Maize Dek15 Encodes the Cohesin-Loading Complex SubunitSCC4 and Is Essential for Chromosome Segregation andKernel Development[OPEN]

Yonghui He,a Jinguang Wang,b Weiwei Qi,b and Rentao Songa,1

a State Key Laboratory of Plant Physiology and Biochemistry, National Maize Improvement Center, Beijing Key Laboratory of CropGenetic Improvement, Joint International Research Laboratory of Crop Molecular Breeding, College of Agronomy and Biotechnology,China Agricultural University, Beijing 100193, Chinab Shanghai Key Laboratory of Bio-Energy Crops, Plant Science Center, School of Life Sciences, Shanghai University, Shanghai200444, China

ORCID IDs: 0000-0002-2432-3950 (Y.H.); 0000-0003-2597-7347 (J.W.); 0000-0002-6329-4072 (W.Q.); 0000-0003-1810-9875 (R.S.)

Cohesin complexes maintain sister chromatid cohesion to ensure proper chromosome segregation during mitosis andmeiosis. In plants, the exact components and functions of the cohesin complex remain poorly understood. Here, wepositionally cloned the classic maize (Zea mays) mutant defective kernel 15 (dek15), revealing that it encodes a homolog ofSISTER CHROMATID COHESION PROTEIN 4 (SCC4), a loader subunit of the cohesin ring. Developing dek15 kernelscontained fewer cells than the wild type, but had a highly variable cell size. The dek15 mutation was found to disrupt themitotic cell cycle and endoreduplication, resulting in a reduced endosperm and embryo lethality. The cells in the dek15endosperm and embryo exhibited precocious sister chromatid separation and other chromosome segregation errors,including misaligned chromosomes, lagging chromosomes, and micronuclei, resulting in a high percentage of aneuploidcells. The loss of Dek15/Scc4 function upregulated the expression of genes involved in cell cycle progression and stressresponses, and downregulated key genes involved in organic synthesis during maize endosperm development. Our yeasttwo-hybrid screen identified the chromatin remodeling proteins chromatin remodeling factor 4, chromatin remodelingcomplex subunit B (CHB)102, CHB105, and CHB106 as SCC4-interacting proteins, suggesting a possible mechanism by whichthe cohesin ring is loaded onto chromatin in plant cells. This study revealed biological functions for DEK15/SCC4 in mitoticchromosome segregation and kernel development in maize.

INTRODUCTION

Plant development depends on the proper regulation of mitosis.The mitotic cell cycle contains interphase stages (G1, S, and G2)and a mitosis phase (the M-phase, comprising prophase, meta-phase, anaphase, and telophase; McIntosh, 2016). Sister chro-matid cohesion and segregation is a critical step for guaranteeingthe equal distribution of geneticmaterials betweendaughter cells.FromtheG1/Sphase toanaphase, thesisterchromatidsare linkedtogether by cohesin, a ring-shaped SMC (structural maintenanceof chromosomes) complex, comprising two heterodimericATPases (SMC1 and SMC3), an a-kleisin hinge (sister chromatidcohesion protein 1; SCC1), and an adaptor protein (SCC3;Uhlmann andNasmyth, 1998; Uhlmann et al., 1999; Nasmyth andHaering, 2009; Uhlmann, 2016). Together, these proteins forma tetramer ring encircling chromatin (Haering et al., 2002; Gligoriset al., 2014). Thecohesin complexproteins arehighly conserved inmicrobes, plants, and animals (Nasmyth and Haering, 2009;Uhlmann, 2016; Bolaños-Villegas et al., 2017).

The localization of cohesin ring depends on a heterodimericcomplex of SCC2 and SCC4 homologs (Ciosk et al., 2000;Chao et al., 2015). SCC4 is a small (624 amino acids in buddingyeast; Saccharomyces cerevisiae) protein containing a multiple-tetratricopeptide-repeats (TPRs) superhelix, whereas SCC2 isa large (1493 amino acid in budding yeast) protein with multipleHuntingtin-elongation factor 3-protein phosphatase 2A-TOR1repeats (Ciosket al., 2000;Hinshawet al., 2015). TheN terminusofSCC2 is the “handle” that binds SCC4 to form a cohesin loader,and theC terminusof SCC2 formsa flexible “hook” to interactwithcohesin (Chao et al., 2015, 2017; Hinshaw et al., 2015; Kikuchiet al., 2016). The SCC2/SCC4 complex is specifically required topromote cohesin linkage to chromatin in an ATP-dependentmanner at G1/S phase (Bernard et al., 2006; Murayama andUhlmann, 2014). SCC4 was first identified as a cohesin loadersubunit for its role in recruiting cohesin to both the centromere andthe chromosomearmsof yeast, afterwhich its conserved functionwas also detected in humans and animals (Ciosk et al., 2000;Seitan et al., 2006; Watrin et al., 2006).SCC4 is indispensable for cell division and developmental pro-

cesses. In yeast, scc4mutant spores die after one or two divisions,whereas in the nematode Caenorhabditis elegans, the mau-2mutant (lacking an ortholog of SCC4) shows partial unviability oflarvae as well as defects in locomotion and egg laying (Ciosk et al.,2000; Bénard et al., 2004). The western clawed frog (Xenopustropicalis) knockdown mutant mau-2 exhibited growth retardationand developmental defects in the early embryo (Seitan et al., 2006).

