APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2009, p. 6647–6654 Vol. 75, No. 210099-2240/09/$12.00 doi:10.1128/AEM.00854-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Multiplexed Bead-Based Mesofluidic System for Detection ofFood-Borne Pathogenic Bacteria�

Sheng-Quan Jin, Bin-Cheng Yin, and Bang-Ce Ye*Lab of Biosystems and Microanalysis, State Key Laboratory of Bioreactor Engineering, East China University of

Science & Technology, Shanghai 200237, China

Received 15 April 2009/Accepted 23 August 2009

In the present study, a simple and rapid multiplexed bead-based mesofluidic system (BMS) was developedfor simultaneous detection of food-borne pathogenic bacteria, including Staphylococcus aureus, Vibrio parah-aemolyticus, Listeria monocytogenes, Salmonella, Enterobacter sakazakii, Shigella, Escherichia coli O157:H7, andCampylobacter jejuni. This system is based on utilization of isothiocyanate-modified microbeads that are 250�m in diameter, which were immobilized with specific amino-modified oligonucleotide probes and placed inpolydimethylsiloxane microchannels. PCR products from the pathogens studied were pumped into microchan-nels to hybridize with the oligonucleotide-modified beads, and hybridization signals were detected using aconventional microarray scanner. The short sequences of nucleic acids (21 bases) and PCR products charac-teristic of bacterial pathogens could be detected at concentrations of 1 pM and 10 nM, respectively. Thedetection procedure could be performed in less than 30 min with high sensitivity and specificity. The assay wassimple and fast, and the limits of quantification were in the range from 500 to 6,000 CFU/ml for the bacterialspecies studied. The feasibility of identification of food-borne bacteria was investigated with samples contam-inated with bacteria, including milk, egg, and meat samples. The results demonstrated that the BMS methodcan be used for effective detection of multiple pathogens in different foodstuffs.

Bacterial food-borne pathogens pose a significant threat tohuman and animal heath. These organisms are the leadingcauses of illness and death in less developed countries, killingapproximately 1.8 million people annually, and they are thethird leading cause of death. In developed countries, food-borne pathogens are responsible for millions of cases of infec-tious gastrointestinal diseases each year, costing billions ofdollars in medical care and lost productivity (42). The Centersfor Disease Control and Prevention estimates that food-bornediseases cause approximately 76 million illnesses, 325,000 hos-pitalizations, and 5,000 deaths in the United States each year(25). The Food and Drug Administration’s 2005 Food Codestates that the estimated cost of food-borne illness is $10 billionto $83 billion annually (29). The major food-borne pathogensinclude Salmonella, Listeria monocytogenes, Staphylococcus au-reus, Vibrio parahaemolyticus, Campylobacter jejuni, Escherichiacoli O157:H7, Enterobacter sakazakii, and Shigella (14, 32, 41).

Rapid detection and identification of pathogens and othermicrobial contaminants in food are needed by the food indus-try, food safety agencies, and public health bureaus. Tradi-tional methods to detect food-borne bacteria often rely ontime-consuming growth in culture media, isolation of bacteria,biochemical identification, and sometimes serology (5, 8).There have been many attempts to develop faster, more con-venient, more sensitive, and more specific techniques for de-tection and diagnosis of pathogenic bacteria, including immu-nological methods, biosensors, and microarray technologies.Although immunological methods, such as enzyme immunoas-

says (33), immunofluorescence techniques (13), and enzyme-linked immunosorbent assays (2, 21), are specific and sensitive,they often result in many false positives due to washing andcross-reactions. Several nucleic acid-based methods have beendeveloped for rapid and simultaneous detection of multiplepathogenic bacteria (7, 30). PCR is the method used mostcommonly for specific detection of food-borne pathogens (12,16, 31, 40). The biosensor method (24, 28) and oligonucleotidemicroarray technology have been used for analysis of microbialpathogens (4, 6, 18, 26, 36). Despite the recent advances indetection of food pathogens, there are still many challengesand opportunities for improving the current technologies, in-cluding improving the integration and automation of opera-tions, increasing the throughput and robustness, and decreas-ing the cost. Therefore, it is highly desirable to develop amethod that can provide simple, practical, and high-through-put routine detection of pathogens in food samples.

Over the past decade, in order to improve the microanalysismethod, much effort has been devoted to continued develop-ment of the micro total analysis system concept, such as alaboratory on a chip (39). So far, microfluidic and mesofluidicchips have been developed and used for various biological andchemical processes by taking advantage of automation, largesurface-to-volume ratios, low solvent consumption, sensitivity,short separation time, miniaturization, and portability, andthese chips can be controlled by the fluid velocity (3, 9, 11, 17).Mesofluidic chip (channel diameter, �100 �m) analysis pro-vides better fluidics control and maneuverability than the mi-crofluidic system (channel diameter, �1 �m). It allows accu-rate control of required conditions on beads and flow ofreagents to facilitate the hybridization reactions using a peri-staltic pump and an injection pump. Here, we report develop-ment of a simple, multiplexed, bead-based mesofluidic system

* Corresponding author. Mailing address: Lab of Biosystems andMicroanalysis, State Key Laboratory of Bioreactor Engineering, EastChina University of Science & Technology, Shanghai 200237, China.Phone and fax: 86-21-64252094. E-mail: bcye@ecust.edu.cn.

