ORIGINAL ARTICLE

Mapping of DNA Sex-Specific Markers and Genes Relatedto Sex Differentiation in Turbot (Scophthalmus maximus)

Ana Viñas & Xoana Taboada & Luis Vale &

Diego Robledo & Miguel Hermida & Manel Vera &

Paulino Martínez

Received: 15 December 2011 /Accepted: 3 April 2012 /Published online: 3 May 2012# Springer Science+Business Media, LLC 2012

Abstract Production of all-female populations in turbot canincrease farmer’s benefits since sexual dimorphism ingrowth in this species is among the highest within marinefish, turbot females reaching commercial size 3–6 monthsearlier than males. Puberty in males occurs earlier than infemales, which additionally slows their growth. Thus, elu-cidating the mechanisms of sex determination and gonaddifferentiation is a relevant goal for turbot production. A ZZ/ZW sex determination mechanism has been suggested forthis species, and four sex-related quantitative trait loci(QTL) were detected, the major one located in linkage group(LG) 5 and the three minor ones in LG6, LG8, and LG21. Inthe present work, we carried out a linkage analysis forseveral sex-related markers: (1) three anonymous sex-associated RAPD and (2) several candidate genes relatedto sex determination and gonad differentiation in other spe-cies (Sox3, Sox6, Sox8, Sox9, Sox17, Sox19, Amh, Dmrta2,Cyp19a, Cyp19b). We focused our attention on their co-localization with the major and minor sex-related QTLtrying to approach to the master sex-determining gene ofthis species. Previously described growth-related QTL werealso considered since the association observed betweengrowth and sex determination in fish. Amh, Dmrta2, andone RAPD were located in LG5, while Sox9 and Sox17

(LG21), Cyp19b (LG6), and a second RAPD (LG8) co-mapped with suggestive sex-related QTL, thus supportingfurther analyses on these genes to elucidate the genetic basisof this relevant trait for turbot farming.

Keywords Turbot .Linkagemap .Sex .Growth .Candidategenes . QTL

Introduction

Among vertebrates, fish display an enormous variation ofsex determining (SD) mechanisms. Pure genetic (GSD) andenvironmental (ESD) SD mechanisms as well as a continu-ous range between both extremes have been reported in thisgroup (Devlin and Nagahama 2002; Mank and Avise 2009).Different GSD systems have been reported within the samefish genus and even in different populations of the samespecies (Volff 2005), which indicates the rapid evolutionaryturnover of the SD system in fish (Böhne et al. 2009). Onlyone master SD gene has been identified to date in fish, thedmy/dmrt1bY in Oryzias latipes (Matsuda et al. 2002).

Several traits of high economical value are associated tosex in aquaculture species. Sexual dimorphism has beenobserved in growth rate, time and age of maturation, colorpattern or fin shape (Cnaani and Levavi-Sivan 2009). This isthe case of turbot, one of the most appreciated aquaculturespecies in Europe, which shows extreme differential growthrates between sexes (Piferrer et al. 1995). This dimorphismis among the largest ones in farmed marine fishes andcontinues after sexual maturation (Piferrer et al. 2004).Females grow faster than males and reach puberty later,which makes all-female population production desirablefor turbot industry.

A. Viñas (*) :X. Taboada : L. Vale :D. RobledoDepartamento de Genética, Facultad de Biología (CIBUS),Universidad de Santiago de Compostela,Rúa Lope Gómez de Marzoa, s/n 15782,Santiago de Compostela, Spaine-mail: anamaria.vinas@usc.es

M. Hermida :M. Vera : P. MartínezDepartamento de Genética, Facultad de Veterinaria,Universidad de Santiago de Compostela,Campus de Lugo, Avda das Ciencias, s/n 27002,Lugo, Spain

Mar Biotechnol (2012) 14:655–663DOI 10.1007/s10126-012-9451-6

Several studies have been carried out in turbot aiming toelucidate the SD mechanism. The balanced sex ratio infamilies suggests the existence of a major genetic sex-related factor (Imsland et al. 1997) and a limited influenceof environmental factors such as temperature (Haffray et al.2009). Mitotic and meiotic chromosome analysis have notrevealed any heteromorphic sex-associated chromosomepair in this species (Bouza et al. 1994; Cuñado et al.2001). Sex ratio of gynogenetic progenies rendered differentresults, a ZZ/ZW system being reported by Baynes et al.(2006), while other authors suggested a XX/XY mechanism(Cal et al. 2006). Recently, a major SD region on LG5 andthree additional suggestive sex-related QTL were identifiedby a medium scale genome scan for QTL detection (Martí-nez et al. 2009). Segregation analysis demonstrated a ZZ/ZW mechanism in the major SD region. These results agreewith those obtained by Haffray et al. (2009) based on theanalysis of progenies obtained from steroid sex-reversaltreated parents. However, the studies by Martínez et al.(2009) and Haffray et al. (2009) also suggested the influenceof other genetic or environmental factors underlying the SDmechanism in this species. It should be noted that hybrid-ization between turbot (Scophthalmus maximus) and brill(Scophthalmus rhombus) produces monosex progeniesdepending on the sex of the parents, which could suggestdifferent SD mechanisms for these congeneric species(Purdom and Thacker 1980). A recent screening with 2030RAPD DNA markers by Casas et al. (2011) on pooledgenomic DNA from both sexes detected three sex-associated RAPDs, which combined reached a molecularsexing accuracy of 90 % in males and 83.3 % in females.Finally, a transcriptome analysis based on cDNA-AFLPallowed the identification of a set of differentially expressedgenes in male and female adult gonads among which Mns1and Nek10, genes both related to spermatogenesis in mam-mals, showed significant male-biased expression by Q-PCR(Taboada et al. 2012).

Recently, the relationship between sex and growth in fishis gaining importance. Thus, in Salmo salar a QTL formaturation close to a QTL for body weight was identified(Moghadam et al. 2007) and a genetic correlation betweenbody weight and sex reversal in gilthead sea bream wasestablished (Batargias et al. 1998), being recently confirmedby Loukovitis et al. (2011). These authors found two signif-icant QTL one for weight and one for sex co-mapping in thesame position in Sparus aurata.