1 Address correspondence to rentaosong@cau.edu.cn.The author responsible for distribution of materials integral to the findingspresented in this article in accordance with the policy described in theInstructions for Authors (www.plantcell.org) is: Rentao Song (rentaosong@cau.edu.cn).[OPEN]Articles can be viewed without a subscription.www.plantcell.org/cgi/doi/10.1105/tpc.18.00921

The Plant Cell, Vol. 31: 465–485, February 2019, www.plantcell.org ã 2019 ASPB.

In Arabidopsis (Arabidopsis thaliana), the scc4 mutation leads toendosperm defects and embryo lethality, similar to the effects ofthe scc2, smc1,andsmc3mutations (LiuCmetal., 2002; Sebastianetal.,2009;Mininaetal., 2017).SCC4depletion leads toprecocioussister chromatid separation (PSCS) during mitosis in yeast andanimals (Ciosk et al., 2000; Seitan et al., 2006; Watrin et al., 2006);however, the function ofSCC4 inplant cellmitosis remainsunclear.

Maize (Zea mays) kernels contain an embryo and endosperm,both of which are products of double fertilization (Russell, 1992).Endosperm development begins with a triploid (3C) cell formedfrom the twopolar nuclei of theovule andone spermcell. In the veryearly stages of endosperm development, a large number of nucleiareproducedwithout subsequent cytokinesis, formingasyncytium(Olsen, 2001). These nuclei are then surrounded by cell walls toform cells, which continue to divide and differentiate to form themajor endosperm cell types, such as the starchy endosperm (SE),basal endosperm transfer layer (BETL), aleurone layer (AL), andembryo-surrounding region (Olsen,2001;Sabelli andLarkins,2009;Doll et al., 2017). Endosperm cells have strong mitotic activitybetween 8 and 14 d after pollination (DAP), after which mitotic cellproliferation persists only in the peripheral cell layers (AL and thesubaleurone layer) until;20 to 25 DAP (Kowles and Phillips, 1985,1988;Schweizer et al., 1995). TheSEcells in the central endospermchange from mitosis to endoreduplication at 10 DAP, increasingtheir DNA contents without undergoing sister chromatid segre-gation (Kowles and Phillips, 1985; Sabelli and Larkins, 2009). Theembryo itself begins development as a diploid (2C) zygote, fromwhich the mature embryo is formed by a continuous process ofmitosisandcell differentiation (Doll et al., 2017). Thedevelopmentofthe endosperm and the embryo therefore depend on the properregulation of mitosis and cell differentiation, making maize kerneldevelopment a good model for studying these processes.

Maize has a long history of genetic study, during which a richresource of mutants has been developed. The defective kernel(dek)mutants are affected in the development of both the embryoand the endosperm, and were initially generated through ethylmethanesulfonate (EMS) mutagenesis of the pollen (Neuffer andSheridan, 1980). Only a fraction of the dek mutants have beencloned and functionally characterized (Lid et al., 2002; Qi et al.,2016b, 2017a, 2017b; Garcia et al., 2017; Wang et al., 2017; Daiet al., 2018; Li et al., 2018b). In this study, we analyzed the classicmaizemutationdek15,which leads toa reducedendospermand isembryo lethal. Positional cloning revealed thatDek15encodes themaize homologof SCC4.Our cytological analysis showed that thedek15mutation causes defects in sister chromatid cohesion andaneuploidy, and we found that the transcriptome of the mutantswas also dramatically altered. We conclude that Dek15/Scc4 isrequired to precisely regulate chromosome segregation, possiblyby interacting with the chromatin remodeling complex to assistcohesin binding to chromatin.

RESULTS

dek15 Causes a Reduced Endosperm and Is Embryo Lethal

The classic dek15 mutant was previously generated using EMSmutagenesis in maize (Neuffer and Sheridan, 1980). This mutant

wasobtained from theMaizeGeneticsCooperationStockCenter,then crossed to the W22 inbred line and selfed to obtain F2 ears.The segregation ratio of wild-type (+/+ and dek15/+) and mu-tant (dek15/dek15) kernels on the F2 ears was close to 3:1(Supplemental Figure1A), suggesting thatdek15plantscontaineda recessive mutation in a single gene.Compared with the wild type, the mature dek15 kernels were

pale and small but more variable in size (Figures 1A and 1B), witha 100-kernelweight only 42.0%of that of thewild type (Figure 1C).In the dek15 kernels, both the endosperm and the embryo wereseverely affected (Figure 1D); the dek15 embryos were difficult toobserve in the mature kernels (Figure 1B), because only smallembryo debris could be identified using an anatomical micro-scope (Figure 1D). The dek15 kernels were incapable of germi-nating (Figure 1E). All attempts to rescue the immature dek15embryos at 18 DAP on Murashige and Skoog medium failed(Figure 1F).The developing kernels of dek15 were observed from 9 DAP to