� Published ahead of print on 28 August 2009.

6647

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

(BMS) for simultaneous detection of eight of the major food-borne pathogens. The BMS method is based on nucleic acidhybridization on the surface of different beads in polydimeth-ylsiloxane (PDMS) microchannels, which makes it suitable forhigh throughput and parallel analysis of food samples (Fig. 1).First, eight specific oligonucleotide probes corresponding toeight different bacterial pathogens were designed. Glass mi-crobeads (diameter, 250 �m) precoated with the differentprobes were arranged in the PDMS microchannels (diameter,300 �m) using a predetermined order (NUC, VP, PRS, C20,SG, IAL, HLY, and HIP beads). Then the fluorescence-la-beled PCR products of target genes amplified from the patho-gens studied were infused into the microchannels, hybridized,and captured by the corresponding probes on the beads. Thebeads were scanned, and the fluorescence intensities were em-ployed to identify the pathogens. The complete procedure canbe completed within 30 min. The analytical performance of themethod in terms of specificity, sensitivity, and preliminary val-idation is discussed below. Moreover, 184 contaminated foodsamples were analyzed to illustrate use of this method.

MATERIALS AND METHODS

Reagents and materials. Glass microbeads (average diameter, 250 �m),3-aminopropyltrimethoxysilane, a 2,4,6-trinitrobenzene sulfonic acid solu-tion, and 1,4-phenylene diisothiocyanate were purchased from Sigma-Aldrich(St. Louis, MO). PDMS was purchased from Dow Corning (Midland, MI).Other chemicals and solvents were analytical grade and were purchased fromSinopharm Chemcial Reagent Co. Ltd. (Shanghai, China). All reagents wereused directly without additional purification. The water was double distilled,processed to 18.2 M� with a Milli-Q water purification system (Millipore,Bedford, MA), and sterile. Oligonucleotide probes and primers (Table 1)were purchased from Songon Inc. (Shanghai, China), synthesized by standardphosphoramidite chemistry, and purified by reverse-phase high-performanceliquid chromatography. Some strains, purified genomic DNA, and the foodsamples were kindly provided by Shanghai Entry-Exit Inspection & Quaran-tine Bureau and Shanghai Jiao Tong University. Purified genomic DNA from27 reference strains, including Salmonella sp. strains CMCC50098,CMCC50001, CMCC50004, CMCC50017, CMCC50335, and CMCC50770, S.aureus ATCC 8095, ATCC 6538, ATCC 13565, ATCC 27664, ATCC 12600,ATCC 25923, ATCC 27661, and ATCC 29213, L. monocytogenes ATCC 7644,ATCC 27708, ATCC 13313, and ATCC 13932, V. parahaemolyticus ATCC17802 and ATCC 33846, Shigella sp. strains CMCC51334, AS1.1869, andAS1.1868, E. sakazakii ATCC 29544 and ATCC 50205, E. coli O157:H7 strainATCC 43889, and C. jejuni ATCC 29428, were used in this study.

Bead modification and oligonucleotide probe immobilization. The isothiocya-nate-modified beads and probe-immobilized beads were prepared using a pre-viously described method (34). Prepared probe-modified beads were stored in avacuum at room temperature.

BMS. The operating principle of the BMS is shown schematically in Fig. 1. Thecore component of the BMS was the PDMS mesofluidic reaction chamber, whichwas filled with glass beads in PDMS microchannels. A silicon wafer with apattern made of SU-8 by photolithography was used to cast the PDMS mesoflu-idic mold. PDMS was mixed well with a curing agent at a ratio of 10:1 (wt/wt),and then the mixture was poured onto the silicon wafer, which had been fumi-gated by fluoroalkyl silanes. Subsequently, the master mold with the PDMS wasthen placed in a vacuum desiccator for approximately 15 min to help remove airbubbles from the PDMS that were introduced when the curing agent was stirredin. Then the master mold with PDMS was removed from the desiccator andplaced on an 80°C hot plate for 1 h to cure. After the PDMS on the master moldcured, it was lifted off. Then the PDMS device was bonded to a glass slide usingan oxygen plasma bonder (PDC-002; Harrick Scientific Corp., United States).Inside the plasma bonder, the bonding surfaces of the slide (25 mm by 75 mm by1 mm) and the PDMS chip were exposed to high-energy plasma, which strippedaway electrons on the surface. This caused the surfaces to become hydrophilic.When the two hydrophilic surfaces came into contact, they formed a strong bond.The integrated mesofluidic chamber device was fabricated by sealing with a glassslide, which contained access holes for connection of mesofluidic fittings (Fig. 1Aand B). The entire process was performed using the methods described previ-ously (43).

The BMS was assembled with a programmable multichannel peristaltic pump(KH-07550; Cole-Parmer, United States), a valve, the mesofluidic chamber, andsome reagent vessels using silicone tubing (Fig. 1C).

