Contents lists available at ScienceDirect

Materials Science & Engineering C

journal homepage: www.elsevier.com/locate/msec

Effect of Polyhydroxybutyrate/Chitosan/Bioglass nanofiber scaffold onproliferation and differentiation of stem cells from human exfoliateddeciduous teeth into odontoblast-like cells

Maryam Khoroushia, Mohammad Reza Foroughib,⁎, Saeed Karbasic, Batool Hashemibenid,Abbas Ali Khademie

a Dental Materials Research Center, Department of Operative Dentistry, School of Dentistry, Isfahan University of Medical Sciences, Isfahan, IranbDental Materials Research Center, School of Dentistry, Isfahan University of Medical Sciences, Isfahan, Iranc Department of Biomaterials and Tissue Engineering, School of Advanced Technologies in Medicine, Isfahan University of Medical Sciences, Isfahan, Irand Torabinejad Dentistry Research Center, Department of Anatomical Sciences and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan,Irane Torabinejad Dentistry Research Center, Department of Endodonics, School of Dentistry, Isfahan University of Medical Sciences, Isfahan, Iran

A R T I C L E I N F O

Keywords:ScaffoldStem cells from human exfoliated deciduousteeth (SHED)Odontogenic differentiationBone morphogenetic proteins-2 (BMP2)

A B S T R A C T

Scaffolds and their characteristics play a central role in tissue engineering. The purpose of this study was todetermine the effects of Polyhydroxybutyrate (PHB)/Chitosan/nano-bioglass (nBG) nanofiber scaffold madeusing the electrospinning method, on the proliferation and differentiation of stem cells obtained from humanexfoliated deciduous teeth into odontoblast-like cells. In this experimental study, the pulps of the molten de-ciduous teeth were isolated, thereafter, the stem cells from human exfoliated deciduous teeth (SHED) wereextracted and then the 3-(4,5-dimethylthiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay was used todetermine the cell viability percentage. The expression of some stem cell genes was studied by flowcytometry.These cells were then subjected to odontoblast by using the bone morphogenetic proteins-2 (BMP2) growthfactor in the differentiation medium and for the expression of their specific genes. Primers of collagen type-I,dentin sialophosphoprotein (DSPP) and alkaline phosphatase (ALP) were used and the percentage of differ-entiation to odontoblast cells in induction scaffolds was investigated using real-time PCR and im-munohistochemistry methods. The results revealed a 6-fold increase in the expression of DSPP genes and col-lagen type-I, and a 2-fold increase in the expression of ALP in scaffold with BMP2 group compared to the scaffoldas control group which according to the immunohistochemical test results, showed the extracted SHED to havebeen differentiated into dentin odontoblast-like cells. As a result, this scaffold can be used as a suitable substrateto apply in dentin tissue engineering.

1. Introduction

The source of the types of cells in the body is the stem cell, whichhas two important characteristics known as self-renewal and differ-entiation; Depending on the stem cells, these have power to become oneor more different cell types, which can be effective in the treatment ofvarious types of diseases [1]. The human dental pulp has phenotypiccharacteristics; hence the stem cells can be differentiated into othercells such as the nerve cells, fat cells, and odontoblast [2–4]. Recentevidence reveals the effects of dental pulp cells on the regeneration ofbone, cartilage and dental pulp tissue [5–7]. Hitherto, various studieshave been conducted on how these cells are extracted, proliferated and

differentiated, and many researchers have been trying to optimize theconditions for stem cell culture in order to induce the differentiation ofthese cells into odontoblast cells [8–10]. Stem cells from human ex-foliated deciduous teeth (SHED) can be differentiated into odontoblastcells [11]. SHED have been known as a stem cell population in primarytooth pulp [3]. Though it is accessible, SHED have the ability to becomeneurons, fat cells, osteoblasts and odontoblast, and can produce boneand dentin in the right environment [3]. The first group that starteddental pulp engineering was Mooney and Rutherford [12] in 1996, theiractivities stopped when they were confronted with unknown dentalstem cells that could be differentiated into odontoblast. Alternatively,in 2000, Gronthos et al. [13] discovered pulp cells that were able to

https://doi.org/10.1016/j.msec.2018.03.028Received 21 August 2017; Received in revised form 16 March 2018; Accepted 28 March 2018

⁎ Corresponding author.E-mail address: mr.foroughi@dnt.mui.ac.ir (M.R. Foroughi).

Materials Science & Engineering C 89 (2018) 128–139

Available online 30 March 20180928-4931/ © 2018 Published by Elsevier B.V.

T

produce dentin. In a study conducted by Iohara et al. [14] in 2004, thetransplantation of dental pulp that was exposed to dental pulp stemcells led to dentin reconstruction and the formation of a suitable dentinbridge. Lately, it has been revealed that these cells have the ability torecreate the tooth pulp in an in-vivo environment [15]. Wang et al. [16]was examined effect of poly(L-lactic acid) (PLLA) nanofiber scaffold onodontogenic differentiation of human dental pulp stem cells (hDPSc).Consistent with the in vitro studies, nanofibrous scaffolds promotedodontogenic differentiation and hard tissue formation after 8 weeks ofectopic transplantation in nude mice.

One of the important components of tissue engineering is the scaf-fold, which serves as a suitable platform for cellular proliferation,growth, and differentiation. Polymer base scaffolds are commonly usedin various medical branches due to their good hydrophilicity andflexibility. Polyhydroxybutyrate (PHB) is an artificial polymer that hasbeen weakened by the hydrolysis of ester bonds in physiological con-ditions and its attenuation releases the acidic products. The biode-gradation of PHB compared to other biodegradable polymers is slowand best for applications that require durable materials [17]. It wasreported that in simulated physiological conditions, the PHB frameworkloses about 18% of its volume over 60months [18]. One of the prop-erties of the nanoparticles in the scaffolds is helping to proliferate anddifferentiate stem cells into other cells. Therefore, the selection of asuitable growth factor for differentiation to a specific cell line is veryimportant.

Growth factors are involved in the differentiation of many cells andare a kind of cytokine. Bone morphogenetic proteins (BMP) is known toact as a regulator and agent for bone and cartilage growth, and canaffect other tissues and organs, such as the tooth [19,20]. This protein isincreasingly important in the process of dentin reconstruction anddentinogenesis [21–26]. However, the role of dentin-derived BMP inthe differentiation of dental pulp stem cells (DPSCs) is not completelydetermined. The main hypothesis of this study is how much BMP2 cancontribute to the differentiation of SHED into odontoblast. In 2010,Casagrande et al. [27] examined the effect of BMP2 growth factor onthe differentiation of SHED into odontoblast that were able to detectexisting antigens using dentin sialophosphoprotein (DSPP), MEPE andDMP-1 antigens in differentiated cells in odontoblast and confirm thedifferentiation of SHED. In tissue engineering, the action of growthfactors are very important at the onset and continued differentiation ofselective stem cells into odontoblast-like cells [28]. One of the proteinscalled DSPP, which is a non-collagen phosphorylation protein, has beenidentified for the process of odontoblast differentiation among severalother proteins [29,30]. DSPP is not only used to express odontoblast butalso to express osteoblast in a small amount [29–32]. Another proteinthat plays an important role in differentiating odontoblast is collagen.This is a protein found in the extracellular matrix of animals and is themost abundant protein in the body. Collagen type-I forms 90% of thebone and teeth dentin [33]. The synthesis of collagen is conducted byosteoblasts in the bone [34], chondroblast in the cartilage [35], odon-toblast in the teeth [33], smooth muscle cells in the wall of the bloodvessels and epithelial cells.

