. Thesedisorders include Tourette’s syndrome (TS) [Gelernteret al., 1993; Comings et al., 1997], alcohol dependence[George et al., 1995], attention deficit-hyperactivitydisorder (AD-HD) [Cook et al., 1995], schizophrenia[Ohara et al., 1993; Seeman et al., 1989; Karlsson et al.,1994], and affective disorders [Shah et al., 1995]. Thedopamine D1 receptor’s role in many brain functions[O’Dowd, 1993] and its high affinity for dopamine [Su-nahara et al., 1990] indicates the importance of DRD1gene integrity to dopamine pathways.

TS and alcohol dependence are probably polygenicdisorders for which susceptibility is conveyed against amultifactorial background [Cloninger, 1987; Comingset al., 1996]. Evidence for the dopamine hypothesis ofTS includes the efficacy of neuroleptic treatment of TS[Peterson, 1996] and twin studies showing that neuro-leptic binding is increased in the caudate of the moreaffected twin [Singer et al., 1991; Wolf et al., 1996].Alcohol dependence may involve increased synaptic do-pamine in mesolimbic and mesostriatal [Imperato andDi Chiara, 1986; Weiss et al., 1990] pathways of reward[Fibiger, 1978; Wise, 1980]. Treatment of comorbid TS-attention deficit-hyperactivity disorder (TS-AD-HD)with methylphenidate (MP) [Castellanos et al., 1997], adopamine transporter antagonist, and TS-obsessivecompulsive disorder (TS-OCD) [Swedo and Leornard,1994] with serotonergic antidepressants, suggests thatmany aspects of neurotransmission may be involved inthe etiology of TS and TS comorbidities. The identity ofthe dopamine system genes that may be involved in TSand alcohol dependence, however, remain unknown.

Systematic studies of the DRD1 gene coding regionin TS and alcohol dependent patients have not beenreported. A preliminary study of the DRD1 gene ineight alcohol dependent patients found no DRD1 genemutations [Lei et al., 1995]. Mutations were also ab-sent from the DRD1 gene in studies of schizophrenia[Lei et al., 1995] and bipolar disorder [Shah et al.,1995]. Linkage studies preclude a major DRD1 geneeffect in TS [Gelernter et al., 1993], schizophrenia[Cichon et al., 1996] and bipolar disorder [Coon et al.,1993; Nothen et al., 1992]. However, a recent associa-

Contract grant sponsor: National Institute on Drug Abuse;Contract grant sponsor: Medical Research Council of Canada;Contract grant sponsor: Smokeless Tobacco Council.

*Correspondence to: Dr. Brian F. O’Dowd, Department of Phar-macology, University of Toronto, Toronto, Ontario, M5S 1S5,Canada. E-mail: brian.odowd@utoronto.ca

Received 9 July 1997; Revised 30 December 1997

American Journal of Medical Genetics (Neuropsychiatric Genetics) 81:241–244 (1998)

© 1998 Wiley-Liss, Inc.

tion study suggests that the DRD1 gene may play amodest role in TS and addictive behaviours [Comingset al., 1997]. Therefore, we continued our study of TS[Lam et al., 1996] and alcohol dependence [George etal., 1993] by screening the DRD1 gene for sequencevariants in these disorders and a control populationusing single stranded conformational polymorphism(SSCP) analysis.

MATERIALS AND METHODSPatient DNA

Blood samples from non-psychiatric controls and pa-tients diagnosed with TS, TS-AD-HD, TS-OCD, and al-cohol dependence were obtained. The diagnostic crite-ria are described below. Genomic DNA was isolatedusing phenol extraction and ethanol precipitation ofDNA from patient blood as previously described [Bar-deesy and Pelletier, 1995].

Clinical Samples

Tourette’s syndrome samples. The TS patientswere consecutive, unrelated individuals treated at theTourette’s Syndrome Clinic of the City of Hope Na-tional Medical Center (COH), Duarte, California [Com-ings and Comings, 1993; Comings, 1994; Comings etal., 1996]. All patients and available first degree rela-tives were required to complete a detailed 31 page be-havioral questionnaire modeled after the DiagnosticInterview Schedule (DIS) [Robbins et al., 1981]. TheDIS questionnaire is available elsewhere [Comings andComings, 1990].