24 DAP (Supplemental Figure 1B). The dek15 kernels could beclearly distinguished from the wild type by their lighter color asearly as 12 DAP, and the immature mutant kernels were smallerthan the wild type at all developmental stages (SupplementalFigure 1C). The dek15 embryos appeared to be more severelyaffected than the endosperm (Figures 1G to 1I; SupplementalFigure 2); while the wild type formed the typical embryonicstructures, including the scutellum, leaf primordia, shoot apicalmeristem, and root apical meristem, the dek15 embryos arrestedduring early development, and were much smaller than those ofthe wild type (Figure 1H). In addition there was no relationshipbetween defective embryo size and endosperm size in the dek15kernels at 15 DAP (Supplemental Figure 2B).Transmission electron microscopy observations revealed that

the immature dek15 endosperm contained fewer and smallerstarch grains and protein bodies than that of the wild type(Figure 2A). In the mature dek15 endosperm, scanning electronmicroscopy observation revealed that the starch grains were alsosmaller at this stage, and that the mature endosperm containedlessof theproteinaceousmatrix than thewild type (Figure 2B). Thestarch and protein contents of the dek15 endosperm were sig-nificantly lower than those of the wild-type endosperm, both asa percentage of kernel weight (Figure 2C) and as the averagecontents per kernel (Figure 2D).

Positional Cloning of Dek15

Dek15 was mapped to a 28.236-Mb interval on chromosome 4(from 160,472,432 to 188,708,387) using the maize SNP3072genotyping array. With use of additional markers, the mappinginterval was narrowed down to 431 kb (from 182,738,064 to183,169,294) based on the analysis of 979 mutant kernels fromthe F2 population (Figure 3A). The Dek15 interval contained ninepredicted protein-coding genes according to the B73 referencegenome (Jiaoetal., 2017).Acomparisonof thesequencesof thesepredicted genes in the wild-type and dek15 plants revealed thatonlyG3 (Zm00001d052192) andG7 (Zm00001d052197) containedmutations that would be expected to cause the loss of genefunction. G3 was excluded as a Dek15 candidate because loss-of-function mutations of this gene were also present in other

466 The Plant Cell

tested inbred lines (Zong31, Zheng58, W64a, W22, Mo17, 2674,Chang7-2, and Xun928) that lacked the dek15 phenotype. Indek15, G7 contained a typical EMS-induced G-to-A mutation659 bp from the start codon, resulting in a codon change of TGG(tryptophan) toTAG (stopcodon) and thepremature terminationofthe open reading frame (ORF; Figure 3B). This point mutationmeant that only the N-terminal 219 amino acids of the 727-aminoacid wild-type protein were retained in the mature dek15 protein

(Figure 3C), suggesting that G7 (Zm00001d052197) was thecandidate Dek15 gene.

Functional Complementation and Allelic Confirmationof Dek15

To confirm that G7 (Zm00001d052197) was Dek15, a transgenicfunctional complementation test was performed. The genomic

Figure 1. Phenotypic Features of dek15 Kernels.

(A) Mature F2 ear of dek15 3 W22. Arrows indicate the dek15 kernels. Bar = 1 cm.(B) Mature wild-type (WT) and dek15 kernels from a segregated F2 ear. Bar = 1 cm.(C) Comparison of the 100-kernel weight of randomly selected mature wild-type and dek15 kernels in a segregated F2 population. Values are means with6SE; n = 3 (***, P < 0.001, Student’s t test).(D) Longitudinal sections of wild-type and dek15 mature kernels. En, endosperm; Em, embryo. Bar = 1 mm.(E) Germination test of wild-type and dek15 mature kernels (7 DAG). Bar = 1 cm.(F) Attempts to rescue the immature embryos (18 DAP) of wild type and dek15 on Murashige and Skoog medium. The result was observed after 6 d ofcultivation. Bar = 1 cm.(G) Longitudinal paraffin sections of developing wild-type and dek15 kernels at 15 DAP. En, endosperm; Em, embryo. Bars = 1 mm.(H) Developing wild-type and dek15 embryos at 15 DAP. SC, scutellum; LP, leaf primordia; SAM, shoot apical meristem; RAM, root apical meristem.Bars = 100 mm.(I)Comparison of the developing endosperm area and embryo area in wild-type and dek15 kernels at 15 DAP. Values are means6SE; n = 3 kernels for wildtype; n = 5 kernels for dek15. (***, P < 0.001; ns, not significant; Student’s t test)