The purpose of this study was to investigate the adhesion, growthand proliferation of SHED on composite nanofiber scaffolds and toevaluate the differentiation of cells into odontoblast-like cells.

2. Materials and methods

The materials required for the manufacture of nanofiber scaffoldsinclude Polyhydroxybutyrate (PHB), Chitosan and Trifluoroacetic acid(TFA) (Sigma Aldrich, USA) and Nanobioglass [36]. Materials used todifferentiate SHED are MTA powder (ProRoot MTA, Densply, USA),BMP2 (Peprotech, USA), Dentin sialophosphoprotein (DSPP) antibody(Abgent, USA), Collagen type-1 antibody (Ptglab, USA), Anti-RabbitSecondary Antibody (Rockland-inc, USA), DSPP, Alkaline phosphatase(ALP) and Collagen type-I specific primers from BIONEER South Korea.

2.1. Fabrication of electrospinning scaffold of PHB/Chitosan/Bioglassnanofibers

In this stage, the PHB polymer powder having a constant con-centration of 9 wt%, as the optimum concentration, was weighed usinga digital scale [36]. To prepare each desired concentration, the ap-propriate amount of PHB was dissolved at a temperature of 40 °C andfor 20min in a Trifluoroacetic acid (TFA) solvent. After PHB wascompletely dissolved in TFA, 15 wt% of chitosan was added to themixture for 20min at 40 °C. Thereafter, 10 wt% of bioglass nano-particles was added to the polymer/chitosan solution, and again, themixture was placed under a stirrer for 30min. To achieve a better andmore uniform dispersion while preventing particle agglomeration, thesolution was also processed for 60min by a homogenizer, and thenimmediately electrospinning was done with the desired conditions. Todetermine the effect of electrospinning parameters on the developedscaffolds, two important parameters affecting the fiber diameter, i.e. theelectric potential of the spinning machine, and the spacing between thesyringe needle and the collector, were considered as variable para-meters of the electrospinning operation. In other words, the authorsprepared different samples for two different values of the electric po-tential (17 kV) and two different values of the needle-collector spacing(14 cm). Once the syringe was prepared, 1ml of the composite solutionwas put into the spinning machine, and the electrospinning operationwas performed on aluminum foil.

2.2. Measurement of porosity and mechanical properties of scaffold

To measure the density and porosity of electrospun scaffolds,1× 2 cm samples of scaffolds were prepared, weighed by a scale, andhad their thickness measured by a thickness gauge. In the end, thedensity and porosity of the samples were calculated through the methodof Vi and Juvi using Eqs. (1) and (2) [33]. It should be noted that eachsample had three replications and the reported values are the average ofthree measurements.

= ⎛⎝ ×

⎞⎠

Scaffold density Scaffold massScaffold area Scaffold thikness (1)

⎜ ⎟= ⎛⎝

− ⎞⎠

×Scaffold prosity (%) 1Scaffold density

Bulk density100

(2)

The bulk density was calculated by immersing in a fluid with knowndensity [34,35]. In this method, the scaffold was weighed and thensubmerged into a specific fluid such as water or ethanol for 24 h, al-lowing the fluid to fully penetrate the scaffold's body (this study usedphosphate buffer solution with a density of 0.995 g/cm3 for this pur-pose). After 24 h, the scaffold was dried and was weighed again. Thedifference between the two measured weights revealed the extent ofpenetration of the fluid into the scaffold.

The mechanical properties of developed scaffolds were evaluated bytensile test conducted in accordance with DIN EN ISO 2062 standard. Inthis test, the samples had a dimension of 60×10mm, load cell was50 N, and the distance between the two jaws was 10mm. To providetest reproducibility, each scaffold sample had three replications. Tensiletest was performed using Zwick/Material Prufung1446 test machinewith tension rate of 10mm per minute. The test results were then or-ganized in terms of elastic modulus, tensile strength and elongation.

2.3. Extraction of mesenchymal stem cells from pulp of deciduous teeth

Three healthy naturally fallen teeth (from 3 healthy children aged 6to 11 years) were extracted and collected for mesenchymal stem cells.Two to five days before tooth extraction, the patients underwent fullhealth education and full professional prophylaxis of the teeth usingbrushes and pumice dough to reduce the amount of plaque and debrisas much as possible, thereby, minimizing microbial contamination in

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

129

the culture medium. Professional prophylaxis was performed again forpatients on the day of extraction. After adequate local anesthetic in-jection, the patients rinsed their mouth with a 0.12% chlorhexidinemouthwash twice, each time for 1min to minimize contamination ofthe culture medium. Tooth extraction was performed under sterilesurgical procedures using sterile gloves after oral disinfection with io-dine solution, and immediately after extraction, the remaining pulp ofthe teeth was extracted by spoon excavator or endodontic files from theapical end of the analyzed root with minimum trauma and immersed ina PBS solution. Sterile equipment was also used. After washing the teethin PBS solution containing 1% of antibiotic penicillin/streptomycin, thepulp tissue was removed from the teeth and washed again in the so-lution. For the cell culture, the pulp tissue was placed in a solution of4mg/ml collagenase type-I at 37 °C. After 1 h, the lysed tissue wasconverted to single cell type using the pipetting technique, and added tothe medium containing Minimum Essential Medium Eagle Alpha (α-MEM) and 15% ES-FSC, and was then centrifuged for 10min at1200 rpm. The cell was mixed again with the medium and culturedafter being transferred to a suitable dish in an incubator at 37 °C and95% humidity. After 24 h, the floating cells were removed from themedium by washing the dish with PBS solution and the culture was leftto stay in the same conditions to proliferate the cells. After filling thedish, the cell passage was performed using Trypsin-EDTA and even-tually, depending on the number of cells from each sample, the cellpassage was conducted. For subsequent experiments, the cells of thefourth passage were placed in a medium with 10% DMSO and thentransferred to the nitrogen tank.

The cells were isolated by flowcytometry using markers which in-cluded CD19, CD14, CD146 and CD90. For this purpose, monolayerstem cells were fixed after trypsinizing and counting in 4%Paraformaldehyde (PFA) solution and incubated with human antibody.After 30min, the cells were washed with phosphate buffer saline andanalyzed by flowcytometry.

After proliferation of the cells in the initial culture, filling at least80% of the flask floor, the cells were transported to several flasks after10–12 days. The passage steps were as follows: the outer atmosphere ofthe T25 flask was evacuated, the cells were washed twice with 2ml ofPBS, 3ml of Trypsin-EDTA (Sigma) solution was then added to the flaskand placed at 37 °C for 3min. To stop the activity of trypsin enzyme,3ml of DMEM medium with 10% FBS was added to the flask, usingpipetting, more so, the cells separated from the flask floor were isolatedand floated, the cell suspension was poured into 15ml falcon pipes andcentrifuged for 8min at 1400 rpm. The cellular deposition was placedin 1ml of the suspension culture medium and then transferred intothree T25 flasks containing 12ml culture medium containing 10% PBS.The flasks were kept in an incubator at 37 °C and 5% CO2 [37].