The objective of this study was to map several markersand candidate genes associated with sex determination inturbot, trying to ascertain their association with previouslyreported sex- (Martínez et al. 2009) and growth-related QTL(Sánchez-Molano et al. 2011) using the turbot map (Bouzaet al. 2007, 2008). These included three sex-associatedRAPD markers in turbot (Casas et al. 2011) and some

orthologous genes of the vertebrate sex determination path-way (Sox3, Sox6, Sox8, Sox9, Sox17, Sox19, Amh, Dmrta2,Cyp19a, Cyp19b). Results showed relationships of some ofthese genes/markers with sex- or growth-related QTL, thussuggesting the convenience of carrying additional analysison them for elucidating the genetic basis of the SD mecha-nism in turbot.

Materials and Methods

PCR Conditions

Genomic DNA was extracted from muscle tissue in allanalyzed individuals using standard phenol–chloroform pro-cedures (Sambrook et al. 1989). Amplicons of the selectedgenes and sex-associated markers (see below) were obtainedin a volume of 50 μl, 75 ng of genomic DNA, 20 pmol ofeach primer, 0.2 mM of each dNTP, 1× PCR reaction buffer,and 2.5 U of GreenTaq DNA polymerase (GenScript). PCRwas performed in a MyCycler Thermal cycler (Bio-Rad) asfollows: initial denaturation at 94 °C for 3 min; 30 cyclesincluding 94 °C during 30 s, 50 s at an annealing tempera-ture between 58 and 60 °C, and an extension time dependenton amplicon size (about 1 kb/min) at 72 °C; and a finalextension step at 72 °C for 7 min. The PCR products wereseparated on agarose gels and stained with SYBR gold(Invitrogen). Amplification products were excised from thegel and purified with Qiaquick gel extraction kit (Qiagen) orobtained directly from PCR amplification using SpinCLean(Mbiotech) kit.

Searching for Polymorphism in Sex-Related Genes

Orthologous sequences of several genes involved in the sexdevelopment pathway of vertebrates (Sox3, Sox6, Sox8,Sox9, Amh, Dmrta2, Cyp19a, and Cyp19b) were obtainedfrom stickleback, fugu, zebrafish, tetraodon, and medakausing ENSEMBL database (http://www.ensembl.org/index.html) and were aligned by CLUSTALW (http://www.ebi.ac.uk/Tools/clustalw2/index.html). Primers to am-plify putative polymorphic fragments within introns weredesigned in conserved adjacent exon regions using thePrimer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for most genes. In Sox3, the ampliconwas obtained from an exon region since this gene lacksintrons. In Sox17 and Sox19, the polymorphism was identi-fied in the 3′ UTR (untranslated region) using the turbotEST database (Pardo et al. 2008; Vera et al. 2011). Whenprimers did not work, as in Amh and Cyp19a, degeneratedprimers were designed from sequences of close related fishspecies deposited in GenBank: Amh from Acanthopagrusschlegelii (GU256046), Dicentrachus labrax (AM232701),

656 Mar Biotechnol (2012) 14:655–663

Odontesthes hatchery (DQ441594), and Paralichthys oliva-ceus (AB166791); and Cyp19a from D. labrax (AJ318516),Monopterus albus (AY583785), Oncorhynchus mykiss(AJ311937), and P. olivaceus (AB017182). After amplifica-tion with these primers, bands were cloned with “pGEM®-TEasy Vector System” (Promega) using high efficiency com-petent cells JM19 and sequenced following the ABI PrismBigDye™ Terminator v3.1 Cycle Sequencing Kit protocolon an ABI 3730xl Genetic Analyzer (Applied Biosystems).Turbot sequences were aligned using the software SeqScapev2.5 (Applied Biosystems) and new primers were designedto look for polymorphism using 10 individuals (five malesand five females) (Table 1). These sequences were alignedand analyzed with SeqScape v2.5 (Applied Biosystems) toidentify polymorphisms.

Searching for Polymorphism in Sex-Associated DNAMarkers

Three sex RAPD markers, ScmM1, ScmF1, and ScmF3,obtained in a previous work on pooled genomic DNA(Casas et al. 2011), were amplified from sequences depos-ited in GenBank (Table 1).

Genotyping and Linkage Maps

Two different sources of variation (length polymorphismand SNP) were used for mapping the sex-related genesand markers following Vera et al. (2011). Primers flankinglength polymorphic regions were designed for ScmM1 andScmFe2 sex-associated markers, and for Sox8, Sox9,Dmrta2 genes. SNP variation was detected at ScmFe1 sex-associated marker, and for Sox3, Sox6, Sox17, Sox19, Amh,Cyp19a, and Cyp19b genes.

Informativeness of the markers for mapping was checkedin the parents of eight reference families used for mapping(Bouza et al. 2007; Sánchez-Molano et al. 2011). This samplewas constituted by a total of 35 individuals corresponding tothe parents (eight males and eight females) and grandparents(eleven males and eight females) available from the mappingfamilies. Progenies of families ranged between 85 and 96offspring. All SNPs were successfully adjusted for Snapshotreactions. Offspring genotyping of the most informative fam-ily was carried out in an ABI 3730xl DNA sequencer usingthe GENEMAPPER 4.0 software (Applied Biosystems). Segrega-tion at each locus was evaluated for conformance to Mende-lian segregation using chi-square tests using Bonferronicorrection (α00.05). Linkage analysis was performed accord-ing to the methodology described by Bouza et al. (2007) onthe consensus map previously reported (Bouza et al. 2007,2008). JoinMap 3.0 was used for map construction, with aLOD threshold >3 and a recombination frequency threshold<0.4 for a consistent mapping.

Results and Discussion

Sex determination depends on an initial signal transmittedthrough a regulatory cascade which leads to the develop-ment of a bipotential gonad as a testis or as an ovary(Graham et al. 2002; Penman and Piferrer 2008). Wilkins(1995) proposed the “bottom-up hypothesis”, according towhich this hierarchy would evolve from downstream com-ponents that would acquire new upstream regulatory func-tions. This is not the case of medaka’s (Oryzias latipes)dmy/Dmrt1bY, the only known sex-determination genedescribed to date in fish (Matsuda et al. 2002), since it aroseas a Dmrt1 duplicate, first located in the autosomal LG9 andthen inserted into another chromosome (proto-Y chromo-some), finally becoming the sex-determination master gene(Schartl 2004).