Mitotic Chromosome Segregation Requires Dek15/Scc4 467

fragment of Zm00001d052197 is very long (20,084 bp); therefore,only theORFofG7 (2181bp)wasused to construct the transgenicvector, and was transformed intomaize (pApB, Hi-II hybrid) underthe control of its native promoter (2030 bp upstream from thetranslational start codon). Three independent transgenic lineswere obtained, two of which were crossed to the dek15 hetero-zygous plants and then selfed to obtain F2 ears. With use of themolecular marker AC190640.21, which was tightly linked to thedek15 locus, the kernels containing the homozygous dek15 locuswere identified (Figure 3D and 3E). These homozygous dek15kernels were then genotyped using primers specific for the Bargene on the transgene construct to identify the kernels containingthe G7 transgene (Figure 3F). The homozygous dek15 kernelscontaining the G7 transgene had all reverted to the wild-typephenotype, whereas the kernels lacking the G7 transgeneretained the mutant phenotype. This demonstrated that the

transformed G7 ORF complemented the dek15 mutation, andindicated that Zm00001d052197 is Dek15.Targeted mutation of Zm00001d052197 was also performed

using the CRISPR/Cas9 system (Qi et al., 2016a). The guide RNA(gRNA) spacer sequencesweredesigned to target the 2ndexonofZm00001d052197 (1,000–1,019 bp of the G7 ORF). Six in-dependentCRISPR/Cas9 transgenic lineswere obtained, three ofwhichcontainedcodon-shiftingmutationscausedbyadeletionorinsertionat the target sequence (Figure4A). Thephenotypesof thekernels carrying these mutated alleles showed a similar defectivephenotype to dek15 (Figures 4B to 4D; Supplemental Figure 3A).Allelism tests were performed by crossing two independentheterozygous mutated alleles (dek15-cas9-1 and dek15-cas9-3)with heterozygous dek15. The kernel phenotypes in the F2 earsdisplayed a 3:1 segregation of wild-type and mutant kernels(Supplemental Figure 3B). The genotyping of randomly selectedkernels from the allelism test ears indicated that all those with themutant phenotypecontainedboth thedek15 locusand thedek15-cas9 locus (Figures 4E to 4G). This result indicated that dek15-cas9 and dek15 cannot complement each other, and furtherconfirmed that G7 (Zm00001d052197) is Dek15.

Dek15 Encodes a Homolog of SCC4

The genomic DNA sequence of Dek15 (Zm00001d052197) is20,084 bp, comprising 10 exons and 9 introns (https://www.maizegdb.org/). The mature transcript of Dek15 has a 2,181-bpcoding sequence, encoding an 80-kD protein comprising 727amino acids. The Zm00001d052197 protein was previously an-notated as a protein with unknown function in maizeGDB. Se-quences homologous to this protein were identified usinga Protein Basic Local Alignment Search Tool (BLASTp) search(https://blast.ncbi.nlm.nih.gov/Blast.cgi), the results of whichindicated that DEK15 shared significant sequence similaritywith a cohesin loader subunit, SCC4, which is conserved ina variety of other species. Both bioinformatics predictions andprotein crystal structures have shown that SCC4 in other spe-cies contains multiple TPR domains, which are composed of34 amino acid residues in tandem repeating units (Blatch andLässle, 1999;Seitan et al., 2006;Watrin et al., 2006;Hinshawet al.,2015). The TPRpredprogram (Zimmermann et al., 2018) predictedthat the C terminus of DEK15 contained five TPRs (Figure 3C). Inthe maize B73 reference genome (Jiao et al., 2017), Dek15 wasfound to be the only SCC4 homolog. It was therefore namedZmSCC4.

Scc4 Is Highly Conserved and Constitutively Expressed

A phylogenetic tree was constructed using ZmSCC4 and itshomologous proteins from other species (Figure 5A; Sup-plemental Data Set 1). ZmSCC4 was most closely related to theSCC4 proteins in plants, followed by those of animals and mi-crobes. Among plants, ZmSCC4wasmore closely related to theSCC4 proteins of monocots than dicots. The plant SCC4scontained an extra segment of;100 amino acids in themiddle ofthe protein (Supplemental Figure 4), suggesting that plantSCC4s may have some unique features not present in theiranimal and microbe counterparts.

Figure 2. Cytological and Biochemical Analysis of Wild-Type (WT) anddek15 Endosperm.

(A) Transmission electron microscopy analysis of the third cell layer fromthe aleurone layer in the wild-type and dek15 endosperm at 15 DAP.Bars = 10 mm. SG, starch granule; PB, protein body; Nu, nucleus.(B)Scanning electronmicroscopy analysis of the central regions ofmaturewild-type and dek15 endosperm. Bars = 10 mm. SG, starch granule; PM,proteinaceous matrix.(C) Starch and total protein contents of mature wild-type and dek15 en-dosperm relative to the kernel weight. Values are means6SE; n = 3 (*, P <0.05; **, P < 0.01, Student’s t test).(D) Starch and total protein contents of the mature wild-type and dek15endospermof individual kernels. Valuesaremeans6SE;n=3 (***,P<0.001,Student’s t test).