After trypsinization of SHED from the third passage (Fig. 1), 2× 104

cells were transferred to each scaffold. According to the references [38],the scaffolds were 0.3mm in thickness and 10mm in diameter, andeach scaffold was placed in the well of the plate. To each well, 1ul ofDulbecco's Modified Eagle's medium (DMEM) containing 10% serumand 1% Pen/Str was added. Finally, to sterilize the scaffolds, they wereexposed to UV for 2 h and 70% ethanol for 30min and washed with PBSsolution. After this stage, four groups including: (1) culturing cells inthe flask flood without scaffold (control), (2) PHB scaffold (G1), (3)PHB/chitosan scaffold (G2), (4) PHB/chitosan/Bioglass scaffold (G3)were selected at 3, 5 and 7 days with at least 3 repetitions and wereprepared for cell culture. MTT-assay (MethylThiazol Tetrazolium-assay)was used to determine the survival and proliferation of these cells onthe scaffolds. In this test, the activity of the mitochondria dehy-drogenase enzyme and ultimately the recovery of tetrazolium salt,which is an indicator of cell growth, were investigated. After per-forming MTT assay at the time mentioned above, removed the media,washed the cells with PBS about 400 μl of pure media, and 40 μl of MTTsolution (with concentration of 5mg/μl) were added to each well andplaced in the incubator at 37 °C for 4 h. The medium was slowly

evacuated and 400 μl of Dimethyl sulfoxide (DMSO) was added andstored in the dark for 2 h at laboratory temperature, and then 100 μl ofthe solution was pipetted and transferred to the well of the 96-wellplate. In order to determine the presence of antibodies or specific an-tigens, the OD absorbance of samples were read by the spectro-photometer ELISA reader (Hiperion MPR 4+ Microplate reader) at thewavelength of 540 nm.

2.4. Differentiation of SHED to odontoblast

In order to induce the differentiation of SHED into odontoblast, fourdifferent media with different compositions were also used and induc-tion of the cells on different scaffolds was performed for 14 days. Thegroups considered for the cellular differentiation medium are: (1)Medium, (2) Medium containing BMP2 growth factor (100 ng/μl), (3)Medium containing BMP2 growth factor (100 ng/μl)+MTA (200mg)and, (4) Medium containing MTA (200mg). To differentiate odonto-blastogenesis, 5× 105 cells per well with scaffolds were cultured. Thedifferentiation groups are: PHB/chitosan/Bioglass scaffold (control),(2) PHB/chitosan/Bioglass + BMP2 Scaffold (D1), (3) PHB/chitosan/Bioglass+BMP2+MTA Scaffold (D2) and (4) PHB/chitosan/Bioglass+MTA scaffold (D3). The differentiation medium of the scaf-fold groups and monolayer cells on days 3 and 14 of the differentiationhas been shown in Fig. 2. The cell culture medium was changed everythree days. After 14 days from the time of differentiation, mRNA ex-traction and cDNA synthesis were performed, and in order to evaluateodontoblast specific genes [11] in the Real time-PCR step, DSPP, ALPand Collagen type-I primers were used and Hematoxylin-Eosin (H-E),while immunohistochemistry (IHC) methods were used to trace DSPPand Collagen type-I proteins of the differentiated cells.

2.5. mRNA extraction and cDNA synthesis from differentiated cells

The Trizol solution (TriPure Isolation Reagent, Roche Diagnostics,USA) and TriPure Extraction Kit (13RXN) were used to separate thecells from the scaffold surface. The scaffolds were placed into the falcontube and 1 cm3 of Trizol was added and mixed well to dissolve thescaffold inside the solution (20 s). 200ml of chloroform was then addedto the tube and the samples were kept in the laboratory for 10min. Itwas then centrifuged for 15min at 13,000 rpm at 4 °C. After cen-trifugation, three phases were formed; a transparent upper phase con-taining mRNA, which was carefully separated and inserted into the newtube (600 μl). Then, 600 μl of isopropanol was added to the previoussample and kept at room temperature for 10min. Subsequently, the

Fig. 1. SHED after the third passage.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

130

tubes were centrifuged at 12,000 rpm at 4 °C for 12min. A white masswas formed at the bottom of the tubes that actually indicated RNAdeposition. The next step was to discard the superficial fluid and add1 cm3 of 70% ethanol to the tube and centrifuged it for 5min at8500 rpm (RNA washing step). The supernatant was dispose again andthe tubes were placed at room temperature to evaporate the extraethanol. After drying 50 μl of water without enzymes, the arenas wereadded to the samples and placed at 56 °C for 10min. The prepared RNAsample should be stored at −80 °C or rapidly converted to cDNA.

2.6. Synthesis of cDNA

The Revertal-L kit of the company AmpliSens was used to synthesizecDNA. In accordance with the kit instructions, each sample of 10.3 μl ofthe RT mix buffer, 0.42 μl of RT Gmix2 buffer, and 0.5 μl of RT reversetranscriptase enzyme were used. These materials were added to thetube and 10 μl of the extracted mRNA was added to the mixture andplaced at 38 °C for 30min. After that, the cDNA sample was preparedand kept at −20 °C.

2.7. Real time-PCR technique

In this method, the reference gene glyceraldehyde-3-phosphate de-hydrogenase (GAPDH), which has a fixed and unchanged expression incells, was used to normalize the data. Specific primers of the referencegene and specific odontoblast genes used in this study were extractedfrom available sources [11] (Table 1) and a standard curve was used tocalculate the level of expression of each of the targeted genes.

2.8. Stages of real-time PCR test

The device's thermal - time schedule was completed in three steps.The first stage, which leads to the denaturation of DNA molecules andactivation of the polymerase enzyme was performed at 95 °C for 12min,the second stage was carried out at 60 °C for 25 s and at 72 °C for 30minfor 40 consecutive cycles, and the final step was to draw the

dissociation curve or the melting curve. The temperature of differentproliferation stages of DNA strands has been written in Table 2. Real-Time PCR reactions were used in the final volume of 10 μl and in 100 μltubes. In the present study, Sybr-Green characterized by green fluor-escence, is placed through a small strand of double-stranded DNAmolecule and diffused fluorescence light. The production of fluorescentlight is in direct proportion to the production of PCR hence Sybr-Greenmolecule has no inhibitory effect on PCR and can be used instead offluorescent probes.

2.9. Relative quantization data analysis

In this study, a threshold cycle comparison method was used tomeasure the number of copies of the target and reference genes. In thismethod, the threshold cycles of each gene (conducted in triplicate) wasused. The gene was normalized based on the glyceraldehyde 3-phos-phate dehydrogenase reference gene. The expression level of each of thetarget genes was calculated using formula (3), which means that CtGeneis equivalent to the threshold cycle of each primer and CtControl isequivalent to the GAPDH primer threshold cycle;

∆ = −Ct Ct CtGene Coltrol (3)

The amount of mRNA proliferation in each sample was calculatedfrom formula (4):

∆ ∆ = ∆ − ∆Ct Ct Ct( ) Gene Coltrol (4)

Finally, 2−Δ(ΔCt) is equal with the proportion of target gene to re-ference gene (formula (5)):

= −∆ ∆old changeF 2 Ct( ) (5)

The number of cycles was considered 40 times for progressivepropagation and the wavelength of 470 nm was according to the Sybr-Green standard, and then the test was controlled by Rotor-Gene 6000Series Software 1.7.