Linkage mapping provides a powerful tool to detectgenomic regions associated with relevant traits. In our study,we mapped several genes reported to be associated to sexualdifferentiation in other vertebrate species and some anony-mous sex-associated markers previously reported in turbot(Casas et al. 2011). The existence of a major sex-associatedQTL in LG5 of this species and other three minor QTL inLG6, LG8, and LG21 (Martínez et al. 2009) provided areference framework for this task. Also, the genetic associ-ation observed between growth and sex in several fishspecies (Badyaev 2002; McCormick et al. 2010; Loukovitiset al. 2011) suggested to take the growth-related QTL pre-viously identified in turbot (Sánchez-Molano et al. 2011) asan additional reference.

Figure 1 shows the eight linkage groups where the 10sex-related candidate genes and the three sex-associatedRAPD markers were positioned on turbot map. It is note-worthy that five out of 10 genes and two out of three RAPDanalyzed markers were located in the four linkage groups(LG5, LG6, LG8, and LG21) where sex-associated QTLshad been previously reported (Martínez et al. 2009). InTable 2, the mapping positions, within each linkage group,of sex-related genes and markers, the nearest marker withthe low recombination frequency, and the LOD score forconsistent mapping are detailed. With the exception of Sox3,the low recombination frequency to the closest marker andthe LOD score values indicate the reliability of mappingand, consequently, the conclusions derived from it. It isimportant to note that comparative mapping using synteniesof turbot map against the stickleback (Gasterosteus aculeatus)genome (Bouza et al. unpublished) also confirmed the posi-tions obtained in our mapping analysis. Furthermore, in thisanalysis a 1.6:1 female/male ratio of recombination frequency(RF) was observed (Bouza et al. unpublished). This valuecorroborated the female/male RF result obtained in a previouswork (Bouza et al. 2007) and differs slightly from that foundby Ruan et al. (2010) which reported a 1.3:1 ratio of RF.

Mar Biotechnol (2012) 14:655–663 657

Tab

le1

Techn

icalcond

ition

sforam

plificationof

polymorph

icregion

sassociated

tosex-relatedgenes(Sox3,So

x6,S

ox8,So

x9,Sox17,S

ox19,A

mh,

Dmrta2

,Cyp19

a,Cyp19

b)andRAPDmarkers

(SmM1,

Scm

Fe1,Scm

Fe1)used

fortheirmapping

intheturbot

(Scoph

thalmus

maximus)genetic

map

Gene

Accession

number

Primers

SNPinternal

prim

ers

Polym

orph

ism

Amplicon

size

(bp)

Markerpo

sitio

n

Scm

M1

EF61

2196

F:CAGATCACTGGGAGGAGAGC

Lengthpo

lymorph

ism

419

R:TGAGGAGTGTGCAAATCTGTCT

Scm

Fe1

EF61

2192

F:ACTCCAGAATTTGCATCAG

SNP

65R:TCTCTTTTCCCACAGCATCA

Scm

Fe2

EF61

2194

F:TGTTCATGTTGAATGGGACA

Lengthpo

lymorph

ism

183

R:AAAGAGCCAACTCATCTCCTCT

Sox

3JQ

3005

37F:AAGACCAAGACCCTGCTCAA

F:GGCCATCACGTCCCACTC

SNP

545

Exo

nR:GTCCCTGCGCTCTGATA

GTG

Sox

6JQ

4036

37F:CCACTGAGGCGAGAGTCTTC

F:CGCTA

TCTTGTTGTTTCTTA

CCATTT

SNP

691

19th

intron

R:CTCTTGATA

GCCCTGCCAAT

Sox

8JQ

3005

36F:CCCTGAGGAGAAAGCATCAG

Lengthpo

lymorph

ism

224

Secon

dintron

R:GAACCAGGGATTGGAGGATT

Sox

9JQ

3005

35F:GCGCGTCCAAATTTGGCGGA

Lengthpo

lymorph

ism

311

Firstintron

R:GAACGGCCGCTTCTCGCCTT

Sox

17JQ

4036

38F:GAGCAGATGCACCACTCTGA

F:CCTCAAATCTCTGTA

GCAAATTTTTT

SNP

539

Secon

dexon

+3′

UTR

R:GCAAAAAGTA

TAAAAACACCGTCA

Sox

19JQ

4036

39F:TGTGCCTTGCCTTTTGATTT

R:AGACCCTTCTCATGGTCTGG

SNP

600

3′UTR

R:GGTTTGCTGGAGATTTA

GTCTGA

Amh

JQ40

3642

DegF:GASAGYTGRCYCTGTCTCC

R:CCTGCCGCTGGTTCCTTCTT

SNP

250

Sixth

exon

DegR:GAGCCDYBGCAGTTGTTRAT

F:AGGAGGAGGTGGGTCACAG

R:CACGCAGGAGAGAAAACAGA

Dmrta2

JQ40

3644

F:GAGGTGTTTGGTTCCGTCAG

Lengthpo

lymorph

ism

596

Firstintron

R:CTCCGTCTTTCAAAGGCTTG

Cyp

19a

JQ40

3643

DegF:GGVACNGCCWGYAACTA

CTA

CF:GTA

CCTGTCGATGGTGAGGG

SNP

378

Fou

rthintron

DegR:TTBAVBAGCABCAGCATRAA

F:GGAGGTTTGTGTCTCCTCCA

R:AGATGTCGGGTTTGATCAGC

Cyp

19b

JQ40

3645

F:CTTTCTTTGTCCGTTCTTCCA

F:CCTGATTGTA

ATGCCGTCGAT

SNP

197

Ninth

exon

R:GTTGACTTCACCATGCGAAA

FandRindicate

forw

ardandreverseprim

ers,respectiv

ely,andDegFandDegRdegenerate

forw

ardandreverseprim

ers,respectiv

ely

658 Mar Biotechnol (2012) 14:655–663

However, it is important to note that it is a global data anddifferences were found in different linkage groups as we willdiscuss below for LG5 and LG21.