The entire analysis procedure in the mesofluidic system, including bead load-ing, washing, hybridization, and reagent injection, was automatically carried outby using a multichannel peristaltic pump. First, the glass beads attached witholigonucleotide probes were pumped in triplicate into the PDMS microchannelsin a predetermined order. The inlet capillary was connected to the samplereservoir, and the outlet capillary was connected to the waste reservoir throughthe peristaltic pump. The inner wall of the microchannels and the glass beadswere washed with 0.2% sodium dodecyl sulfate (SDS) and double-distilled H2Ofor 10 min, respectively. The short sequences of nucleic acids (21 bases) or PCRproducts in hybridization solution (4� SSC-0.1% SDS [1� SSC is 0.15 M NaClplus 0.0.15 M sodium citrate]) were injected into the microchannels, and thehybridization fluid was allowed to flow back and forth in the microchannels at42°C for several minutes. After the reaction, 1� SSC-0.03% SDS, 0.2� SSC, and0.05� SSC were sequentially infused again into the microchannels to wash thebeads (5 min each). The flow rate of the solution was 20 �l/min.

Detection of complementary oligonucleotides. One 21-mer synthetic targetoligonucleotide, Tial (Cy5-AGAGTGGGGTTTGATGGACAA), which was spe-cific for the IAL probe, was selected to investigate the performance of thesystem. To characterize the response of the system to the synthetic target oligo-nucleotide Tial, solutions with various concentrations of Tial were flowed throughthe modified beads in microchannels. The hybridization time (Tial retention timein microchannels) could be controlled using the flow rate.

Detection of PCR products of pathogens. Eight target genes were employed tospecifically identify eight pathogens as described previously (23). The prs geneencoding phosphoribosyl pyrophosphate synthetase is specific for L. monocyto-genes (10), the hyd gene encoding a putative cell wall-associated hydrolase isspecific for Salmonella spp. (23), the nuc gene encoding a micrococcal nucleaseis specific for S. aureus (35), the VP1316 gene encoding a transcriptional regu-lator of the LysR family is specific for V. parahaemolyticus (44), the hipO geneencoding a hippuricase is specific for C. jejuni (19), the hlyA gene encodinghemolysin is specific for E. coli O157:H7 (38), the sg fragment of the 16S-23SrRNA intergenic spacer is specific for E. sakazakii (22), and the ial fragmentencoding a component of the Mxi-Spa secretion machinery is specific for Shigellaspp. (15).

Portions (25 g or 25 ml) of food samples were homogenized with 225 ml 2YTliquid medium (16.0 g/liter tryptone, 10.0 g/liter yeast extract, 5.0 g/liter NaCl; pH7.0), and the mixtures were incubated at 37°C for 8 h. Genomic DNAs ofpathogens were extracted by the boiling method (1). The cultured bacteria in 1ml were put into a 1.5-ml tube and centrifuged for 5 min at 12,000 rpm, and thesupernatant was discarded. Then the bacterial precipitate was washed in Tris-HCl–EDTA buffer twice and centrifuged at 12,000 rpm for 3 min, and thesupernatant was discarded. Then the bacterial precipitate was added to 1 mldiethyl pyrocarbonate-treated H2O to redisperse the cells and boiled for 10 min.The tube was centrifuged for 5 min at 12,000 rpm to obtain a supernatant forPCR. Amplification of the target genes was carried out using a 50-�l reaction

FIG. 1. Operation of the BMS. (A) Profile of microchannels filledwith glass beads; (B) side view of microchannels formed by PDMS andslides; (C) schematic diagram of the flow in the BMS. The arrowsindicate the direction of fluid flow.

6648 JIN ET AL. APPL. ENVIRON. MICROBIOL.

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

mixture containing 1� PCR buffer (Mg2� Plus), 0.2 �M of each primer (Table1), 0.2 mM of each deoxynucleoside triphosphate, 2.5 U of polymerase (rTaq;TaKaRa, Japan), and 50 to �100 ng of genomic DNA. PCR amplification wasperformed with a thermal cycler (PTC-225; MJ Research), using the followingprogram: initial denaturation at 96°C for 5 min, followed by 30 cycles of 96°C for45 s, 56°C for 45 s, and 72°C for 45 s and then a final extension at 72°C for 10 min.PCR products were labeled by second-round PCR amplification with univer-sal Cy5-modified primers FL1-1 (5�-ATGGTGTAAACTTGTACCAG-3�)and FL1-2 (5�-Cy5-TTGGTAGCAGCGGTAGAGTTG-3�). The PCR wasperformed as follows. A 5-�l PCR mixture was used, and sequences wereamplified using 12 to 15 cycles of 96°C for 30 s, 55°C for 1 min, and 72°C for 30 s.All PCR products were analyzed by 1% agarose gel electrophoresis. The fluo-rescent PCR products were used directly without further purification. PCRproducts were purified by using a QIAquick PCR purification kit (Qiagen,Germany) and then quantified with a NanoDrop ND-1000 spectrophotometer(NanoDrop Technologies, DE) to determine the sensitivity of the BMS.

Beads precoated with different probes were serially pumped into a singlemicrochannel in the following order: NUC, VP, PRS, C20, SG, IAL, HLY, HIP.Each bead set was processed in triplicate. Multiple prepared microchannels wereoperated in parallel simultaneously. Hybridization solutions (50 �l; 4� SSC-0.1% SDS) containing different pathogen PCR products were injected into pre-pared microchannels at a flow rate of 20 �l/min. The hybridization reactionmixture was kept at 42°C for 30 min. After hybridization, the beads in micro-channels were washed with 1� SSC-0.03% SDS, 0.2� SSC, and then 0.05� SSC(5 min each).