Fig. 2. Differentiation medium of scaffold groups and monolayer cells on days 3 and 14.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

131

2.10. Preparation of scaffolds for immunohistochemistry (IHC) test

IHC test was performed using primary antibodies of collagen type-I,dentin sialophosphoprotein (DSPP) and secondary anti-Rabbit IgG an-tibody (GOAT). Initially, all antibodies were diluted with dinitrogenwater at 20 μl and frozen into eppendorf. The cells cultured on thescaffolds were fixed in phosphate buffered formaldehyde at 10% v/v.For proper evaluation, the scaffold with transverse sections should beprepared. Block preparation was done in four steps, namely: the pro-cessing stage, in which cells and scaffolds were prepared using theTissue processor-DS 2080/H machine. In the next step, each scaffoldwas divided into three parts and held vertically in the mold to slowlymelt the paraffin around it, then the molds were quickly transferred tothe freezer at −30 °C to cool the paraffin. Thereafter, blocks were cutinto pieces to have a thickness of 8–10 μm using a microtome machinemodel Accu-Cut SRM-SAKURA. Finally, the samples were placed in theoven for 60min at 45 °C. Subsequently, the components were dehy-drated with alcohol and stained to evaluate the morphology with H-Esolution. This method was used for general staining in most pathologylabs. This method includes using Xylene solution to clear the blocks for20min in 3 steps, namely: hydration with 100 to 70 degrees of alcohol,cell core staining by Hematoxylin and staining of cell cytoplasm byEosin, and dehydrating step by 70 to 100% of alcohol. For im-munohistochemistry (IHC), sections were immersed in 0.3% H2O2 for30min and blocked in TBS for 1 h. The cut blocks were then incubatedfor 30min with DSPP, Collagen type-I antibodies for 60min, and sec-ondary anti-Rabbit IgG (GOAT) antibodies for 30min and then placedin DAB solution for 1min. Finally, the H-E and IHC images were viewedby the Olympus CX31 microscope.

2.11. Statistical test

The results of the experiments were statistically analyzed by IBMSPSS Statistics V21.0 software and by two-way ANOVA analysis withsignificance level of p < 0.05.

3. Results and discussion

3.1. FE-SEM test of electrospun scaffolds

The FE-SEM image and histogram diagram of the nanocompositescaffold samples have been shown in Fig. 3. It can be seen that thetensile strength increases during the formation of the fibers and a

decrease in the fiber diameter is notable, as compared to the pure PHBsample of this phenomenon in Fig. 3. In this image, there is also acompletely porous network of fibers without nodes and agglomerates,therefore, the presence of ionic groups in the polymer structure causedby the bioglass nanoparticles increases the electrical conductivity of thesolution thereby transferring more electricity and ultimately leading tothe elongation and narrowing of the fibers, which reduces their dis-tribution. In general, a droplet of polymer solution released from theneedle changes shape under the influence of the electric field and willbe in the form of a Taylor cone; so that a high-electrical solution canmove more electric charges which ultimately leads to elongation andnarrowing of the fibers and a reduction in their distribution [39]. Thepresence of 10 wt% bioglass nanoparticles and 15wt% chitosan in-creased the tensile strength and young's modulus of fibers to 3.42MPaand 210.96MPa, respectively [36].

3.2. Results of porosity and mechanical properties of scaffold

High pore size allows the cells to repair the damaged tissue moreproperly. In addition, pores play an important role in supplying the cellswith nutrition [2]. In Table 3, where the samples porosities are listed,compounds containing 15wt% bioglass have higher agglomeration intheir structure, resulting in a higher pore size and thicker fibers; on theother hand, the presence of agglomerates in these structures has limitedthe movement of polymer chains, ultimately resulting in lower porosity.In chitosan containing compounds, the change in the density of com-posite causes the fibers to become thinner and the pores to becomesmaller, but it should be noted that these positive effects of addingchitosan reduces after exceeding a certain limit. In samples containing20wt% chitosan, the very high viscosity limits the movement of na-noparticles in polymer matrix as well as the movement of polymerchains and reduces the porosity. Therefore, according to the abovedescription and the results of Table 3, the sample S1 can be selected asthe best sample in terms of high porosity.

PHB and chitosan are brittle polymers whose brittleness depends ontheir degree of crystallinity. However, the addition of bioglass can beused as a measure to adjust the polymer crystallinity, and thereby im-prove the scaffold's brittleness and tensile properties. It should again benoted that the presence of high amounts of chitosan in polymer solutionwill cause it to gain a high viscosity and become ill-suited for electro-spinning. Meanwhile, the presence of up to 10% (by weight) of bioglassnanoparticles in the polymer chain allows these particles to act suc-cessfully as temporary cross-links and ultimately improve the me-chanical properties. This is the effect of high surface energy of nano-particles and their ability to act favorably in tensile field and move inthe direction of elongation. Ceramics such as bioglass that have ionicbonds exhibit a high durability and can therefore be used to improvethe durability of composite, but only when their presence does not leadto agglomeration. In fact, agglomeration is weakening the mechanicalproperties by weakening the bond between bioglass nanoparticles andthe polymer matrix. These agglomerations points become highly vul-nerable to stresses and in effect act as points of stress concentrationresulting in easier formation of micro-cracks in the structure and

Table 1List of primers used in Real-time PCR analysis.

Gene name Direction Sequence (5′→ 3′) Length (bp) Melting temperature (°C)

DSPP Forward GGGCCATTCCAGTTCCTCAAA 171 59.6Reverse TCTCTTGCCTTCCTCTATCACCTT 171 59.8

Collagen type I Forward GGCAAAGAAGGCGGCAAAG 133 59.4Reverse GAGCACCAGCAGGACCATC 133 59.5

ALP Forward TGTGGAGTATGAGAGTGACGAGAA 111 59.6Reverse CAGATGAAGTGGGAGTGCTTGTAT 111 59.6

GAPDH Forward CATGTTCGTCATGGGGTGAACCA 159 61Reverse AGTGATGGCATGGACTGTGGTCAT 159 61

Table 2Temperature of different stages of DNA strands.

Status Temperature (°C) Time

Hold 95 15minCycle Denaturation 95 12 s

Annealing 60 25 sElongation 72 30 s

Melting 60–95 –

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

132

therefore reducing the mechanical properties. According to the SEM(Fig. 1) analysis and evaluation of the porosity and mechanical prop-erties, the PHB/15%Chitosan/10%nBG sample had the best resultsamong the other samples, so this scaffold was selected as the mostsuited sample for bioactivity and biodegradability analyses.

3.3. Results obtained from cell morphological observations

Live cells grown on culture media were identified on days 1, 5 and 7after starting the culture. Live cells were extracted from pulp tissue ondays 1, 5 and 7 after starting the culture using a contrast phase mi-croscope, the appearance of fibroblasts was visible on the flask floor,and it gradually increased the density of these cells with increasingculture time (Fig. 4).

The flow cytometry analysis results revealed that CD90 and CD146mesenchymal markers were positive in cells isolated from deciduousdental pulp, while the hematopoietic markers of CD14 and CD19 were

negative. The results are shown in Fig. 5. In Fig. 5, the expression ofendothelial markers of CD90 and CD146 were 99.79% and 94.21%,respectively, and the rate of expression of the hematopoietic markers ofCD14 and CD19 were 23.32% and 7.32%, respectively. Dental pulpstudies have suggested that dental pulp cells have a vascular outflow,because the cells exhibit CD146 and CD90 markers, which are specificmarkers of endothelial cells. There is only one unidentified cell type inthe dental pulp that can be differentiated into other cells. Concerningthe closed space of the pulp chamber and the very narrow canal of theroot of the tooth, we concluded that the dental pulp cells are all fun-damental [40–42].

CD14 and CD19 are markers for endothelial progenitor cells [43],while CD90 and CD146 are markers for pluripotent stem cells [44],therefore, it can be stated that the stem cells extracted in this study arepluripotent. Previous studies by Miura et al. revealed that ex-vivo ex-tended SHED express the primary mesenchymal marker (STRO1) [3],but contrary to the results, the cells were positive for endothelial pro-genitor cells (CD146). In this study, the positive cells of STRO1 andCD146 were also accumulated around the remaining pulp blood vesselsand it was concluded that the origin of these cells is probably theperivascular micro environment [3].