Shirak et al. (2006) considered Amh and Dmrta2 SDcandidate genes in tilapia because they co-localized withQTL related to sex-specific mortality and sex determination,respectively. In this species, a detailed analysis of the sex-associated QTL region in LG23 based on linkage and phys-ical map of 33 genetic markers reduced the sex-relatedinterval to 1.5 Mb, where 51 genes were identified. Amongthese genes, Amh is particularly relevant since it is located inthe center of the sex-related region showing the highestover-expression in male embryos between 3 and 7 dayspost-fertilization (Eshel et al. 2012). Furthermore, Poon-laphdecha et al. (2011) reported a dimorphic expression ofAmh both in the testis and brain of tilapia males during the

critical period of sex differentiation. In a previous work,Martínez et al. (2009) demonstrated a macrosyntenic rela-tionship between turbot LG5 and tilapia LG23 using modelfish genomes as a bridge, indicating the relevance of map-ping Amh and Dmrta2. These genes were located at 10–13 Mb from a sequence homologous to Sma-USC30, theclosest SD turbot marker, using comparative mapping. Amhcodifies the anti-Müllerian hormone, which determines theregression of Müllerian ducts in mammals, birds, and rep-tiles during early testis differentiation (Rey et al. 2003)likely acting as an antiaromatase factor, but its role is notclear in fish. Besides tilapia, Amh expression was demon-strated to be higher in males than in females of rainbow trout(Vizziano et al. 2008), flounder (Yoshinaga et al. 2004),zebrafish (Wang and Orban 2007), and Squalius alburnoides(Pala et al. 2008). On the other hand, Dmrta2, a gene

Sma-USC900.0

Sma-USC468.9

Sma-USC24219.5Sma-USC6431.0Sma-USC17133.8Sma-USC16835.6Sma-USC3637.0Sma-USC8443.8SmaUSC-E644.8Sma-USC24545.5Sma-USC4445.7Sma-USC24947.7Sma-USC18553.0Sma-USC18754.2Sma-USC10957.5Sma-USC4357.8Sma-USC16159.1Sma-USC21966.0

SOX1971.8

Sma-USC112(a)86.9

Sma-USC186100.0Sma-USC166103.1

LG02

Sma-USC470.0

CYP19a13.1Sma-USC17716.1

SOX618.4Sma-USC10219.2Sma-USC167Sma-USC10019.3

Sma-USC27728.0B12-IGT1436.6

SmaUSC-E342.6

Sma-USC749.5

Sma-USC20566.3Sma-USC23067.9

LG04

SOX30.0

Sma4-14INRA36.4

Sma-USC37(a)43.1

ScmFe260.0

Sma-USC17872.8Sma-USC23876.9Sma-USC20678.5

Sma-USC15484.3

B11-I12/6/392.0Sma-USC13594.4

Sma-USC272101.9Sma-USC204102.0Sma-USC174107.1

LG7

Sma-USC2800.0Sma1-125INRA3.1Sma-USC96.3Sma-USC2677.1Sma-USC12511.9Sma-USC7614.1Sma-USC21515.4Sma-USC9415.6Sma-USC3415.7Sma-USC20315.8

SOX816.6Sma-USC11518.4Sma-USC1623.0SmaUSC-E1035.3SmaUSC-E3844.3Sma-USC155(a)51.4

LG13

Sma-USC2700,0

SmaUSC-E306,3

Sma-USC6518,0Sma-USC25422,3

ScmM124,7Sma-USC24735,9

Dmrta242,4Sma-USC1043,0Sma-USC22544,3

Amh48,2Sma-USC8851,2Sma-USC27854,1Sma-USC19858,3Sma-USC1258,5Sma-USC20262,0Sma-USC26564,7Sma1-152INRA66,5

LG05

3/3GT0,0Sma-USC1474,7Sma-USC288,1Sma-USC1078,3Sma3-12INRA9,6Sma-USC18814,8

cyp19b19,5SmaUSC-E2920,8Sma-USC11024,2Sma-USC13229,1Sma-USC22730,7

Sma-USC15964,1

Sma-USC26476,77/1TC1878,0

LG06

Sma-USC1940,0Sma-USC592,1

ScmFe15,7

Sma-USC17035,2

Sma-USC1856,8Sma-USC4859,9

Sma-USC20866,4

LG8

Sma-USC870,0Sma-USC410,4Sma-USC755,5Sma-USC1487,4Sma-USC117

SOX178,6

SOX99,1Sma-USC23117,4Sma-USC23418,0

LG21

Fig. 1 Map positions (highlighted in red) of sex-related genes (Amh,Dmrta2, Cyp19a, Cyp19b, Sox3, Sox8, Sox6, Sox9, Sox17, Sox19) andsex-associated RAPD markers (SmM1, ScmFe1, ScmFe1) on turbot(Scophthalmus maximus) genetic map. The number of each linkage

group (LG) is indicated above, genetic distances in centimorgans onthe left, and marker codes on the right. Framework markers (LOD > 3)are presented in bold face. Gray shading indicates the position of theSD QTLs in LG5, LG6, LG8, and LG21

Table 2 Location of the sex-related genes (Sox3, Sox6, Sox8,Sox9, Sox17, Sox19, Dmrta2,Amh, Cyp19a, Cyp19b) andRAPD markers (ScmFe2,ScmFe1, ScmM1) on turbotlinkage map

The last three columns show thenearest marker with low RF onthe map to each gene or RAPDtested, the recombination fre-quency (RF), and the LOD scorevalue

LG linkage group

Gene LG Nearest marker with low RF RF to nearest marker LOD score

Sox3 7 Sma4-14INRA 0.3111 2.08

Sox6 4 Sma-USC102 0.0000 11.15

Sox8 13 Sma-USC16 0.0106 24.21

Sox9 21 Sma-USC231 0.0000 23.38

Sox17 21 Sma-USC117 0.0000 26.94

Sox19 2 Sma-USC219 0.0405 16.42

Dmrta2 5 Sma-USC247 0.0638 17.63

Amh 5 Sma-USC88 0.0312 23.17

Cyp19a 4 Sma-USC177 0.0460 18.98

Cyp19b 6 Sma-USC110 0.1364 9.40

ScmFe2 7 Sma-USC238 0.0635 12.36

ScmFe1 8 Sma-USC194 0.0500 21.33

ScmM1 5 Sma-USC10 0.1538 9.24

Mar Biotechnol (2012) 14:655–663 659

belonging to the DM gene family, encodes a protein contain-ing a zinc finger motif called the DMdomain.Dmy (dmrt1bY),an ortholog of the mammalian DMRT1, is implicated in testisdevelopment and is the responsible for sex determination inO.latipes (Matsuda et al. 2002), the only sex determination genedetected in fish to date.