Scanning and data analysis. The mesofluidic chip was scanned with a Genepix4000B scanner (Axon Instruments, Foster City, CA) at a resolution of 5 �m fora Cy5 optical filter. The laser power and photomultiplier tube voltage were set toobtain optimum signal intensities. Spot analysis and quantification of the original

16-bit TIF images were performed with the Genepix software (v5.0). In addition,the mesofluidic chip could also be scanned in line by integrating the fluorescencedetection device into the system.

RESULTS AND DISCUSSION

To demonstrate the potential and performance of the BMSmethod, an initial set of experiments was carried out to detectthe targets of oligonucleotides and PCR products complemen-tary to different probes on the beads. Synthetic target oligonu-cleotide Tial and the PCR product of ial specific for the IALprobe were used to illustrate the specificity and sensitivity ofthe hybridization on beads.

PCR amplification and design of probes. Primers with theuniversal sequences were selected to amplify eight targetgenes, and the products (264 to 465 bp) were specific for thepathogens tested (23). The results demonstrated that theseprimers can specifically amplify the target genes (Fig. 2). Am-plification of target genes can also be carried out using multi-plex PCR (data not shown). The probes were also carefullyselected to achieve unambiguous identification of each patho-gen. Eight 20-bp oligonucleotide probes, NUC, VP, PRS, C20,SG, IAL, HLY, and HIP, were designed with the Primer3program to hybridize specifically with the target genes repre-

TABLE 1. Sequences of primers and probes for eight pathogens

Pathogen

Primer Probe

Primer Sequence (5�–3�)aGenBankaccession

no.Probe Sequence (5�–3�)b

S. aureus NUC-F TTGGTAGCAGCGGTAGAGTTGATCATTATTGTAGGTGTATTAGC

BA000017 NUC GTCCCCTTTTTGAAAGGACC

NUC-R ATGGTGTAAACTTGTACCAGCAGGCGTATTCGGTTTC

V. parahaemolyticus VP-F ATGGTGTAAACTTGTACCAGAACTGACGCTTGTTGAGG

BA000031 VP CAGTGAAGAGCACGGTTTCA

VP-R TTGGTAGCAGCGGTAGAGTTGAAACTCCTGCCTGACGAT

L. monocytogenes PRS-F ATGGTGTAAACTTGTACCAGGCTGAAGAGATTGCGAAAGAAG

EF110565 PRS CGAAACTGCTGGTGCAACTA

PRS-R TTGGTAGCAGCGGTAGAGTTGCAAAGAAACCTTGGATTTGCGG

Salmonella C20-F ATGGTGTAAACTTGTACCAGACCGCTGGTGAAACGACA

AE008786 C20 TAACCTCCTCTTTCCAGCGA

C20-R TTGGTAGCAGCGGTAGAGTTGGCGACGGCAGTGCTTATT

E. sakazakii SG-F ATGGTGTAAACTTGTACCAGGGGTTGTCTGCGAAAGCGAA

AY702093 SG CGTAATAAGAAATGCGCGGT

SG-R TTGGTAGCAGCGGTAGAGTTGGTCTTCGTGCTGCGAGTTTG

Shigella IAL-F TTGGTAGCAGCGGTAGAGTTGCTGGATGGTATGGTGAGG

AY206439 IAL TGTCCATCAAACCCCACTCT

IAL-R ATGGTGTAAACTTGTACCAGGGAGGCCAACAATTATTTCC

E. coli O157:H7 HLY-F ATGGTGTAAACTTGTACCAGCAGTAGGGAAGCGAACAGAG

AY495950 HLY ACAGGAGGAAGCGGTAATGA

HLY-R TTGGTAGCAGCGGTAGAGTTGAAGCTCCGTGTGCCTGAAGC

C. jejuni HIP-F TTGGTAGCAGCGGTAGAGTTGGGCAATGATAGAAGATGG

Z36940 HIP TTTGCCTTTTCTGGAGCACT

HIP-R ATGGTGTAAACTTGTACCAGATTAGCCTGTGCAAGACC

a Underlining indicates sequences that are universal primers for the second round of PCR amplification.b Each oligonucleotide probe is modified with 16-mer poly(T) and an amino group at 5� end.

VOL. 75, 2009 DETECTION OF PATHOGENS WITH MESOFLUIDIC CHIP 6649

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

senting eight pathogens (Table 1). The specificity of probeswas also investigated. As shown in Fig. 3, when oligonucleotideTial specific for the IAL probe was used for hybridization, onlythe beads carrying the IAL probe produced a strong signal,whereas the other beads showed very low signals close to thebackground signal. The other probes exhibited similar signalpatterns. The specificities of all of the probes were also exam-ined and confirmed with a microarray using PCR products of27 reference strains (data not shown). The results also stronglyindicated that probes NUC, VP, PRS, C20, SG, IAL, HLY,and HIP were specific for S. aureus, V. parahaemolyticus, L.monocytogenes, Salmonella spp., E. sakazakii, Shigella spp., E.coli O157:H7, and C. jejuni, respectively.