3.4. The percentage of cell viability survey

The MTT assay was used to confirm the activity and growth andproliferation of cells on the nanofibers used and the amount of scaffoldtoxicity. The absorbance of the OD of the samples was read using theELISA reader spectrophotometer. The change in the growth rate of cellsalong the scaffolds and the percentage of cell viability (Formula (6))have been shown for day 1, 5 and 7. The results of the MTT assay for the

Fig. 3. SEM Image and histogram diagram for PHB/10Cht/15nBG nanocomposite fibers [66].

Table 3Mechanical properties and porosity of electrospun scaffolds (n=3).

Sample Stress (MPa) Modulus (MPa) Porosity (%)

S0 0.95 ± 1.5 109.90 ± 0.05 63.5S1 3.42 ± 2.98 210.96 ± 0.09 81.2S2 1.01 ± 3.04 217.98 ± 0.1 66.3S3 1.55 ± 1.28 183.22 ± 0.06 65

S0: PHB.S1: PHB/15Cht/10nBG.S2: PHB/20Cht.S3: PHB/15nBG.

Fig. 4. SHED medium after 7 days. (a) Shows a small clone one day after the culture; (b) the same clone on the fifth day; and (c) the same clone on the seventh day.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

133

corresponding time intervals are plotted in a chart and the MTT testmechanism have been shown in Fig. 6.

= ×Cell viability OD test OD control(%) ( )/ ( ) 100 (6)

Nanofiber scaffolds physically imitate the extracellular matrix, sothat they can be a good substrate for cell adhesion and cell growth [45].For this purpose, the MTT assay was performed for cultured SHED onthe scaffolds at day 3, 5 and 7, the results are shown in Fig. 6. Based onthe test, there was a significant difference between the control groupand the experimental groups (ANOVA, p < 0.05). The highest cellviability rate was observed for the control sample, and following, were

the samples G3+MTA and G3. There was no significant differencebetween the two groups of G3+MTA and G3 in terms of cell viability(ANOVA, p > 0.05). While these two groups had a significant differ-ence from the G1 sample, this may result from the presence of car-boxylamino groups in the chitosan structure which improves substrate'shydrophilicity and, consequently, the better growth of active metaboliccells on G3+MTA and G3 scaffolds, compared to the G1 sample. Al-though the cell survival rate was lower in both G3+MTA and G3groups than in the control group, however, due to the results of thebiocompatibility test performed in the previous study [36], the G3composition containing bioglass and chitosan had good biocompat-ibility and it can be said to be a suitable substrate for cell growth andproliferation. Therefore, it can be stated that the growth and pro-liferation of SHED can be a function of the chemical (hydrophilic) andstructural properties (porosity and fiber size) of the scaffolds, and withbetter properties, the better the binding and growth of the cells [45].According to Fig. 6, there was no significant difference between thegroups of day 3 (ANOVA, p > 0.05), but on the 5th day, this differencewas significant in G1 group, and on the 7th day, there was a significantdifference between groups G3, G3+MTA and MTA. According to theresults obtained from the evaluation of the percentage of cell viability,the scaffolds containing bioglass nanoparticles have far more cellularviability than scaffolds without nanoparticles, therefore, it can beconcluded that the presence of nanoparticles plays an important role incell growth and adhesion [46]. The change in cell direction andcrossing multiple different courses of random nanofibers decreases thespeed of proliferation compared to aligned nanofibers, which leads tothe formation of smaller colony size and less cell elongation withmultipolar shape. On day 7 we observed the highest proliferation ratein the PHB/chitosan/nBG scaffolds. Supposing the highest proliferationrate of the SHED occurred 3 days after initial culture, the decrease incellular proliferation in aligned nanofibrous scaffolds on MTA groupscould be related to the lack of space for proliferation and relativetoxicity of MTA. According to Fig. 6, most of the cells on MTA were

Fig. 5. Results of flowcytometry of human SHED. (a) CD90, (b) CD146, (c) CD14 and (d) CD19.

Fig. 6. The results of the MTT assay and the comparison of the survival of thecells on the scaffolds (n= 3), (a) the third day, (b) the fifth day, and (c) theseventh day, with a significant difference between the control group and thegroups with scaffold (G) (n=3). * Indicates a significant difference from theMTA (p < 0.05, ANOVA).

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

134

dead, and only the cell debris could be observed, especially when thecells were seeded after day 3 of MTA hydration. However, cells seededon MTA after day 5 of MTA hydration appeared to recover to someextent in 4 day cultures. The differences were statistically significant(ANOVA, p < 0.05). In a 2010 study by Yang et al. [38], the effect ofhydroxyapatite nanoparticles on PCL/Gelatin/nHA scaffolds was in-vestigated and it was concluded that, the presence of nanoparticlesincreases the hydrophilicity of the scaffold, and as a result, can improvecell growth, proliferation and adhesion.

3.5. Evaluation of cell morphology and adhesion on the scaffold surface

The suitability of 3D composite scaffolds for cell culture was de-termined by observing cell adhesion and dispersion using SEM images.High cell binding on the optimized scaffold can be seen in the SEMimages shown in Fig. 7; this is the result of suitable physical-chemicalproperties and the cell-compatibility of the scaffolds. Increasing theconcentration of chitosan increased the cellular binding. Bioglass na-noparticles also play a key role in binding SHED on the compositescaffolds. In Fig. 7-b shown cell adhesion and dispersion (with magni-fication of 2500×).

3.6. Real-time PCR test analysis

While many researchers have investigated the odontoblast differ-entiation of dental cells, the formation of odontoblast cells is unclear toa large extent. One of the important factors that can lead this type ofresearch to the desired goal is the selection of the appropriate molecularsignals that are important in tissue engineering [47–49]. Therefore, inthis study, according to the references, a suitable growth factor forinducing SHED was selected for odontoblast [11]. The differentiation ofstem cells into odontoblast was confirmed by Real-time PCR. The ex-pressions of collagen type-I, DSPP and ALP genes were selected asodontogenic phenotype markers and examined in differentiated cellsafter 14 days. Factors such as the shape and morphology and the scaf-fold components can also play an important role in increasing cell in-duction [11]. The nanofiber scaffolds in this study are three-dimen-sional, which is one of the most effective induction factors for thescaffold. The results of the study by Iohara et al. indicated that BMP2induction of cells in a 3D culture was much more effective than in themonolayer culture, so that, after 21 days, the DMP-1 gene expressionwas observed only in the 3D culture [50]. On the other hand, thepresence of bioglass nanoparticles in the scaffold composition also in-creases cell induction [51]. According to Fig. 8, it is observed that, in allthe groups, SHED differentiated into odontoblast-like cells and theirgene expression was positive, making them significantly different fromthat of the control group. ANOVA test showed that p < 0.05 and there

was no significant difference between other groups.The expression level of Collagen type-I in the medium+BMP2 (D1)