Amh and Dmrta2 genes mapped at LG5 in the turbotconsensus map (Fig. 1), as comparative mapping suggested(Martínez et al. 2009), but they were far apart from theclosest major SD marker (SmaUSC-30), at 31.9 and36.1 cM, respectively. SmaUSC-30 correctly sexed 98.4 %of the offspring in the four families analyzed and showedsignificant sex association in a panmictic natural sample(Martínez et al. 2009). In this work, it was estimated thatthe SD gene would be at 2.6 cM of SmaUSC-30. Althoughthe localization of markers in linkage maps depends on thefamily or population analyzed, and on the density ofmarkers, recent data in a new turbot consensus map (Bouzaet al. unpublished) confirm the position of Sma-USC30previously reported. It is remarkable that no relevant recom-bination differences were detected between sexes in LG5(Martínez et al. 2009). Thus, our results very likely discardAmh and Dmrta2 as primary sex determination genes inturbot or, in other words, indicate that both genes are notresponsible for the association values observed between theQTL and sex in LG5. However, this does not mean that bothgenes are unimportant in the sex differentiation of turbot.Other studies such as their expression analysis in differentstages of gonad development are needed to unravel the roleof Amh and Dmrta2 in the sexual development of turbot.

Cytochrome P450 aromatase is a crucial enzyme forgonad differentiation because it drives the conversion ofandrogens into estrogens. In lower vertebrates, inactivationof this enzyme both by environmental factors, such astemperature, or by genes of the differentiation cascade deter-mines testis differentiation, its activity being on the basis ofovary differentiation (Guiguen et al. 2010). In teleost, twogenes of this family, Cyp19a and Cyp19b, encode gonad andbrain aromatases, respectively, which have been describedin most species with some exceptions such as European andJapanese eel (Ijiri et al. 2003; Tzchori et al. 2004). As shownin Fig. 1, Cyp19a was located in turbot map at 13.1 cM inLG4 (Table 2) a linkage group where neither sex- norgrowth-related QTL have been identified to date. However,Cyp19b mapped at 19. 5 cM in LG6, only at 4. 7 cM fromthe closest marker (SmaUSC-110) to a minor sex-relatedturbot QTL (Martínez et al. 2009). There are evidences ofCyp19b aromatase brain sexual dimorphism (Diotel et al.2010; Munakata and Kobayashi 2010; Vizziano-Cantonet etal. 2011) and some studies indicate its putative role in sexualdifferentiation (Diotel et al. 2010).

SRY-related high-mobility-group box (Sox) genes consti-tute a family that encodes transcription factors including a

DNA-binding HMG box domain of conserved 79 aminoacid protein motif (Gubbay et al. 1990) and additionaldomains implicated in transcriptional regulation (Wegner1999). Most mammalian Sox genes have two orthologs inteleost fish as a result of the teleost-specific genome dupli-cation (Koopman et al. 2004). In fish, several Sox geneshave demonstrated gonad expression, but their exact role insex determination and gonad differentiation is mostlyunknown. Sex differentiation and Sox genes have beenrelated since the identification of Sry (Lefebvre et al.2007), a gene expressed in the XY gonad which inducesthe differentiation of Sertoli cells and the subsequent testisdevelopment in mammals (Sinclair et al. 1990).

In this group, Sox9 is expressed after Sry and is requiredfor testis differentiation, but unlike Sry, this gene is con-served in all vertebrates and its expression has been detectedin birds, reptiles, amphibians, and fish. In mammals, Sox9activates the Amh gene (Bagheri-Fam et al. 2009). Q-PCRand in situ hybridization analysis performed on gonad tis-sues have suggested a role for Sox17 in the spermatogenesisand during gonad differentiation from ovary to testis in therice eel, a freshwater species that undergoes natural sexreversal from male to female during its life (Wang et al.2003). In sea bass, this gene was discarded as sex determi-nant because its expression was detected after gonad differ-entiation started. However, a sexual dimorphic expression ofSox17 was described, showing higher expression in femalesas ovarian differentiation progresses (Navarro-Martín et al.2009). Sox17 and Sox9 mapped in turbot LG21 at 0.5 cMbetween them and at 8 cM from the SmaUSC231 micro-satellite (Fig. 1, Table 2), the highest associated marker to asuggestive sex-related QTL in LG21 (Martínez et al. 2009).Remarkably, this linkage group showed sharp recombina-tion frequency differences between sexes, no recombinationbeing detected in males (Bouza et al. 2007). Diminishedrecombination is a property associated with the sex-determining region in the heterogametic sex which avoidsbreakage of beneficial sex-associated allele combinations(Charlesworth and Charlesworth 1997). Our data stronglysuggest further analysis on these genes to understand theirputative role in sex determination.

Sox8, together with Sox9 and Sox10, is expressed in testisdevelopment in mouse. Several experiments revealed thatSox8 and Sox9 show overlapping functions during testisdifferentiation (Chaboissier et al. 2004). Sox 8 mapped at16.6 cM in turbot LG13 (Fig. 1); in this linkage group, asuggestive weight QTL was detected at 10 cM (Sánchez-Molano et al. 2011). Sox3 has been located in the pseudoau-tosomal X–Y homologous region of the X chromosome inhumans and marsupials (Graves 1998) and is the putativeancestor of SRY (Foster and Graves 1994). Despite not beingessential for sex determination, this gene has been related tonormal male testis differentiation and gametogenesis in

660 Mar Biotechnol (2012) 14:655–663

black porgy (Shin et al. 2009), while other studies suggestedits relationship to ovary rather to testis development as inRana rugosa (Oshima et al. 2009). Also, Yao et al. (2007)pointed out that Sox3 is more important for oogenesis thanfor spermatogenesis in protogynous hermaphroditic fish.Sox3 gene was located in turbot LG7 in our study, but itsposition was only suggestive (LOD <3) (Fig. 1, Table 2).Anyway, no sex-associated or growth-related QTL has beenidentified to date in turbot close to this position. No sex-associated or growth-related QTL was previously identifiedin the region of LG2 where Sox19 was located (Fig. 1).Koopman et al. (2004) proposed that this gene could haveevolved from Sox3. Sox19 seems to be fish specific and hasbeen described in zebrafish (Okuda et al. 2006), sturgeon(Hett and Ludwig 2005), fugu (Koopman et al. 2004), ricefield eel (Liu and Zou 2001), and now in turbot.

Expression of Sox6, together with Sox5 and Sox13, hasbeen detected in a variety of vertebrate tissues (Lefebvre2010), and these genes may be involved in sperm matura-tion in vertebrates (Hagiwara 2011). In fish, there are fewworks focused on the analysis of Sox6 function. In rainbowtrout, this gene was excluded as the primary sex-determining gene (Alfaqih et al. 2009), but interestingly itis only expressed in testis (Yamashita et al. 1998). Similarly,Sox6 expression has been detected in mouse in the laststages of spermatogenesis (Takamatsu et al. 1995). In turbot,this gene was located at 18.4 cM in LG4 and at 5 cM ofCyp19a.