Surface density of probes on beads. The effect of the probeconcentration on probe immobilization was also studied. Ifdifferent probe concentrations generate different densities ofimmobilized probes on the bead surface, the hybridizationefficiency is directly affected. Synthetic target oligonucleotideTial and the PCR product of ial were hybridized with the beadsprecoated with five different concentrations of probe IAL. Asshown in Fig. 4, the hybridization signal increased with theprobe concentration from 0.1 �M to 3.0 �M for targets of boththe oligonucleotide and PCR products. However, the hybrid-ization signal decreased when the probe concentration was 5.0�M. The data clearly demonstrated that the highest value forhybridization signal was obtained with beads prepared with 3.0�M probe, while the amounts of hybridized targets decreasedand the signals were relatively low when beads with higherprobe concentrations (5.0 �M) were used. These observations

were consistent with the finding of Le Berre et al. (20) andPeterson et al. (27) that a higher probe density could reducethe efficiency of duplex formation and kinetics of the targetcapture procedure. The reason for the decreased hybridizationintensity may be steric and electrostatic interference that pre-vents target access for hybridization with probes. Therefore, aprobe concentration of 3.0 �M was chosen as the workingconcentration in the following experiments. Based on our pre-vious work (34), the concentration of the DNA probes on thesurface was estimated to be 5 � 1013 to 7 � 1013 probes/cm2

when 3.0 �M probe was used for immobilization.Fast hybridization of oligonucleotide and PCR products.

The influence of hybridization time was also investigated. Thesynthetic target oligonucleotide Tial (50 �l of a 108 M prep-aration) was hybridized with beads precoated with oligonucle-otide probe IAL at room temperature for different times(range, 1 min to 20 min). As shown in Fig. 5, the hybridizationwas faster in microchannels than in bulk solutions. The signalobtained at 5 min was about 95% of the saturated value.Besides oligonucleotide samples, the PCR product of the ialgene (361 bp), amplified from pathogen cultures, was alsotested. Compared with oligonucleotides, PCR products usuallyrequire more hybridization time (such as overnight incuba-tion). Accordingly, PCR products (50 �l) were pumped at aflow rate of 20 �l/min and hybridized to beads in microchan-

FIG. 2. PCR products of eight pathogens visualized by agarose gelelectrophoresis. Lane M, DL2000 marker; lane 1, S. aureus; lane 2, V.parahaemolyticus; lane 3, L. monocytogenes; lane 4, Salmonella; lane 5,E. sakazakii; lane 6, Shigella; lane 7, E. coli O157:H7; lane 8, C. jejuni.

FIG. 3. Fluorescence values for the eight types of beads hybridizedwith synthetic target oligonucleotide Tial.

FIG. 4. Influence of probe concentration. Beads that were pre-coated with five different concentrations of probe IAL were hybridizedwith synthetic target oligonucleotide Tial (f) at room temperature for20 min and with the PCR product of ial (F) at 42°C for 30 min.

FIG. 5. Effect of the hybridization time for synthetic target oligo-nucleotide Tial (f) at room temperature and for the PCR product ofial (F) at 42°C.

6650 JIN ET AL. APPL. ENVIRON. MICROBIOL.

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

nels at 42°C for 5 min to 45 min by using stop-flow incubation.It was found that longer hybridization times resulted in stron-ger signals, and the maximum hybridization signal was ob-served at 30 min. The results obtained demonstrated that thehybridization efficiency could be enhanced greatly by the me-sofluidic flow assay. Remarkably, the hybridization time re-quired in the BMS assay was reduced to 30 min, whereas for atraditional slide microarray the hybridization time is up to 4 hor overnight. The fast hybridization of BMS was attributedmainly to a higher mass transfer velocity in the flow reaction.

Reproducibility and number of beads. An attractive featureof the BMS method with a series of beads is the possibility ofparallel detection of several microorganisms in a single micro-channel. The number of beads used in the BMS method rep-resents the throughput for analysis (like spots of a microarray).The effect of the number of beads was also investigated. PCRproducts (50 �l) of the ial gene in 4� SSC-0.1% SDS wereinjected into microchannels with different numbers of beadsprecoated with the IAL probe (10, 20, 50, 60, and 100 beads).The results are shown in Fig. 6. When the number of beads wasin the range from 10 to 100, no significant change of thefluorescence intensity was observed. The method revealed thatthere was good reproducibility with a variation coefficient of11.0%.

Sensitivity of the BMS method for DNA targets. Analyticsensitivity is one of the most critical factors determining thepracticability of a detection method. In our work, the sensitiv-ity of the BMS assay for detection of a synthetic target oligo-nucleotide and a PCR product was tested. Dilutions of thesynthetic target oligonucleotide and PCR product were used todetermine the limits of detection. Figure 7 shows the correla-tion of the signal intensity with the concentration of DNAtargets. The fluorescence intensity increased linearly with theconcentration from 1012 to 106 M and then reached equi-librium for synthetic target oligonucleotide. Clearly, the BMSmethod showed a strong response even for target oligonucle-otides at subnanomolar concentrations. The results demon-strated that the target oligonucleotides can be detected at aconcentration of 1012 M. This is a remarkable improvementcompared to the biosensor method (28) and the microarraymethod (37), which detected 200 pM and 1.0 nM. The PCR

products were diluted to obtain a series of concentrations from1012 to 106 M. The minimum concentration measured inthis work was 108 M with a hybridization time of 30 min.