In addition to DIS and demographic questions, allDSM-III-R [American Psychiatric Association, 1987]and DSM-IV [American Psychiatric Association, 1990]variables required for the diagnosis of TS, chronic mo-tor tic and vocal tic disorder, and AD-HD and OCDwere included. The responses were entered into anSPSS data base.

The DRD1 gene of TS patients with no comorbiditywere analyzed in the context of an ethnically matchedcontrol population. In addition, 35 TS patients diag-nosed with comorbid TS-AD-HD and 30 patients diag-nosed comorbid with TS-OCD were analyzed.

Control samples. The 50 controls obtained fromthe Addiction Research Foundation (ARF), Toronto,Ontario were healthy volunteers from the MetropolitanToronto area with no history of psychiatric treatment.

The controls were of non-hispanic, northern or westernEuropean descent in order to ethnically match the 50TS patients with no comorbidity.

Samples from patients diagnosed with alcoholdependence. The DRD1 gene of 72 patients from theARF diagnosed with alcohol dependence werescreened. The patients were all admitted to the TorontoHospital between 1989 and 1992 for alcohol-relatedchronic health problems. Assessment of alcohol depen-dence was made according to DSM-IV criteria [Ameri-can Psychiatric Association, 1990]. The patients wereof northern and western European descent and residedin Metropolitan Toronto.

PCR amplification of gene segments to be ana-lyzed by SSCP. PCR reactions were conducted using200 ng human genomic DNA, 1 mg of each oligonucleo-tide primer, 2 mmol dNTP, 1.5 mmol MgCl2, and 0.5 UTaq polymerase. PCR primers are listed in Table I.Forty cycle PCR of 95°C for 30 seconds, 55-60°C for 40seconds, and 72°C for 40 seconds was conducted in aPerkin Elmer system 2400 machine. Amplified DNAwas analyzed by agarose electrophoresis prior toscreening.

SSCP analysis of PCR generated from genomicDNA samples. PCR products were diluted 1:4 withan SSCP loading buffer. The buffer was prepared bymixing stock denaturing solution with stock stop solu-tion in a 2:3 ratio. The stocks were stored at room tem-perature. The denaturing solution consisted of 0.1%SDS and 10 mM EDTA. The stop solution consisted of95% formamide, 20 mM EDTA, 0.05% bromophenolblue, and 0.05% xylene cyanole FF. Samples were de-natured at 95°C for 5 minutes and chilled to 4°C for 5minutes prior to loading [O’Dowd et al., 1996].

The entire volume of buffer and PCR product, 20 mL,was loaded into separate wells of Novex 4–20% TBEgels. Gels were run in the Novex ThermoFlow SSCPElectrophoresis system under temperature regulationby a Haake water bath. Electrophoresis at 4°C wasconducted at 85 V for 15–18 hours for the 261–414 bpPCR fragments (Table I). At 24°C, the electrophoresisvoltage was 55 V. The DNA was visualized using theNovex SilverXpress Staining kit. Direct sequencing ofthe DNA was conducted using the USB Sequinase PCRProduct Sequencing (Cleveland, OH) or by subcloningthe PCR product into pBluescript and sequencing us-ing the Pharmacia-Biotech T7 Sequencing Kit(Uppsala, Sweden) [O’Dowd et al., 1996].

TABLE I. Oligonucleotides Used in PCR/SSCP Analysis of Human DRD1 Gene

Set Primer name Primer sequence (58-38)Fragment

(base pairs)AnnealingTemp. (°C)