468 The Plant Cell

Figure 3. Positional Cloning and Identification of Dek15.

(A) The dek15mutant was crossed to theW22 inbred line, then selfed to obtain F2 ears. A total of 979mutant kernels from F2 populationwere analyzed. Thenumber belowmolecular marker indicates the ratio of the recombinant exchange kernels in the tested population. The dek15 locus was narrowed down toa 431-kb interval on chromosome 4, which contained nine candidate genes: Zm00001d052190 (G1), Zm00001d052191 (G2), Zm00001d052192 (G3),Zm00001d052193 (G4), Zm00001d052194 (G5), Zm00001d052195 (G6), Zm00001d052197 (G7), Zm00001d052198 (G8), and Zm00001d052200 (G9).(B)Structureandmutationsiteof theZm00001d052197gene.Lines represent introns, blackboxes represent exons, andwhiteboxes represent the59and39untranslated regions.(C)Schematicdiagramof theZm00001d052197proteinstructureandmutationsite.Zm00001d052197waspredicted tocontainsfive tandemrepeatsof theTPR domain (gray squares) using TPRpred (https://toolkit.tuebingen.mpg.de/tprpred/). AA, amino acid.(D) to (F) Functional complementation test of dek15. (D) Representative kernels with the wild-type (wild type [WT]; top) and mutant (bottom) phenotypes,fromF2earsproduced fromacrossbetween theG7-ORF-expressing transgenic lines (T0) and thedek15heterozygousplant. (E)Homozygousdek15kernelswere identifiedusing themarkerAC190640.21,which isclosely linked to thedek15 locus.dek15, homozygousdek15; -,water. (F)The transgenedetectionofthe above kernels using the primers for the Bar gene on transgene construct. +, Zm00001d052197 transgene construct; -, water.

Mitotic Chromosome Segregation Requires Dek15/Scc4 469

The results of RT-quantitative PCR analysis revealed that Scc4was constitutively expressed in broad range of maize tissues.Its expression levelwas low in the tassels, but high in theear, husk,and kernel (Figure 5B). During kernel development, the expressionof Scc4 peaked at 6 and 9 DAP and slowly decreased thereaf-ter (Figure 5C). A polyclonal antibody was raised against theC-terminal portion (500–727 amino acids) of SCC4 (SupplementalFigure 5). At the protein level, the SCC4 content was higher in theearly to middle stages of kernel development (6 DAP to 18 DAP),and decreased gradually as development progressed (Figure 5D).

TheScc4mRNA expressionwas significantly reduced in dek15in comparison with the wild type during endosperm development(15, 18, and 21 DAP; Figure 5E). The total proteins from the dek15andwild-type immature endospermswere analyzed using proteingelblottingwithaSCC4antibody, revealing thatSCC4wasabsentin the dek15 kernels (Figure 5F).To examine the subcellular localization of SCC4, the full-length

Scc4 ORF was fused to the N terminus of yellow fluorescentprotein (YFP) and driven by the Cauliflower mosaic virus 35Spromoter. The fusionconstructwas transiently expressed inonion

Figure 4. CRISPR-Cas9-Based Mutation of Dek15 and Allelism Test with dek15.

(A) The sequence in the Zm00001d052197 locus targeted using CRISPR/Cas9. The gRNA target sequence and the protospacer-adjacent motif (PAM) areshown in green and blue, respectively. Alignments of mutant sequences from three independent transgenic plants are indicated. Red letters and dashesrepresent insertions and deletions, respectively.(B) Mature F2 ear of dek15-cas9-1 3 W22. Arrows indicate the mutant kernels. Bar = 1 cm.(C) Mature wild-type (WT) and dek15-cas9-1 kernels from (B). Bar = 1 mm.(D) Longitudinal paraffin sections of developing wild-type and dek15-cas9-1 kernels at 18 DAP. En, endosperm; Em, embryo. Bars = 1 mm.(E) to (G) An allelism test was performed using a cross between heterozygous dek15 (dek15/+) and heterozygous dek15-cas9-1 (dek15-cas9-1/+). (E)Randomly selected kernels from the allelism test ear. Bar = 1 cm. (F) Sequences of the kernels in (E) at the dek15 locus in the Zm00001d052197 genomicfragment. (G) Sequences of the kernels in (E) at the editing site in dek15-cas9-1. Red arrows indicate the mutation sites or editing site.

470 The Plant Cell

Figure 5. Phylogenetic Analysis, Expression Pattern, and Subcellular Localization of SCC4.