group was about 6.5 times. In the medium+BMP2+MTA (D2) group,the expression of the gene was 3 times and in the medium+MTA (D3)group it increased to 2.5 times, compared to the control group. Giventhat collagen exists in the extracellular matrix as one of the mostabundant proteins in the body and it plays an important role in boneformation; therefore, collagen growth factor, plays an important role inbone formation and helps to increase the expression of the collagengene and its differentiation toward the odontoblast-like and osteoblastcells [24]. However, when the BMP2 growth factor with MTA is presentin the differentiation medium due to the release of Si and Ca ions, theMTA extract disrupts BMP2 function [52] and reduces the expression ofthe collagen gene by 50% compared to the D1 group and decreases theD3 group by about 22% compared to D1. DSPP expression level in theD1 group was about 5.5 fold, in the D2 group, the expression of thegene was about 2.5 times and in the D3 group, it was about 1.5 times,compared to the control group. DSPP is the most important non-col-lagenic dentin matrix protein that plays a key role in the formation andmineralization of dentin [53–56]. ALP gene had the lowest expressionin the three groups of scaffolds compared to the control, so that in theD1 group, the expression rate of the gene was about 2 times, about 1.5times in the D2 group, and in the D3 group, approximately one-foldincrease in the expression of the gene. This decrease in the expression ofALP gene expression in all the groups, compared to DSPP and Collagentype-I genes, is due to the presence and release of calcium phosphateand calcium hydroxide in the MTA during the time of differentiation(14 days) [49,52]. According to references [57], the degree of differ-entiation in the groups containing MTA has been due to the presence ofscaffold bioglass nanoparticles and the release of calcium ions. Themorphology and structure of nanoparticles also play a significant role inbiological responses [58,59]. It can be concluded that the environmentsthat are less involved in ion release (group D1) are much less indicativeof the expression than the groups that releases more ion (groups D2 andD3). It should be noted that MTA exhibits minor toxicity at the earliesttime when it enters into differentiated media [60,61]. Animal studieshave shown that MTA leads to a limited amount of pulp tissue necrosisafter application [62–64]. However, due to the mesh state of the scaf-folds, MTA takes a longer time to prepare; therefore, the ion releasecontinues and reduces the gene expression in the groups. The scaffoldseems to allow the MTA to have beneficial effects on the formation ofdentin. Lee et al. [65] showed that the PCL-F scaffold is a temporarybarrier for MTA to be prepared. The extract of MTA with BMP2 pro-motes the expression of DSPP and Collagen type-I genes, which do notdiffer significantly. In addition, the grown cells on the scaffolds of theD1 and D2 groups significantly increased the expression of DSPP andCollagen type-I genes than those of the D3 group. These MTA attributes

Fig. 7. Evaluation of cell morphology and adhesion on the scaffold surface. (a) Magnification of 500× and (b) magnification of 2500×.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

135

showed that the D2 group did not only maintain the beneficial prop-erties of MTA, instead of the D3 group, but also induced differentiationinto the odontoblast-like cell line.

3.7. The results of H-E staining and immunohistochemistry (IHC) tests

Scaffold samples affected by the growth factor of the BMP2 andMTA extracts in a differentiation medium were evaluated for the pre-sence of odontoblast specific matrix by IHC and H-E staining methods.As notable in Fig. 9, after staining H-E, the cell cores appeared in darkpurple and the cellular cytoplasm medium, in pink. On the other hand,IHC test images (arrows representing some of the differentiated cells onthe scaffolds) were analyzed by ImageJ software and the percentage ofthe formation of differentiated cells in each of the groups was eval-uated. Fig. 10 shows the differentiated cells of the groups marked with

the Collagen-I antibody. Fig. 11 reveals the cells differentiated withDSPP antibodies. It is noteworthy that cells that have dark purple coresand brown cytoplasm can be accepted as differentiated cells. In Fig. 12,the D1 group that contains the BMP2 growth factor with Collagen type-Iantibody has the highest percentage (32%) of the differentiated cells; sothat, the results of the Real-Time PCR test seem logical. The resultsindicated that the presence of DSPP and Collagen type-I compoundswas determined as the formation of brown deposition of Diamino-benzidine (DAB).

4. Conclusion

In this research, the PHB/10Cht/15nBG nanocomposite scaffold wasmade using the electrospinning method while putting the optimalparameters into consideration. According to the results, due to the

Fig. 8. Diagrams of various scaffolds and expression levels of (a) collagen type-I, (b) DSPP and (c) ALP genes (p < 0.05) *.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

136

presence of chitosan and bioglass nanoparticles, the resulting scaffoldhad good hydrophilic and uniformity properties. The results of flowcytometry showed that in the cells isolated from the deciduous dentalpulp, the mesenchymal markers of CD90 and CD146 were positive,while, the hematopoietic markers of CD14 and CD19 were negative.The SEM images show cellular binding and a high cell proliferation onthe scaffolds, which determine the compatibility of the scaffolds re-garding the non-toxicity of cells. The results of the Real-time PCR testshowed a 6-times increase in the expression of DSPP and Collagen type-I genes compared to the control group, so that in the images obtainedfrom the IHC test, the extracted cells of SHED are visibly differentiated

into odontoblast-like dentin cells. Therefore, according to the results, itcan be concluded that the scaffold constructed is suitable for direct pulpcapping.

Acknowledgments

This research was sponsored by Isfahan University of MedicalSciences, Iran with the code 394792. The authors of the paper thank themembers of the Dental Materials Research Center, the Isfahan DentistrySchool and the Department of Pathology at Al-Zahra Hospital inIsfahan.

Fig. 9. H-E test images and presence of cells on the scaffolds of (a) control group; (b) BMP2 group; (c) BMP2+MTA group; and (d) MTA group (400×). (Forinterpretation of the references to color in this figure, the reader is referred to the web version of this article.)

Fig. 10. Immunohistochemistry test images and the presence of cells on the scaffolds marked with the Collagen-I antibody. (a) Control group; (b) BMP2 group; (c)BMP2+MTA group; and (d) MTA group (400×).

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

137

References

[1] D. Baksh, L. Song, R. Tuan, Adult mesenchymal stem cells: characterization, dif-ferentiation, and application in cell and gene therapy, J. Cell. Mol. Med. 8 (2004)301–316.

[2] M.M. Gronthos, J. Brahim, P.G. Robey, S. Shi, Postnatal human dental pulp stemcells (DPSCs) in vitro and in vivo, Proc. Natl. Acad. Sci. 97 (2000) 13625–13630.

[3] M. Miura, S. Gronthos, M. Zhao, B. Lu, L.W. Fisher, P.G. Robey, S. Shi, SHED: stemcells from human exfoliated deciduous teeth, Proc. Natl. Acad. Sci. 100 (2003)5807–5812.

[4] R. Alipour, F. Sadeghi, B. Hashemi-Beni, S.H. Zarkesh-Esfahani, F. Heydari,S.B. Mousavi, M. Adib, M. Narimani, N. Esmaeili, Phenotypic characterizations andcomparison of adult dental stem cells with adipose-derived stem cells, Int. J. Prev.Med. 1 (2010) 164.

[5] G.-J. Huang, S. Gronthos, S. Shi, Mesenchymal stem cells derived from dental tis-sues vs. those from other sources: their biology and role in regenerative medicine, J.Dent. Res. 88 (2009) 792–806.

[6] A. Kabiri, E. Esfandiari, A. Esmaeili, B. Hashemibeni, A. Pourazar, M. Mardani,Platelet-rich plasma application in chondrogenesis, Adv. Biol. Res. 3 (2014).

[7] A. Kabiri, E. Esfandiari, B. Hashemibeni, M. Kazemi, M. Mardani, A. Esmaeili,Effects of FGF-2 on human adipose tissue derived adult stem cells morphology andchondrogenesis enhancement in Transwell culture, Biochem. Biophys. Res.Commun. 424 (2012) 234–238.

[8] M. Liu, Y. Sun, Y. Liu, M. Yuan, Z. Zhang, W. Hu, Modulation of the differentiationof dental pulp stem cells by different concentrations of β-glycerophosphate,Molecules 17 (2012) 1219–1232.