Several sex-associated markers had been previously iden-tified in turbot (Casas et al. 2011). ScmM1 RAPD markermapped at 24.7 cM in the major sex-determinant LG5 ofturbot, but at 18.4 cM from the closest marker to the majorsex QTL previously reported (SmaUSC-30; Martínez et al.2009). This distance could explain the limited sexing ofturbot individuals when using this marker (81.7 %; Casaset al. 2011). Interestingly a weight QTL is located in LG5 ina confidence interval between 10 and 30 cM, suggesting theassociation of sex- and growth-related QTL in turbot. Min-ing of genes around this marker by using comparativemapping could provide information to identify relevant can-didates. ScmFe1 RAPD marker was located at 5.7 cM inLG8 only at 3.6 cM of the closest marker (USC59) to asuggestive sex-associated QTL (Martínez et al. 2009). Thismarker yielded a 76.7 % of sexing efficiency (Casas et al.2011), thus, suggesting the involvement of this LG8 regionin sex determination of turbot. Finally, the ScmFe2 RAPDmarker mapped at 60 cM in LG7 associated to Sma-USC135 maker (Fig. 1) where a Fulton factor QTL wasdescribed (confidence interval 10–30 cM; Sánchez-Molanoet al. 2011). As outlined before, a linkage between sex andgrowth appears to be reflected.

This is the first report where sex-related candidate geneshave been mapped to look for their relationship with sex

determination in turbot. Some genes like Dmrta2 and Amh,and a sex-associated RAPD marker were mapped on LG5,where the main sex-related QTL had been previously iden-tified. However, most evidences suggest that they are farapart from the main SD region and further work should beperformed. Other genes like Cyp19b, Sox9, and Sox17, andseveral sex-related RAPD markers co-mapped with sex-related suggestive QTL in different linkage groups, indicat-ing their possible relationship with sex determination andsuggesting a complex regulation of sex determination inturbot. Finally, some candidate genes co-mapped withgrowth-related QTL showing a possible association betweensex determination and growth in this species. This workprovides baseline information for further studies on sexdetermination/differentiation in turbot focusing on theirexpression along gonad development to shed some lighton the sex determination mechanism in this species.

Acknowledgments We thank María López, Lucía Insua, and SoniaGómez for technical assistance. This research work was supported by theConsellería de Educación e Ordenación Universitaria and the DirecciónXeral de I + D Xunta de Galicia (project 10MMA200027PR) and by theSpanish Government (Consolider Ingenio Aquagenomics—CSD2007-00002 project).

References

Alfaqih MA, Brunelli JP, Drew RE, Thorgaard GH (2009) Mapping offive candidate sex-determining loci in rainbow trout (Oncorhynchusmykiss). BMC Genet 10:2

Badyaev AV (2002) Growing apart: an ontogenetic perspective on theevolution of sexual size dimorphism. Trends Ecol Evol 295:316–318

Bagheri-Fam S, Sinclair AH, Koopman P, Harley VR (2009) Con-served regulatory modules in the Sox9 testis-specific enhancerpredict roles for SOX, TCF/LEF, Forkhead, DMRT, and GATAproteins in vertebrate sex determination. Int J Biochem Cell Biol42:472–477

Batargias C, Dermitzakis E, Magoulas A, Zouros E (1998) Character-ization of six polymorphic microsatellite markers in giltheadseabream, Sparus aurata. Mol Ecol 8:897–899

Baynes SM, Verner-Jeffreys D, Howell BR (2006) Research on finfishcultivation. Sci Ser Tech Rep 32:1–64

Böhne A, Schultheis C, Galiana-Arnoux D, Froschauer A, Zhou Q,Schmidt C, Selz Y, Ozouf-Costaz C, Dettai A, Segurens B, CoulouxA, Bernard-Samain S, Barbe V, Chilmonczyk S, Brunet F, Darras A,TomaszkiewiczM, SemonM, Schartl M, Volff JN (2009)Molecularanalysis of the sex chromosomes of the platyfish Xiphophorusmaculatus: towards the identification of a new type of master sexualregulator in vertebrates. Integr Zool 4:277–284

Bouza C, Sánchez L, Martínez P (1994) Karyotypic characterization ofturbot (Scophthalmus maximus) with conventional fluorochromeand restriction endonuclease-banding techniques. Mar Biol120:609–613

Bouza C, Hermida M, Pardo BG, Fernández C, Fortes GG, Castro J,Sánchez L, Presa P, Pérez M, Sanjuán A, de Carlos A, Álvarez-Dios JA, Ezcurra S, Cal RM, Piferrer F, Martínez P (2007) Amicrosatellite genetic map of the turbot (Scophthalmus maximus).Genetics 177:2457–2467

Mar Biotechnol (2012) 14:655–663 661

Bouza C, Hermida M, Millán A, Vilas R, Vera M, Fernández C, CalazaM, Pardo BG, Martínez P (2008) Characterization of EST-derivedmicrosatellites for gene mapping and evolutionary genomics inturbot. Anim Genet 39:666–670

Cal RM, Vidal S, Martínez P, Álvarez-Blázquez B, Gómez C (2006)Survival, growth, gonadal development, and sex ratios of gyno-genetic diploid turbot. J Fish Biol 68:401–413

Casas L, Sánchez L, Orbán L (2011) Sex-associated DNA markersfrom turbot. Mar Biol Res 7:378–387

Chaboissier MC, Kobayashi A, Vidal VI, Lutzkendorf S, Van De KantHJ, Wegner M, De Rooij DG, Behringer RR, Schedl A (2004)Functional analysis of Sox8 and Sox9 during sex determination inthe mouse. Development 131:1891–1901

Charlesworth B, Charlesworth D (1997) Rapid fixation of deleteriousalleles by Muller’s ratchet. Genet Res 70:63–73

Cnaani A, Levavi-Sivan B (2009) Sexual development in fish, practicalapplications for aquaculture. Sex Dev 3:164–175

Cuñado N, Terrones J, Sánchez L, Martínez P, Santos JL (2001) Synap-tonemal complex analysis in spermatocytes and oocytes of turbot,Scophthalmus maximus (Pisces: Scophthalmidae). Genome44:1143–1147

Devlin RH, Nagahama Y (2002) Sex determination and sex differentia-tion in fish: an overview of genetic, physiological and environmentalinfluences. Aquaculture 208:191–364