Detection of pathogenic bacteria. To evaluate the analyticalperformance and to assess the applicability of the method,PCR products of pathogenic bacteria were employed with theBMS method. As shown in Fig. 8, only the correspondingbeads exhibited high fluorescence intensities. Two or morepathogens can also be detected simultaneously with the BMSmethod. In most cases, the ratio of the intensities of the positivesignals to the intensities of the negative signals (beads with the20-bp random oligonucleotide) in all experiments exceeded 5:1.Here we used an intensity ratio of 5:1 as the threshold to catego-rize the positive and negative signals. The results demonstratedthat the BMS method has excellent specificity for eight patho-genic bacteria. The detection limits of the BMS were determinedwith the following eight strains: Salmonella enterica serovar TyphiCMCC50098, S. aureus ATCC 8095, L. monocytogenes ATCC7644, V. parahaemolyticus ATCC 17802, Shigella sonneiCMCC51334, E. sakazakii ATCC 29544, E. coli O157:H7 strainATCC 43889, and C. jejuni ATCC 29428. Serially diluted bac-terial cultures (1 ml) were used to extract genomic DNAs,which were used as templates to identify the bacteria by theBMS method. Meanwhile, 200-�l serially diluted bacterial cul-tures were employed for cell counting on plates. It was foundthat the detection limits of the BMS method were about 500 to6,000 CFU/ml for these pathogens (Table 2).

As a proof of principle for detection of microorganisms incontaminated food, we examined the detection of pathogenicbacteria in endogenously infected samples (�500 to 6,000CFU/ml). A total of 184 contaminated food samples fromdifferent matrices were tested by the BMS method; these sam-ples included 43 egg samples, 46 pork samples, 42 chickensamples, 20 shellfish samples, 23 fish samples, 5 ice creamsamples, and 5 milk power samples. The results obtained withthe BMS method were completely consistent with the resultsobtained with traditional culture and biochemical identifica-tion methods (Table 2). The pathogens in all food sampleswere accurately determined and identified by our method,whereas traditional bacteriology was considered the “goldstandard.” This indicated that the BMS method can success-fully detect pathogens in contaminated food samples.

FIG. 6. Average fluorescence intensity of all beads in a channel,showing the influence of the number of beads. Each channel containeda different number of beads. PCR products were hybridized with beadsat 42°C for 30 min.

FIG. 7. Effects of target concentrations of the synthetic target oli-gonucleotide (f) from 1014 to 105 M, of the PCR product (Œ) from1012 to 6.45 � 106 M, and of control DNA (F).

VOL. 75, 2009 DETECTION OF PATHOGENS WITH MESOFLUIDIC CHIP 6651

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

FIG. 8. Detection of PCR products of one, two, three, or four pathogens by the BMS method.

6652 JIN ET AL. APPL. ENVIRON. MICROBIOL.

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

In this study, an integrated mesofluidic system comprising abead-based mesofluidic device, a valve, and a peristaltic pumpwas developed for pathogen detection. This system provides aplatform for injection, transport, and manipulation ofprobe-modified beads in PDMS channels to facilitate hy-bridization. All operations, including bead-infusing, hybrid-ization, and washing steps, can be carried out simply by con-trolling the peristaltic pump. The hybridization reaction couldbe completed in 30 min. This process, conducted in microchan-nels, could reduce the sample volume required and protect theliquids from evaporation and cross contamination. A practicalapplication for the mesofluidic system was confirmed based onits ability to determine microorganisms in food samples. Thismethod is fast, has high sensitivity, and can be automated tocarry out parallel and high-throughput detection. The mi-crobeads improved the assay sensitivity by increasing the activecapture area and also decreased the variability and hybridiza-tion times. The flexible nature of the BMS method allowsbeads precoated with new probes to be added easily. Indeed,the use of different multiplex probe-modified beads in mesoflu-idic devices should open up new flexible, high-throughput ap-proaches for bioanalysis.

ACKNOWLEDGMENTS

This work was financially supported by China NSF (grants 20627005and 20776039), by the Shanghai Project (grants 07dz19508 and09JC1404100), by SKLBE 2060204, and by Shuguang 06SG32.

We acknowledge the help with the multiplex PCR and culture ofpathogens provided by X. M. Shi and C. Lu of Shanghai Jiao TongUniversity and by M. Gu of the Shanghai Entry-Exit Inspection &Quarantine Bureau.

REFERENCES

1. Afghani, B., and H. R. Stutman. 1996. Polymerase chain reaction for diag-nosis of M. tuberculosis: comparison of simple boiling and a conventionalmethod for DNA extraction. Biochem. Mol. Med. 57:14–18.

2. Aysan, Y., N. Yildiz, and F. Yucel. 2004. Identification of Pseudomonasviridiflava on tomato by traditional methods and enzyme-linked immunosor-bent assay. Phytoparasitica 32:146–153.

3. Beyor, N., T. Seo, P. Liu, and R. Mathies. 2008. Immunomagnetic bead-based cell concentration microdevice for dilute pathogen detection. Biomed.Microdevices 10:909–917.

4. Bodrossy, L., and A. Sessitsch. 2004. Oligonucleotide microarrays in micro-bial diagnostics. Curr. Opin. Microbiol. 7:245–254.

5. Buchanan, R. L., and F. J. Schultz. 1994. Comparison of the Tecra VIA kit,Oxoid BCET-REPLA kit, and CHO cell culture assay for the detection ofBacillus cereus diarrhoeal enterotoxin. Lett. Appl. Microbiol. 19:353–356.