1 P1-UP CTGCTTAGGAACTTGAGGGGT 321 60P2-DOWN GAAGCCAGCAATCTCAGCCAC

2 P3-UP CTGGTCATGCCCTGGAAGGCA 309 55P4-DOWN GGTCTCAGCCAGGGAAGTGGC

3 P5-UP CCAGTGCAGCTCAGCTGGCAC 414 60P6-DOWN CAAAATGCAGTTCAAGATGAA

4 P7-UP GTGTGCTGTTGGCTACTTTTC 352 55P8-DOWN CAGGTCCTCAGAGGAGCCCAC

5 P9-UP AAGGAGTGCAATCTGGTTTAC 261 58P10-DOWN GCAAACCCCAGAGCAATCTCC

242 Thompson et al.

RESULTS

The SSCP analysis involved screening the coding re-gion of the DRD1 gene for structural variants. NoSSCP band shifts were noted in the TS group (n 4 50),the TS-AD-HD (n435), the TS-OCD (n430), or the al-cohol dependent patient group (n472) when SSCP wasconducted at 55 V for 18 hours at 24°C or at 100 voltsfor 18 hours at 4°C. In one of the fifty controls, an SSCPband shift was observed in the analysis of the DRD1gene region coding for the amino terminus (Fig. 1, lane2). The SSCP was conducted at 100 V for 18 hours at4°C. Sequence analysis of the DRD1 gene in three rep-resentative patients from each disease population con-firmed that the SSCP pattern alteration resulted froma single base pair substitution of C for T, which re-sulted in the conservation of 49Ile.

DISCUSSION

Prior to this report there has been no systematic at-tempt to associate structural variations in the codingregion of the DRD1 gene with TS, TS comorbidities, oralcohol dependence. The DRD1 sequence conservationamong the 72 alcohol dependent patients included inthis study confirms the results of a previous study onthe DRD1 gene in eight AD patients [Lei et al., 1995].The integrity of the DRD1 gene coding region in TSconfirms work by our group [Gelernter et al., 1993],suggesting that a major DRD1 gene effect is unlikely inTS and indicates that evidence suggesting that theDRD1 gene may be a susceptibility loci for TS [Com-ings et al., 1997] is unlikely to be explained by studyingthe DRD1 coding region.

The present study provides evidence for DRD1 cod-ing region sequence conservation given that SSCP candetect up to 90% of single nucleotide changes [Jor-danova et al., 1997] if SSCP is conducted under optimaltemperature control. Thus, we conclude that our SSCPscreening of the DRD1 gene nucleotide sequence de-tected most of the nucleotide changes present in theTS, alcohol dependence, and control samples screened.These results do not exclude the possibility that theDRD1 gene is polymorphic in other samples, in otherdisorders, or in DRD1 gene regulatory regions. How-ever, the present study indicates that sequence varia-tion in the DRD1 gene coding region is unlikely to ac-

count for the population variability in dopaminergicgenes that may result in TS, TS-AD-HD, TS-OCD, oralcohol dependence. Therefore, future studies shouldscreen the coding regions of other dopamine systemgenes, such as the dopamine transporter (DAT1), inpatients diagnosed with neuropsychiatric disorders[Vandenbergh et al., 1992; Comings et al., 1996].

ACKNOWLEDGMENTS

We thank Dr. Philip Seeman and Carla Ulpian forhelp in contrasting SSCP methodologies.

REFERENCES

American Psychiatric Association (1987): ‘‘Diagnostic and StatisticalManual of Mental Disorders. Third Edition-Revised (DSM-III-R).’’Washington, DC: American Psychiatric Press.

American Psychiatric Association (1990): ‘‘Diagnostic and StatisticalManual of Mental Disorders. Fourth Edition (DSM-IV).’’ Washington,DC: American Psychiatric Press.

Bardeesy N, Pelletier J (1995): Mutational detection by single strandedconformational polymorphism. PCR in Neuroscience 26:163–183.

Castellanos FX, Giedd JN, Elia J, Marsh WL, Ritchie GF, Hamburger SD,Rapoport JL (1997): Journal of the American Academy of Child andAdolescent Psychiatry 36:589–596.

Cichon S, Nothen MM, Stober G, Schroers R, Albus M, Maier W, RietschelM, Korner J, Weigelt B, Franzek E, Wildenauer D, Fimmers R, Prop-ping P (1996): Systematic screening for mutations in the 5’-Regulatoryregion of the Human dopamine D1 receptor (DRD1) gene in patientswith schizophrenia and bipolar affective disorder. Am J Med Genet67:424–428.