Diotel N, Page YL, Mouriec K, Tong SK, Pellegrini E, Vaillant C,Anglade I, Brion F, Pakdel F, Chung BC, Kah O (2010) Aromatasein the brain of teleost fish: expression, regulation and putativefunctions. Front Neuroendocrinol 31:172–192

Eshel O, Shirak A, Weller JI, Hulata G, Ron M (2012) Linkage andphysical mapping of sex region on LG23 of Nile tilapia (Oreo-chromis niloticus). G3 (Bethesda) 2:35–42

Foster JW, Graves JA (1994) An SRY-related sequence on the marsupialX chromosome: implications for the evolution of the mammaliantestis-determining gene. Proc Natl Acad Sci U S A 91:1927–1931

Graham P, Penn JKM, Schedl P (2002) Masters change, slaves remain.Bioessays 25:1–4

Graves JAM (1998) Interactions between SRY and SOX genes inmammalian sex determination. Bioessays 20:264–269

Gubbay J, Collignon J, Koopman P, Capel B, Economou A,MunsterbergA (1990) A gene mapping to the sex-determining region of themouse Y chromosome is a member of a new family of embryoni-cally expressed genes. Nature 346:245–250

Guiguen Y, Fostier A, Piferrer F, Chang CF (2010) Ovarian aromataseand estrogens: a pivotal role for gonadal sex differentiation andsex change in fish. Gen Comp Endocrinol 165:352–366

Haffray P, Lebège E, Jeu S, Guennoc M, Guiguen Y, Baroiller JF, FostierA (2009) Genetic determination and temperature effects on turbotScophthalmus maximus sex differentiation: an investigation usingsteroid sex-inverted males and females. Aquaculture 294:30–36

Hagiwara N (2011) Sox6, jack of all trades: a versatile regulatoryprotein in vertebrate development. Dev Dyn 240:1311–1321

Hett AK, Ludwig A (2005) SRY-related (Sox) genes in the genome ofEuropean Atlantic sturgeon (Acipenser sturio). Genome 48:181–186

Ijiri S, Kazeto V, Lokman PM, Adachi S, Yamauchi K (2003) Charac-terization of a cDNA encoding P-450 aromatase (CYP19) fromJapanese eel ovary and its expression in ovarian follicles duringinduced ovarian development. Gen Comp Endocrinol 130:193–203

Imsland A, Folkvord A, Stefansson O, Taranger L (1997) Sexualdimorphism in growth and maturation of turbot, Scophthalmusmaximus (Rafinesque, 1810). Aquac Res 28:101–114

Koopman P, Scheper G, Brenner S, Venkatesh B (2004) Origin anddiversity of the Sox transcription factor gene family: genome-wideanalysis in Fugu rubripes. Gene 328:177–186

Lefebvre V (2010) The SoxD transcription factors-Sox5, Sox6, andSox13-are key cell fate modulators. Int J Biochem Cell Biol42:429–432

Lefebvre V, Dumitriu B, Penzo-Méndez A, Han Y, Pallavi B (2007)Control of cell fate and differentiation by Sry-related high-mobility-group box (Sox) transcription factors. Int J BiochemCell Biol 39:2195–2214

Liu L, Zhou R (2001) Isolation of Sox11a, Sox11b and Sox19 genesfrom rice field eel (Monopterus albus) using degenerate primersand nested PCR. Aquat Sci 63:191–195

Loukovitis D, Sarropoulou E, Tsigenopoulos CS, Batargias C, MagoulasA, Apostolidis AP, Chatziplis D, Kotoulas G (2011) Quantitativetrait loci involved in sex determination and body growth in thegilthead sea bream (Spaurus aurata L.) through targeted genomescan. PLoS One 6:e16599

Mank JE, Avise JC (2009) Evolutionary diversity and turn-over of sexdetermination in teleost fishes. Sex Dev 3:60–67

Martínez P, Bouza C, Hermida M, Fernández J, Toro MA, Vera M, PardoB, Millán A, Fernández C, Vilas R, Viñas A, Sánchez L, Felip A,Piferrer F, Ferreiro I, Cabaleiro S (2009) Identification of the majorsex-determining region of turbot (Scophthalmus maximus). Genetics183:1443–1452

Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, KobayashiT, Morrey CE, Shibata N, Asakawa S, Shimizu N, Hori H,Hamaguchi S, Sakaizumi M (2002) DMY is a Y specific DM-domain gene required for male development in the medaka fish.Nature 30:559–563

McCormick MI, Ryen CA, Munday PL, Walker SPW (2010) Differingmechanisms underlie sexual size-dimorphism in two populationsof a sex-changing fish. PLoS One 5:e10616

Moghadam HK, Poissant J, Fotherb H, Haidle L, Ferguson MM,Danzmann RG (2007) Quantitative trait loci for body weight,condition factor and age at sexual maturation in Arctic charr(Salvelinus alpinus): comparative analysis with rainbow trout(Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). MolGenet Genomics 277:647–661

Munakata A, Kobayashi M (2010) Endocrine control of sexual behaviorin teleost fish. Gen Comp Endocrinol 165:456–468

Navarro-Martín L, Galay-Burgos M, Sweeney G, Piferrer F (2009)Different sox17 transcripts during sex differentiation in sea bass,Dicentrarchus labrax. Mol Cell Endocrinol 299:240–251

Okuda Y, Yoda H, UchikawaM, Furutani-Seiki M, Takeda H, Kondoh H,Kamachi Y (2006) Comparative genomic and expression analysis ofgroup B1 sox genes in zebrafish indicates their diversification duringvertebrate evolution. Dev Dyn 235:811–825

Oshima Y, Naruse K, Nakamura Y, Nakamura M (2009) Sox3: atranscription factor for Cyp19 expression in the frog Rana rugosa.Gene 445:38–48

Pala I, Klüver N, Thorsteinsdóttir S, Schartl M, Coelho MM (2008)Expression pattern of anti-Müllerian hormone (amh) in the hybridfish complex of Squalius alburnoides. Gene 410:249–258

Pardo BG, Fernández C, Millán A, Bouza C, Vázquez-López A, VeraM, Alvarez-Dios JA, Calaza M, Gómez-Tato A, Vázquez M,Cabaleiro S, Magariños B, Lemos ML, Leiro JM, Martínez P(2008) Expressed sequence tags (ESTs) from immune tissues ofturbot (Scophthalmus maximus) challenged with pathogens. BMCVet Res 4:37