[9] W. Zhang, X. Zhang, J. Ling, W. Liu, X. Zhang, J. Ma, J. Zheng, Proliferation andodontogenic differentiation of BMP2 gene-transfected stem cells from human toothapical papilla: an in vitro study, Int. J. Mol. Med. 34 (2014) 1004–1012.

[10] A. Almushayt, K. Narayanan, A. Zaki, A. George, Dentin matrix protein 1 inducescytodifferentiation of dental pulp stem cells into odontoblasts, Gene Ther. 13(2006) 611.

[11] B. Hashemi-Beni, M. Khoroushi, M. Foroughi, S. Karbasi, A. Khademi, Tissue en-gineering: dentin - pulp complex regeneration approaches (a review), Tissue Cell 49(2017) 552–564.

[12] P.C. Mooney, Piana J. DJ, B. Rutherford, Engineering dental pulp-like tissue invitro, Biotechnol. Prog. 12 (1996) 865–868.

[13] S. Gronthos, M. Mankani, J. Brahim, P.G. Robey, S. Shi, Postnatal human dentalpulp stem cells (DPSCs) in vitro and in vivo, Proc. Natl. Acad. Sci. 97 (2000)13625–13630.

[14] N.M. Iohara, M. Ito, M. Ishikawa, A. Nakasima, A. Akamine, Dentin regeneration bydental pulp stem cell therapy with recombinant human bone morphogenetic protein2, J. Dent. Res. 83 (2004) 590–595.

[15] M.M. Cordeiro, Z. Dong, T. Kaneko, Z. Zhang, M. Miyazawa, S. Shi, A.J. Smith,J.E. Nör, Dental pulp tissue engineering with stem cells from exfoliated deciduousteeth, J. Endocrinol. 34 (2008) 962–969.

[16] J. Wang, H. Ma, X. Jin, J. Hu, X. Liu, L. Ni, P.X. Ma, The effect of scaffold

Fig. 11. Immunohistochemistry test images and the presence of cells on the scaffolds marked with the DSPP antibody. (a) Control group; (b) BMP2 group; (c)BMP2+MTA group; and (d) MTA group (400×).

Fig. 12. The percentages of the formation of differentiated cells on the scaffold surface relative to the area of the scaffold calculated by the ImageJ software.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

138

architecture on odontogenic differentiation of human dental pulp stem cells,Biomaterials 32 (2011) 7822–7830.

[17] J. Adler, A. Jayan, C.D. Melia, A method for quantifying differential expansionwithin hydrating hydrophilic matrixes by tracking embedded fluorescent micro-spheres, J. Pharm. Sci. 88 (1999) 371–377.

[18] A. Abd-Elmeguid, C.Y. Donald, L.W. Kline, R. Moqbel, H. Vliagoftis, Dentin matrixprotein-1 activates dental pulp fibroblasts, J. Endocrinol. 38 (2012) 75–80.

[19] M. Ike, M.R. Urist, Recycled dentin root matrix for a carrier of recombinant humanbone morphogenetic protein, J. Oral Implantol. 24 (1998) 124–132.

[20] I. Thesleff, P. Sharpe, Signalling networks regulating dental development, Mech.Dev. 67 (1997) 111–123.

[21] K. Bessho, N. Tanaka, J. Matsumoto, T. Tagawa, M. Murata, Human dentin-matrix-derived bone morphogenetic protein, J. Dent. Res. 70 (1991) 171–175.

[22] R.B. Rutherford, J. Wahle, M. Tucker, D. Rueger, M. Charette, Induction of re-parative dentine formation in monkeys by recombinant human osteogenic protein-1, Arch. Oral Biol. 38 (1993) 571–576.

[23] T. Åberg, J. Wozney, I. Thesleff, Expression patterns of bone morphogenetic pro-teins (Bmps) in the developing mouse tooth suggest roles in morphogenesis and celldifferentiation, Dev. Dyn. 210 (1997) 383–396.

[24] M. Nakashima, Induction of dentine in amputated pulp of dogs by recombinanthuman bone morphogenetic proteins-2 and-4 with collagen matrix, Arch. Oral Biol.39 (1994) 1085–1089.

[25] N. Six, J.-J. Lasfargues, M. Goldberg, Differential repair responses in the coronaland radicular areas of the exposed rat molar pulp induced by recombinant humanbone morphogenetic protein 7 (osteogenic protein 1), Arch. Oral Biol. 47 (2002)177–187.

[26] T. Yamashiro, M. Tummers, I. Thesleff, Expression of bone morphogenetic proteinsand Msx genes during root formation, J. Dent. Res. 82 (2003) 172–176.

[27] L. Casagrande, F. Demarco, Z. Zhang, F. Araujo, S. Shi, J. Nör, Dentin-derived BMP-2 and odontoblast differentiation, J. Dent. Res. 89 (2010) 603–608.

[28] Y. Ikada, Key factors in tissue engineering, Bull. Mater. Sci. 22 (1999) 627–631.[29] M. MacDougall, D. Simmons, X. Luan, J. Nydegger, J. Feng, T.T. Gu, Dentin

phosphoprotein and dentin sialoprotein are cleavage products expressed from asingle transcript coded by a gene on human chromosome 4 Dentin phosphoproteinDNA sequence determination, J. Biol. Chem. 272 (1997) 835–842.

[30] H.H. Ritchie, G.J. Pinero, H. Hou, W.T. Butler, Molecular analysis of rat dentinsialoprotein, Connect. Tissue Res. 33 (1995) 73–79.

[31] C. Bègue-Kirn, P.H. Krebsbach, J.D. Bartlett, W.T. Butler, Dentin sialoprotein,dentin phosphoprotein, enamelysin and ameloblastin, tooth-specific molecules thatare distinctively expressed during murine dental, Differentiation 106 (1998)963–970.

[32] C. Qin, J. Brunn, E. Cadena, A. Ridall, H. Tsujigiwa, H. Nagatsuka, N. Nagai,W. Butler, The expression of dentin sialophosphoprotein gene in bone, J. Dent. Res.81 (2002) 392–394.

[33] D. Magne, G. Bluteau, S. Lopez-Cazaux, P. Weiss, P. Pilet, H.H. Ritchie, G. Daculsi,J. Guicheux, Development of an odontoblast in vitro model to study dentin mi-neralization, Connect. Tissue Res. 45 (2004) 101–108.

[34] D. Reffitt, N. Ogston, R. Jugdaohsingh, H. Cheung, B.A.J. Evans, R. Thompson,J. Powell, G. Hampson, Orthosilicic acid stimulates collagen type 1 synthesis andosteoblastic differentiation in human osteoblast-like cells in vitro, Bone 32 (2003)127–135.

[35] P.D. Benya, J.D. Shaffer, Dedifferentiated chondrocytes reexpress the differentiatedcollagen phenotype when cultured in agarose gels, Cell 30 (1982) 215–224.

[36] M.R. Foroughi, S. Karbasi, M. Khoroushi, A.A. Khademi, Polyhydroxybutyrate/chitosan/bioglass nanocomposite as a novel electrospun scaffold: fabrication andcharacterization, J. Porous. Mater. 24 (2017) 1447–1460.

[37] P.A. Zuk, M. Zhu, P. Ashjian, D.A. De Ugarte, J.I. Huang, H. Mizuno, Z.C. Alfonso,J.K. Fraser, P. Benhaim, M.H. Hedrick, Human adipose tissue is a source of multi-potent stem cells, Mol. Biol. Cell 13 (2002) 4279–4295.