Cloninger CR, Sigvardsson S, Gilligan SB, Von Knorring AL, Reich T,Bohman M (1989): Genetic heterogeneity and the classification of al-coholism. Advances in Alcoholism and Substance Abuse 7:3–16.

Comings DE, Comings BG (1990): ‘‘Tourette Syndrome and Human Behav-ior.’’ Duarte, CA: Hope Press, pp 1–828.

Comings DE, Comings BG (1993): Comorbid behavioral disorders. InKurlan R (ed): ‘‘Handbook of Tourette Syndrome and Related Tic andBehavioral Disorders.’’ New York, NY: Marcel Dekker, Inc.

Comings DE (1994): Tourette Syndrome: A hereditary neuropsychiatricspectrum disorder. Ann Clin Psychiatry 6:235–247.

Comings DE, Wu S, Chui C, Ring RH, Gade R, Ahn C, MacMurray JP,Dietz G, Muhleman D (1996): Polygenic inheritance of Tourette syn-drome, stuttering, attention defect hyperactivity, Conduct and Oppo-sitional Defiant Disorder: The additive and subtractive effect of thethree dopaminergic genes-DRD2, DBH, and DAT1 (1996). Am J MedGenet 67:264–288.

Comings DE, Gade R, Wu S, Chiu C, Dietz G, Muhleman D, Saucier G,Ferry L, Rosenthal RJ, Lesieur HR, Rugle LJ, MacMurray P (1997):Studies of the potential role of the dopamine D1 receptor gene in ad-dictive behaviors. Molec Psychiatry 2:44–56.

Cook Jr EH, Stein MA, Krasowski MD, Cox NJ, Olkon DM, Kieffer JE,Leventhal BL (1995): Association of attention-defect disorder and thedopamine transporter Gene. Am J Hum Genet 56:993–998.

Coon H, Jensen S, Hoff M, Holik J, Plaetke R, Reimherr F, Wender P,Leppert M, Byerley W (1993): A Genome-wide search for genes predis-posing to manic-depression, assuming autosomal dominant inheri-tance. Am J Hum Genet 52:1234–1249.

Fibiger HC (1978): Drugs and reinforcement mechanisms: A critical view ofcatecholamine theory. Ann Rev Pharmacol Toxicol 18:37–56.

Gelernter J, Kennedy JL, Grandy DK, Zhou Q-Y, Civelli O, Pauls DL,Pakstis A, Kurlan R, Sunahara RK, Niznik HB, O’Dowd BF, Seeman P,Kidd KK (1993): Exclusion of close linkage of Tourette’s syndrome toD1 dopamine receptor. Am J Psychiatry 150:449–453.

George SR, Cheng R, Nguyen T, Israel Y, O’Dowd BF (1993): Polymor-phisms of the D4 dopamine receptor alleles in chronic alcoholism. Bio-chem Biophys Res Comm 196:107–114.

George SR, Fan T, Ng G, Jung SY, O’Dowd BF, Naranjo CA (1995): Lowendogenous dopamine function in brain predisposes high alcohol pref-erence and consumption: Reversal by increasing synaptic dopamine. JPharmacol Exp Therapeut 273:373–379.

Fig. 1. SSCP Analysis of a fragment of the dopamine D1 receptor gene.This rare silent nucleotide change was detected by electrophoresis con-ducted at 85 V for 24 hours at 4°C. The arrow indicates the SSCP patternof a polymorphic variant.

DRD1 Gene in Tourette’s Syndrome and Alcoholism 243

Imperato A, Di Chiara Di (1986): Preferential stimulation of dopaminerelease in the nucleus accumbens of freely moving rats by ethanol.Journal of Pharmacol Exp Therapeut 239:219–239.

Jordanova A, Kalaydjieva L, Savov A, Claustress M, Schwarz M, Estivill X,Angelicheva D, Haworth A, Casals T, Kremensky I (1997): SSCP analy-sis: A blind sensitivity trial. Hum Mutat 10:65–70.