6. Call, D. R. 2005. Challenges and opportunities for pathogen detection usingDNA microarrays. Crit. Rev. Microbiol. 31:91–95.

7. Clarridge, J. E. 2004. Impact of 16S rRNA gene sequence analysis foridentification of bacteria on clinical microbiology and infectious diseases.Clin. Microbiol. Rev. 17:840–862.

8. Day, T. L., S. R. Tatani, S. Notermans, and R. W. Bennnett. 1994. Acomparison of ELISA and RPLA for detection of Bacillus cereus diarrhoealenterotoxin. J. Appl. Bacteriol. 77:9–13.

9. de la Rosa, C., P. A. Tilley, J. D. Fox, and K. V. Kaler. 2008. Microfluidicdevice for dielectrophoresis manipulation and electrodisruption of respira-tory pathogen Bordetella pertussis. IEEE Trans. Biomed. Eng. 55:2426–2432.

10. Doumith, M., C. Buchrieser, P. Glaser, C. Jacquet, and P. Martin. 2004.Differentiation of the major Listeria monocytogenes serovars by multiplexPCR. J. Clin. Microbiol. 42:3819–3822.

11. Fischer, B., L. D. Mao, M. Gungormus, C. Tamerler, M. Sarikaya, and H.Koser. 2008. Ferro-microfluidic device for pathogen detection, p. 907–910.In Proceedings of the 3rd IEEE International Conference on Nano/MicroEngineered and Molecular Systems, vol. 1. IEEE, Los Alamitos, CA.

12. Fricker, M., U. Messelhausser, U. Busch, S. Scherer, and M. Ehling-Schulz.2007. Diagnostic real-time PCR assays for the detection of emetic Bacilluscereus strains in foods and recent food-borne outbreaks. Appl. Environ.Microbiol. 73:1892–1898.

13. Gergova, R. T., I. D. Iankov, I. H. Haralambieva, and I. G. Mitov. 2007.Bactericidal monoclonal antibody against Moraxella catarrhalis lipooligosac-charide cross-reacts with Haemophilus spp. Curr. Microbiol. 54:85–90.

14. Institute of Food Technologists. 2004. Scientific status summary: bacteriaassociated with foodborne diseases. IFT, Chicago, IL. http://www.ift.org/.

15. Islam, D., and A. A. Lindberg. 1992. Detection of Shigella dysenteriae type 1and Shigella flexneri in feces by immunomagnetic isolation and polymerasechain reaction. J. Clin. Microbiol. 30:2801–2806.

16. Jothikumar, N., and M. W. Griffiths. 2002. Rapid detection of Escherichiacoli O157:H7 with multiplex real-time PCR assays. Appl. Environ. Microbiol.68:3169–3171.

17. Kell, A. J., G. Stewart, S. Ryan, R. Peytavi, M. Boissinot, A. Huletsky, M. G.Bergeron, and B. Simard. 2008. Vancomycin-modified nanoparticles forefficient targeting and preconcentration of Gram-positive and Gram-nega-tive bacteria. ACS Nano. 2:1777–1788.

18. Kim, H. J., S. H. Park, T. H. Lee, B. H. Nahm, Y. R. Kim, and H. Y. Kim.2008. Microarray detection of food-borne pathogens using specific probesprepared by comparative genomics. Biosens. Bioelectron. 24:238–246.

19. LaGier, M. J., L. A. Joseph, T. V. Passaretti, K. A. Musser, and N. M. Cirino.2004. A real-time multiplexed PCR assay for rapid detection and differen-tiation of Campylobacter jejuni and Campylobacter coli. Mol. Cell. Probes18:275–282.

20. Le Berre, V., E. Trevisiol, A. Dagkessamanskaia, S. Sokol, A. M. Caminade,J. P. Majoral, B. Meunier, and J. Francois. 2003. Dendrimeric coating ofglass slides for sensitive DNA microarrays analysis. Nucleic Acids Res. 31:e88.

21. Lin, F. Y. H., P. M. Sherman, and D. Q. Li. 2004. Development of a novelhand-held immunoassay for the detection of enterhemorrhagic Escherichiacoli O157:H7. Biomed. Microdevices 6:125–130.

22. Liu, Y., Q. L. Gao, X. Zhang, Y. M. Hou, J. L. Yang, and X. T. Huang. 2006.PCR and oligonucleotide array for detection of Enterobacter sakazakii ininfant formula. Mol. Cell. Probes 20:11–17.

23. Lu, C. Y., C. L. Shi, C. X. Zhang, J. Chen, and X. M. Shi. 2009. Developmentof single base extension-tags microarray for the detection of food-bornepathogens. Chin. J. Biotechnol. 25:554–559.

24. Lucarelli, F., G. Marrazza, A. P. Turner, and M. Mascini. 2004. Carbon andgold electrodes as electrochemical transducers for DNA hybridization sen-sors. Biosens. Bioelectron. 19:515–530.

25. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro,P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in theUnited States. Emerg. Infect. Dis. 5:607–625.

26. Panicker, G., D. R. Call, M. J. Krug, and A. K. Bej. 2004. Detection ofpathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA mi-croarrays. Appl. Environ. Microbiol. 70:7436–7444.