Penman DJ, Piferrer F (2008) Fish gonadogenesis. Part I. Genetic andenvironmental mechanisms of sex determination. Rev Fish Sci 16(S1):14–32

Piferrer F, Felip A, Blazquez M (1995) Control genético y fisiológicode las proporciones de sexos de los teleósteos y su aplicación enacuicultura. In: Aulas del Mar, Acuicultura, Biología Marina.Zamora S., Agulleiro y Garcia O. (eds) Murcia. pp: 75–109

Piferrer F, Cal FRM, Gómez C, Álvarez-Blázquez B, Castro J,Martínez P(2004) Induction of gynogenesis in the turbot (Scophthalmusmaximus): effects of UV irradiation on sperm motility, the Hertwigeffect and viability during the first 6 months of age. Aquaculture238:403–419

662 Mar Biotechnol (2012) 14:655–663

Poonlaphdecha S, Pepey E, Huang SH, Canonne M, Soler L, MortajiS, Morand S, Pfennig F, Melard C, Baroiller JF (2011) Elevatedamh gene expression in the brain of male tilapia (Oreochromisniloticus) during testis differentiation. Sex Dev 5:33–47

Purdom CE, Thacker G (1980) Hybrid fish could have farm potential.Fish Farmer 3:34–35

Rey R, Lukas-Croisier C, Lasala C, Bedecarras P (2003) AMH/MIS:what we know already about the gene, the protein and its regulation.Mol Cell Endocrinol 211:21–31

Ruan X, Wang W, Kong J, YuF HX (2010) Genetic linkage mapping ofturbot (Scophthalmus maximus L) using microsatellite markersand its application in QTL analysis. Aquaculture 308:89–100

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. Alaboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY

Sánchez-Molano E, Cerna A, Toro MA, Bouza C, Hermida M, PardoBG, Cabaleiro S, Fernández J, Martínez P (2011) Detection ofgrowth-related QTL in turbot (Scophthalmus maximus). BMCGenomics 12:473

Schartl M (2004) Sex chromosome evolution in non-mammalianvertebrates. Curr Opin Gen Dev 14:634–641

Shin HS, An KW, Park MS, Jeong MH, Choi CY (2009) QuantitativemRNA expression of sox3 and DMRT1 during sex reversal, andexpression profiles after GnRHa administration in black porgy,Acanthopagrus schlegeli. Comp Biochem Physiol 154B:150–156

Shirak A, Seroussi E, Cnaani A, Howe AE, Domokhovsky R, ZilbermanN (2006) Amh and Dmrta2 genes map to tilapia (Oreochromis spp.)linkage group 23 within quantitative trait locus regions for sexdetermination. Genetics 174:1573–1581

Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ(1990) A gene from the human sex-determining region encodes aprotein with homology to a conserved DNA binding motif. Nature346:240–244

Taboada X, Robledo D, Del Palacio L, Rodeiro A, Felip A, Martínez P,Viñas A (2012) Comparative expression analysis in maturegonads, liver and brain of turbot (Scophthalmus maximus) bycDNA-AFLPs. Gene 492(1):250–261

Takamatsu N, Kanda H, Tsuchiya I, Yamada S, ItoM, Kabeno S, Shiba T,Yamashita S (1995) A gene that is related to SRYand is expressed inthe testes encodes a leucine zipper-containing protein. Mol Cell Biol15:3759–3766

Tzchori I, Degani G, Hurvitz A, Moav B (2004) Cloning and devel-opmental expression of the cytochrome P450 aromatase gene(CYP19) in the European eel (Anguilla anguilla). Gen CompEndocrinol 138:271–280

Vera M, Alvarez-Dios JA, Millán A, Pardo BG, Bouza C, Hermida M,Fernández C, de la Herrán R, Molina-Luzón MJ, Martínez P(2011) Validation of single nucleotide polymorphism (SNP)markers from an immune Expressed Sequence Tag (EST) turbot,Scophthalmus maximus, database. Aquaculture 313:31–41

Vizziano D, Baron D, Randuineau G, Mahe S, Cauty C, Guiguen Y(2008) Rainbow trout gonadal masculinization induced by inhi-bition of estrogen synthesis is more physiological than masculin-ization induced by androgen supplementation. Biol Reprod78:939–946

Vizziano-Cantonnet D, Anglade I, Pellegrini E, Gueguen MM, FostierA, Guiguen Y, Kah O (2011) Sexual dimorphism in the brainaromatase expression and activity, and in the central expression ofother steroidogenic enzymes during the period of sex differentia-tion in monosex rainbow trout populations. Gen Comp Endocri-nol 170:346–355

Volff JN (2005) Genome evolution and biodiversity in teleost fish.Heredity 94:280–294

Wang XG, Orban L (2007) Anti-Müllerian hormone and 11 β-hydroxilase show reciprocal expression to that of aromatase inthe transforming gonad of zebrafish males. Dev Dyn 236:1329–1338

Wang R, Cheng HH, Xia LX, Guo YQ, Huang X, Zhou RJ (2003)Molecular cloning and expression of Sox17 in gonads during sexreversal in the rice field eel, a teleost fish with a characteristic ofnatural sex transformation. Biochem Biophys Res Commun303:452–457

Wegner M (1999) From head to toes: the multiple facets of Soxproteins. Nucleic Acids Res 27:1409–1420

Wilkins AS (1995) Moving up the hierarchy: a hypothesis on theevolution of a genetic sex determination pathway. Bioessays17:71–77

Yamashita A, Suzuki S, Fujitani K, Kojima M, Kanda H, Ito M,Takamatsu N, Yamashita S, Shiba T (1998) cDNA cloning of anovel rainbow trout SRY-type HMG box protein, rtSox23 and itsfunctional analysis. Gene 209:193–200

Yao B, Zhou L, Wang Y, Xia W, Gui JF (2007) Differential expressionand dynamic changes of SOX3 during gametogenesis and sexinversion in protogynous hermaphroditic fish. J Exp Zool307A:207–219

Yoshinaga N, Shiraishi E, Yamamoto T, Iguchi T, Abe S, Kitano T(2004) Sexually dimorphic expression of a teleost homologue ofMullerian inhibiting substance during gonadal sex differentiationin Japanese flounder, Paralichthys olivaceus. Biochem BiophysRes Commun 322:508–513

Mar Biotechnol (2012) 14:655–663 663