(A)Neighbor-joiningsequencesimilarity analysisofZmSCC4and itshomologs inotherorganisms.SCC4homologswerealignedusingMuscle in theMEGA7.0 software. The phylogeny reconstructionwas conducted inMEGA7.0. Thenumbers next to thebranches represent thepercentageof support from1000bootstraps. Scale bar = average number of amino acid substitutions per site.(B) and (C)RT-quantitative PCRanalysis ofScc4 in various tissues (B) and the developing kernels (C) ofmaize. Root, stem, leaf, silk, tassel, and ear tissueswere collected from field-cultivated W22 plants at the V12 stage. The kernel sample in (B) was harvested at 15 DAP. The developing kernels in (C) werecollected at different stages and labeled as DAP.

Mitotic Chromosome Segregation Requires Dek15/Scc4 471

(Allium cepa) mesophyll cells, and the YFP fluorescence signalswere detected in both the cytoplasm and the nucleus(Supplemental Figure 6). The cytoplasmic and nuclear fractionswere isolated from the developing endosperm cells (15 DAP) ofdek15 and wild-type kernels and analyzed using an immunoblot.The SCC4 protein was detected in both the cytoplasmic andnuclear fractions of the wild-type endosperm, but not in thefractions derived from dek15 (Figure 5G). These results indicatedthat SCC4 was present in both the cytoplasmic and nuclearfractions of the wild-type endosperm.

Loss of Dek15/Scc4 Function Dramatically ReducesCell Proliferation

To explore the cause of the dek15 phenotype, the cell morphol-ogies in the developing wild-type and dek15 kernels were ex-amined at 15 DAP. The wild-type embryo cells were uniformlypatterned, except for the shoot apical meristem and root apicalmeristem where the cells divided more vigorously (Figure 6A). Bycontrast, the dek15 embryo typically comprised smaller cells withhighly variable sizes, accompanied by a few larger vacuolatedcells (Figure 6B). Consistent with the huge difference in embryosize between thewild typeanddek15 (Figure 1I), the cell number indek15 was drastically reduced in comparison with the wild type.

The wild-type BETL cells were darkly stained with thick andextensive cell wall ingrowths (Figure 6C). In contrast, the dek15BETL cells were less stained with much reduced cell wall in-growths (Figure 6D). The wild-type SE cells were smaller anddenser at the endosperm periphery, and gradually increased insize toward the interior of the endosperm (Figure 6E), whereas thedek15 SE cells were larger and irregularly shaped (Figure 6F). Thewild-type AL cells comprised a single sheet layer of uniform cu-boidal cells; however, the dek15 AL cells were variable in cell sizeand shape (Figures 6E and 6F). To quantify the cell numbers in theendosperm, the numbers of SE cells in a defined area (1mm2) wascounted at different regions of the wild-type and dek15 endo-sperm. In comparison with the wild type, fewer SE cells wereobserved in thedek15 endosperm (Supplemental Figure 7). Theseresults, coupled with the smaller endosperm size in dek15(Figure 1I), suggested that the dek15 endosperm contained fewerbut larger cells.

The ultrastructural changes in the 18-DAP endosperm cells atthe subaleurone region were further observed using transmissionelectron microscopy. The nuclei in the dek15 endosperm cellsweremuch larger than thoseof thewild typeat thesamenumberofcells fromtheAL (Figures6G,6H,and6K). Toward thecenter of theendosperm, the diameter of the SE nuclei increased gradually,consistent with the observed endoreduplication (Supplemental

Figure 8B; Schweizer et al., 1995; Leiva-Neto et al., 2004; Sabelliet al., 2013). 4',6-Diamidino-2-phenylindole (DAPI)-stained par-affin sections also showed a statistically significant increase inthe nucleus size of the dek15 endosperm in comparison with thewild-type endosperm at the same cell layer (Figures 6I to 6K;Supplemental Figure 8B). In addition, these larger nuclei wereusually also highly misshapen, often containing intranuclear in-clusion bodies (Supplemental Figure 8A). These results indicatethat dek15 contains severe nuclear structural changes, sug-gesting that SCC4 may affect the function of the nucleus.

The Cell Cycle Is Disrupted in dek15 Endosperm

Todetectwhether the cell cyclewasaffectedby the lossofDek15/Scc4 function, the DNA contents of the wild-type and dek15endospermcells at 12DAP and15DAPwere examined using flowcytometry. In thewild-type endosperm, the peakswere sharp; the3C peak was the tallest, followed by the peaks with progressivelyhigher C numbers (6C, 12C, and so on; Figure 7A). In the dek15endosperm cells, all peaks were substantially smaller and lesspronounced than in the wild type. The positions of the peaks indek15were also shifted to lower C values in comparisonwith theircounterpart peaks in the wild type.Themean ploidy of the dek15 endosperm nuclei was increased

byup to71.7%at 12DAP, andby65.7%at15DAP, in comparisonwith the wild type (Figure 7B). At 12 DAP, the abundance of 3Cnuclei in dek15 were reduced by 81.65% compared with the wildtype, whereas no difference was observed in the numbers of 6Cnuclei (Figure 7C). At 15DAP, the 3Cnuclei in dek15were 72.17%less abundant than in thewild type, whereas the abundance of the6C nuclei was also decreased by 42.65% (Figure 7D). Similarrelative decreases were also observed in peaks correspondingto 12C or greater in the dek15 nuclei in comparison with the wildtype (Figures 7C and 7D). Significantly more intermediate DNAcontents were observed in the dek15 nuclei than in the wildtype (Figures 7C and 7D). These results indicated that theendoreduplication cell cycle was disrupted in dek15.