27. Peterson, A. W., R. J. Heaton, and R. M. Georgiadis. 2001. The effect ofsurface probe density on DNA hybridization. Nucleic Acids Res. 29:5163–6168.

28. Piliarik, M., L. Parova, and J. Homola. 2009. High-throughput SPR sensorfor food safety. Biosens. Bioelectron. 24:1399–1404.

29. Radke, V. 2006. The need for partnerships for food safety. J. Environ. Health69:34–35.

30. Rijpens, N. P., and L. M. F. Herman. 2002. Molecular methods for identi-fication and detection of bacterial food pathogens. J. AOAC Int. 85:984–995.

31. Romanova, N., S. Favrin, and M. W. Griffiths. 2002. Sensitivity of Listeria

TABLE 2. Detection results for 184 naturally contaminatedfood samples

Pathogen

Detectionlimit ofBMS

(CFU/ml)a

No. ofsamples

Results of:

BMSbTraditional culture

and biochemicalidentificationc

Salmonella 5 � 102 73 � �S. aureus 1 � 103 46 � �L. monocytogenes 2 � 103 15 � �V. parahaemolyticus 6 � 103 40 � �Shigella 1.5 � 103 3 � �E. sakazakii 1.3 � 103 5 � �Enterohemorrhagic

E. coli O157:H71 � 103 1 � �

C. jejuni 1 � 103 1 � �

a The detection limits of the BMS were determined using the following eightstrains: S. enterica serovar Typhi CMCC50098, S. aureus ATCC 8095, L. mono-cytogenes ATCC 7644, V. parahaemolyticus ATCC 17802, S. sonnei CMCC51334,E. sakazakii ATCC 29544, E. coli O157:H7 strain ATCC 43889, and C. jejuniATCC 29428. After bacterial DNA was extracted from serially diluted bacterialcultures, it was subjected to PCR amplification for BMS detection of pathogens.

b �, pathogen detected.c Determined using China National Standard GB/T 4789-2003.

VOL. 75, 2009 DETECTION OF PATHOGENS WITH MESOFLUIDIC CHIP 6653

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

monocytogenes to sanitizers used in the meat processing industry. Appl.Environ. Microbiol. 68:6405–6409.

32. Rooney, R. M., E. H. Cramer, S. Mantha, G. Nichols, J. K. Bartram, J. M.Farber, and P. K. Benembarek. 2004. A review of outbreaks of foodbornedisease associated with passenger ships: evidence for risk management. Pub-lic Health Rep. 119:427–434.

33. Schunk, M., T. Jelinek, K. Wetzel, and H. D. Nothdurft. 2001. Detection ofGiardia lamblia and Entamoeba histolytica in stool samples by two enzymeimmunoassays. Eur. J. Clin. Microbiol. Infect. Dis. 20:389–391.

34. Sheng, H., and B. C. Ye. 2009. Different strategies of covalent attachment ofoligonucleotide probe onto glass beads and the hybridization properties.Appl. Biochem. Biotechnol. 152:54–65.

35. Tang, J. N., X. M. Shi, C. L. Shi, and H. C. Chen. 2006. Characterization ofa duplex polymerase chain reaction assay for the detection of enterotoxigenicstrains of Staphylococcus aureus. J. Rapid Methods Autom. Microbiol. 14:201–217.

36. Vora, G. J., C. E. Meador, D. A. Stenger, and J. D. Andreadis. 2004. Nucleicacid amplification strategies for DNA microarray-based pathogen detection.Appl. Environ. Microbiol. 70:3047–3054.

37. Wang, L., and P. C. H. Li. 2007. Flexible microarray construction and fastDNA hybridization conducted on a microfluidic chip for greenhouse plantfungal pathogen detection. J. Agric. Food Chem. 55:10509–10516.

38. Wang, R. F., W. W. Cao, and C. E. Cerniglia. 1997. A universal protocol forPCR detection of 13 species of foodborne pathogens in foods. J. Appl.Microbiol. 83:727–736.

39. West, J., M. Becker, S. Tombrink, and A. Manz. 2008. Micro total analysissystems: latest achievements. Anal. Chem. 80:4403–4419.

40. Wolffs, P. F. G., K. Glencross, R. Thibaudeau, and M. W. Griffiths. 2006.Direct quantitation and detection of salmonellae in biological samples with-out enrichment, using two-step filtration and real-time PCR. Appl. Environ.Microbiol. 72:3896–3900.

41. World Health Organization. 2007. Food safety and foodborne illness. WorldHealth Organization, Geneva, Switzerland. http://www.who.int/mediacentre/factsheets/fs237/en/.

42. World Health Organization. 2008. Initiative to estimate the global burden offoodborne diseases. Foodborne diseases—a growing risk. World Health Or-ganization, Geneva, Switzerland. http://www.who.int/foodsafety/foodborne_disease/ferg/en/.

43. Zhang, D., P. Zuo, and B. C. Ye. 2008. Bead-based mesofluidic system forresidue analysis of chloramphenicol. J. Agric. Food Chem. 56:9862–9867.

44. Zhu, D. S., M. Zhou, Y. L. Fan, and X. M. Shi. 2009. Identification of newtarget sequences for PCR detection of Vibrio parahaemolyticus by genomecomparison. J. Rapid Methods Autom. Microbiol. 17:67–69.

6654 JIN ET AL. APPL. ENVIRON. MICROBIOL.

on May 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from