[38] X. Yang, F. Yang, X.F. Walboomers, Z. Bian, M. Fan, J.A. Jansen, The performanceof dental pulp stem cells on nanofibrous PCL/gelatin/nHA scaffolds, J. Biomed.Mater. Res. A 93 (2010) 247–257.

[39] R. Shalak, F.C. Fcpisr, Tissue Engineering, Alan R Liss, New York, 1998.[40] C. Morsczeck, W. Götz, J. Schierholz, F. Zeilhofer, U. Kühn, C. Möhl, C. Sippel,

K. Hoffmann, Isolation of precursor cells (PCs) from human dental follicle ofwisdom teeth, Matrix Biol. 24 (2005) 155–165.

[41] L. Peng, L. Ye, X.-D. Zhou, Mesenchymal stem cells and tooth engineering, Int. J.Oral Sci. 1 (2009) 6.

[42] G. Bluteau, H. Luder, C. De Bari, T. Mitsiadis, Stem cells for tooth engineering, Eur.Cell. Mater. 16 (2008) 9.

[43] D. Ribatti, N. Finato, E. Crivellato, A. Marzullo, D. Mangieri, B. Nico, A. Vacca,C.A. Beltrami, Neovascularization and mast cells with tryptase activity increase

simultaneously with pathologic progression in human endometrial cancer, Am. J.Obstet. Gynecol. 193 (2005) 1961–1965.

[44] M. Dominici, K. Le Blanc, I. Mueller, I. Slaper-Cortenbach, F. Marini, D. Krause,R. Deans, A. Keating, D. Prockop, E. Horwitz, Minimal criteria for defining multi-potent mesenchymal stromal cells. The International Society for Cellular Therapyposition statement, Cytotherapy 8 (2006) 315–317.

[45] Y. Zhang, H. Ouyang, C.T. Lim, S. Ramakrishna, Z.M. Huang, Electrospinning ofgelatin fibers and gelatin/PCL composite fibrous scaffolds, J Biomed Mater Res BAppl Biomater 72 (2005) 156–165.

[46] H.W. Kim, H.H. Lee, J. Knowles, Electrospinning biomedical nanocomposite fibersof hydroxyapatite/poly (lactic acid) for bone regeneration, J. Biomed. Mater. Res. A79 (2006) 643–649.

[47] D. Roberts-Clark, A. Smith, Angiogenic growth factors in human dentine matrix,Arch. Oral Biol. 45 (2000) 1013–1016.

[48] P.E. Murray, A.J. Smith, Saving pulps—a biological basis. An overview, Prim. Dent.Care 9 (2002) 21–26.

[49] L. Graham, P.R. Cooper, N. Cassidy, J.E. Nor, A.J. Sloan, A.J. Smith, The effect ofcalcium hydroxide on solubilisation of bio-active dentine matrix components,Biomaterials 27 (2006) 2865–2873.

[50] K. Iohara, L. Zheng, H. Wake, M. Ito, J. Nabekura, H. Wakita, H. Nakamura, T. Into,K. Matsushita, M. Nakashima, A novel stem cell source for vasculogenesis inischemia: subfraction of side population cells from dental pulp, Stem Cells 26(2008) 2408–2418.

[51] A. Dayem, H.Y. Choi, G.-M. Yang, K. Kim, S. Saha, J.-H. Kim, C. S-G, The potentialof nanoparticles in stem cell differentiation and further therapeutic applications,Biotechnol. J. 11 (2016) 1550–1560.

[52] Hyung-Mun Yun, Seok-Woo Chang, Kyung-Ran Park, Lan Herr, E.-C. Kim,Combined effects of growth hormone and mineral trioxide aggregate on growth,differentiation, and angiogenesis in human dental pulp cells, JOE 42 (2016)269–275.

[53] Y. Yamakoshi, Dentin Sialophosphoprotein (DSPP) and dentin, J. Oral Biosci. 50(2008) 33–44.

[54] J. Kim, S.H. Nam, K.T. Jang, S.H. Lee, C.C. Kim, S.H. Hahn, Hu JCC, S. JP, A novelsplice acceptor mutation in the DSPP gene causing dentinogenesis imperfecta typeII, Hum. Genet. 115 (2004) 248–254.

[55] W.T. Butler, Dentin matrix proteins, Eur. J. Oral Sci. 106 (1998) 204–210.[56] J.Q. Feng, X.H. Luan, J. Wallace, D. Jing, T. Ohshima, A.B. Kulkarni, R.N. D'Souza,

C.A. Kozak, M. M, Genomic organization, chromosomal mapping, and promoteranalysis of the mouse dentin sialophosphoprotein (Dspp) gene, which codes forboth dentin sialoprotein and dentin phosphoprotein, J. Biol. Chem. 273 (1998)9457–9464.

[57] S. Tabata, T. Nakayama, K. Funakoshi, K. Yasui, K. Wada, M. Uemura, Collagenfibrils in the odontoblast layer of the rat incisor by scanning electron microscopyusing the maceration method, Anat. Rec. 239 (1994) 360–370.

[58] X. Guo, J.E. Gough, P. Xiao, J. Liu, Z. Shen, Fabrication of nanostructured hydro-xyapatite and analysis of human osteoblastic cellular response, J. Biomed. Mater.Res. A 82 (2007) 1022–1032.

[59] J. Huang, Y.W. Lin, X.W. Fu, S.M. Best, R.A. Brooks, N. Rushton, W. Bonfield,Development of nano-sized hydroxyapatite reinforced composites for tissue en-gineering scaffolds, J. Mater. Sci. Mater. Med. 18 (2007) 2151–2157.

[60] J.B. Bonson, T.E. Lallier, Root-end filling materials alter fibroblast differentiation, J.Dent. Res. 83 (2004) 408–413.

[61] C.G. Pelliccioni, Cenni E. GA, D. Granchi, M. Nanni, S. Pagani, et al., Evaluation ofosteoblast-like cell response to Proroot MTA (mineral trioxide aggregate) cement, J.Mater. Sci. Mater. Med. 15 (2004) 167–173.

[62] D.P. de Souza Costa CA, P.P. de Souza, E.M. Giro, J. Hebling, Cytotoxic effects andpulpal response caused by a mineral trioxide aggregate formulation and calciumhydroxide, Am. J. Dent. 21 (2008) 255–261.

[63] W.D. Dominguez, Gutmann J.L. MS, L.A. Opperman, Histological and scanningelectron microscopy assessment of various vital pulp-therapy materials, J.Endocrinol. 29 (2003) 324–233.

[64] Y.K. Okiji, Reparative dentinogenesis induced by mineral trioxide aggregate: a re-view from the biological and physicochemical points of view, Int. J. Dent. 2009(2009) 464280.

[65] WooCheol Lee, Joung-Hwan Oh, Joo-Cheol Park, Hong-In Shin, J.-H. Baek, H.-M. Ryoo, K.M. Woo, Performance of electrospun poly(e-caprolactone) fiber meshesused with mineral trioxide aggregates in a pulp capping procedure, Acta Biomater.8 (2012) 2986–2995.

[66] B. Hashemi-Beni, M. Khoroushi, M.R. Foroughi, S. Karbasi, A.A. Khademi,Cytotoxicity assessment of polyhydroxybutyrate/chitosan/nano- bioglass nano berscaffolds by stem cells from human exfoliated deciduous teeth stem cells fromdental pulp of exfoliated deciduous tooth, Dent. Res. J. 15 (2018) 136–145.

M. Khoroushi et al. Materials Science & Engineering C 89 (2018) 128–139

139