Loss of Dek15/Scc4 Function Causes Mitotic Disorder

To investigate the role of SCC4 in the nucleus, chromosomesspreads in thewild-type and dek15 endosperm cells were stainedwith DAPI and observed (Figures 8A to 8F). In the wild-type en-dosperm cells, deeply stained chromosomes condensed at pro-phase (Figure 8B), then aligned on the equatorial plate in the centerof the cell during metaphase (Figure 8C). At anaphase, the sister

Figure 5. (continued).

(D) SCC4 protein content patterns in wild-type (WT) kernels at different developmental stages. a-Tubulin was used as a loading control.(E)Comparing the expression levels ofScc4 inwild-type anddek15 endospermat 15, 18, and21DAP. Values aremeans6SE;n=4 (***, P< 0.001, Student’st test).(F) Immunoblot comparing the accumulation of the SCC4 protein in wild-type and dek15 endosperm at 15, 18, and 21 DAP. a-Actin was used as a sampleloading control.(G) Immunoblot analysis of the SCC4protein accumulation in nuclear and cytoplasmic fractions of 15-DAPwild-type and dek15 kernels. Bip is a cytoplasmmarker, histones are a nuclear marker and nuclear sample loading control, and Actin is a cytoplasm sample loading control.

472 The Plant Cell

WT

Figure 6. Comparison of Cell Size, Cell Number, and Nucleus Size in Developing Wild-Type (WT) and dek15 Kernels.

(A) and (B)Longitudinal paraffinsectionsofwild-type (A)anddek15 (B)embryos from the samesegregating ear at 15DAP. The insets are amagnified imageof the boxed regions. Bars = 100 mm.(C)and (D)BETLcellson longitudinal paraffinsectionsofwild-type (C)anddek15 (D)endospermat15DAP.Thefiguresbelowprovideahighermagnificationof the boxed areas. Bar = 100 mm.

Mitotic Chromosome Segregation Requires Dek15/Scc4 473

chromatids were precisely separated to form two chromosomesets, which were then pulled to either side of the cell (Figure 8D).

In comparison with the wild type, the dek15 endosperm cellscontained significantly more micronuclei (small dots surroundingthe main nucleus; Figures 8A, 8E, and 8I). Nearly half of the dek15endosperm cells (49.4%, n = 85) contained partially separated orcompletely separated sister chromatids at prophase (Figure 8F),whereas a large portion of dek15 endosperm cells (57.1%, n = 49)contained chromosomes thatwere not arranged on the equatorialplate at metaphase (Figure 8G). Some of the dek15 sister chro-matids lagged behind when being pulled to the poles of the cellsduring anaphase (Figure 8H). Chromosome bridges and laggingchromosomes were easily observed in majority of dek15 endo-sperm cells (66.1%, n = 47). The mitotic index of the dek15 en-dosperm cells was significantly higher than that of the wild type(Figure 8J), because many cells were arrested in prophase andmetaphase (Figure 8K).

Similar alterations in mitosis were also observed in the dek15embryo cells, as well as in the endosperm and embryo cells ofdek15-cas9-1 (Supplemental Figure 9). These results indicatedthat the loss of Dek15/Scc4 function caused mitotic defects, in-cluding precocious sister chromatid separation and variouschromosome segregation errors.

dek15 Cells Had a High Frequency of Sister ChromatidCohesion Defects

To monitor sister chromatid cohesion, fluorescence in situ hy-bridization (FISH) experiments were performed using the dek15endospermcells at 15DAP. These experiments used45S rDNAasa probe, which is located on the short arm of chromosome 6.Because maize endosperm cell are triploid, three signals weredetected per cell in 93.1% (n = 164) of the wild-type endospermcells (Figure 8L). In the 283 observed dek15 endosperm cells, only12.4% (35) nuclei had three signal spots. About 8.5% (24) nucleicontained fewer than three signal points, whereas the vast ma-jority of dek15 endosperm cell nuclei (224; 79.1%) contained fouror more signal spots.