Karlsson P, Sedvaal GC, Haldin C, December Farde F (1994): Reduced D1dopamine receptor binding in drug-naive schizophrenic patients exam-ined by PET. ACNPP Annual Meeting San Juan, Puerto Rico 11–16.

Lam S, Shen Y, Nguyen T, Messier T, Brann M, Comings D, George SR,O’Dowd BF (1996): A serotonin receptor gene (5HT1A) variant found ina Tourette’s syndrome patient. Biochem Biophys Res Comm 219: 853–858.

Lei Q, Sobell JL, Heston LL, Sommer SS (1995): Screening the dopamineD1 receptor gene in 131 schizophrenics and eight alcoholics: Identifi-cation of polymorphims but lack of functionally significant sequencechanges. Am J Med Genet 60:165–171.

Nothen MM, Erdmann J, Korner J, Lanczik M, Fritze J, Fimmers R,Grandy DK, O’Dowd BF, Propping P (1992): Lack of association be-tween dopamine D1 and D2 receptor genes and bipolar affective disor-der. Am J Psychiatry 149:199–201.

O’Dowd BF (1993): Structures of dopamine receptors. J Neurochem 60:804–816.

O’Dowd BF, Nguyen T, Lynch KR, Kolakowski LF, Thompson M, Cheng R,Marchese A, Ng G, Heng HHQ, George SR (1996): A novel gene codesfor a putative G protein coupled receptor with an abundant expressionin brain. FEBS Lett 394:325–329.

Ohara K, Ulpian C, Seeman P, Sunahara RK, Van Tol HHM, Niznik HB(1993): Schizophrenia: dopamine D1 receptor sequence is normal, buthas polymorphisms. Neuropsychopharmacology 8:131–135.

Peterson I, Ohgaki H, Ludeke B, Kleihues P (1994): Direct DNA Sequenc-ing Following SSCP Analysis. Anal Biochem 218:478–479.

Robbins LN, Helzer J, Croughan J, Ratclif KS (1981): National Institute ofHealth diagnostic interview schedule. Arch Gen Psychiatry 38:381–389.

Seeman P, Niznik HB, Guan H-C, Booth G, Ulpian C (1989): Link betweenD1 and D2 dopamine receptors is reduced in schizophrenia and Hun-tington’s diseased brain. Proc Natl Acad Sci USA 86:10156–10160.

Shah M, Coon H, Holik J, Helmer V, Panos P, Byerley W (1995): Mutationscan of the D1 dopamine receptor gene in 22 cases of bipolar I disorder.Am J Med Genet 60:150–153.

Singer HS, Hahn I-H, Moran T (1991): Abnormal Dopamine Uptake Sitesin Postmortem striatum from patients with Tourette’s syndrome. AnnNeurol 30:558–562.

Sunahara RK, Niznik HB, Weiner DM, Stormann TM, Brann MR,Kennedy JL, Gelernter JE, Rozmahel R, Yang Y, Israel Y, Seeman P,O’Dowd BF (1990): Human dopamine receptor encoded by an intronlessgene on chromosome 5. Nature 347:80–83.

Swedo, SE, Leornard HL (1994): Childhood movement disorders and ob-sessive compulsive disorder. J Clin Psychiatry 55:32–37.

Vandenbergh DJ, Persico AM, Hawkins AL, Griffin CA, Li X, Jabs EW andUhl GR (1992): Human dopamine transporter gene (DAT1) maps tochromosome 5p15.3 and displays a VNTR. Genomics 14:1104–1106.

Weiss F, Mitchener M, Bloom FE, Koob GF (1990): Free-choice respondingfor ethanol versus water in alcohol preferring (P) and unselectedWistar rats is differentially modified by nalaxone, bromocriptine andmethylsergide. Psychopharmacology 101:178–186.

Wise RA (1980): Catecholamine theories of reward. Brain Res 152:215–217.

Wolf SS, Jones DW, Knable MB, Gorey JG, Lee KS, Hyde TM, Coppola R,Weinberger DR (1996): Tourette Syndrome: Prediction of phenotypicvariation in monozygotic twins by caudate nucleus D2 receptor bind-ing. Science 273:1225–1227.

244 Thompson et al.