The 45S probe was also used to monitor the number of chro-mosome 6s in the embryo cells at 15 DAP (Figure 8M). In the wildtype, 94.5% (n = 220) of the embryo cells were observed to havetwo signal spots, indicating that these cells contained a pair ofchromosome 6s. In contrast, out of the 316 observed dek15embryocells,only37.6%(119) contained twosignal spots.Asmallbut significant proportion of cells (53; 16.8%) contained no or onlyone signal spot per cell, and nearly half of cells (144; 45.6%) hadmore than three signal spots per cell. Similar signal changes werealso observed for chromosome 4 using centromere 4 (Cent4) as

a chromosome 4-specific FISH probe (Supplemental Figure 10).These FISH results showed that appropriate sister chromatidcohesion was present in almost all wild-type cells, whereas thedek15 cells contained high frequencies of sister chromatids withcohesion defects.The intertwined chromosomes of the dek15 endosperm cells

were hard to count, so the chromosomenumberswere counted inthe wild-type and dek15 embryos at 15 DAP. The chromosomenumber in thewild-typecellswas20 (n=35); however, theaveragechromosome number in the dek15 cells was 22.03 (n = 149;ranging from 12 to 43). Of the 149 observed dek15 embryo cells,only 22.1% (33) cells had a normal chromosome number of 20,whereas 35.6% (53) cells contained fewer than 20 chromosomesand 42.3% (63) had toomany chromosomes (Figure 8N). The lossof Dek15/Scc4 function therefore causes sister chromatid co-hesion defects, and eventually leads to chromosome gain or lossin the maize kernel cells.

Dek15/Scc4 Influences the Expression of Genes Involved inthe Cell Cycle and Nutrient Metabolism

To investigate the impact of the dek15 mutation on global geneexpression during maize endosperm development, an RNA-sequencing (RNA-seq) analysis was performed using the dek15and wild-type endosperm at 15 DAP. Significantly differentiallyexpressed genes (DEGs) were identified with a threshold foldchange greater than two times and P < 0.01. Under these criteria,a total of 1457 DEGs were identified, including 1080 and 377 thatwere upregulated and downregulated in dek15, respectively(Supplemental Data Set 2). Within these DEGs, 1173 genes couldbe functionally annotated using a Gene Ontology (GO) analysis(AgriGO, http://bioinfo.cau.edu.cn/agriGO/analysis.php). Thesignificantly enriched terms were related to nutrient reservoiractivity, transporter activity, hydrolase activity, DNA binding,single-organism biosynthetic processes, mitotic cell cycle pro-cesses, microtubule binding, and responses to stimuli (Figure 9A;Supplemental Data Set 3).Among the DEGs involved in mitotic cell cycle processes

(GO:1903047), the expression levels ofSister chromatid cohesionprotein dcc1,Condensin complex subunit 2, Budding uninhibitedby benzimidazole-related 1, and Mitotic arrest-deficient 2 wereincreased bymore than 111%. In addition, some genes encodingcyclins and cyclin-dependent kinases were also upregulated.Regarding microtubule binding (GO:0008017), 15 of the 19 DEGsencoding kinesins and microtubule-associated proteins wereupregulated. We identified 19 upregulated genes encoding his-tones that are involved in the formation of DNA packagingcomplexes (DNA binding; GO:0003677). The expression changes

Figure 6. (continued).

(E) and (F) Longitudinal paraffin sections of wild-type and dek15 endosperm from the same segregating ear at 15 DAP. The insets are amagnified image ofthe boxed regions. AL, aleurone layer; PE, pericarp; SE, starchy endosperm; SG, starch granule. Bars = 100 mm.(G) and (H)Transmission electronmicroscopic (TEM) analysis of thewild-type anddek15SEcells adjacent to theALat 18DAP. The inset showsamagnifiedimage of the boxed region. Nu, nucleus; NL, nucleolus; NP, nucleoplasm; SG, starch granule; PB, protein body. Bars = 10 mm.(I) and (J) DAPI-stained wild-type and dek15 SE cells adjacent to the AL at 15 DAP. Nu, nucleus; AL, aleurone layer. Bars = 10 mm.(K)Comparison of the nucleus diameters of wild-type and dek15 endosperm cells in the second and third cell layers from the AL in the TEM (G andH) andDAPI-stained longitudinal sections (I and J). Values are means 6SE; n = 12 nuclei in (G and H), n = 100 nuclei in (I and J).

474 The Plant Cell

of these genes suggested that the loss of Scc4 function affectedthe cell cycle and DNA structure.

GO terms associated with nutrient reservoir activity (GO:0045735),transporter activity (GO:0005215), and single-organism biosyntheticprocesses (GO:0044711) were also found to be enriched in theDEGs between the wild type and dek15. Multiple key genes in-volved in protein and starch biosynthesis were significantlydownregulated in dek15 (Supplemental Data Set 3). The genesencoding Opaque1, Opaque10, and 19- and 22-kD zein proteinsweredownregulatedbymore than50%indek15,whereassomeofthe key genes in the starch biosynthetic pathway were also sig-nificantly downregulated, including Shrunken2, Starch synthaseI (SSI), SSIIa, and other starch synthase genes.

In addition, most genes involved in the specific process ofhydrolase activity acting on glycosyl bonds (GO:0016798) wereupregulated, which may affect the accumulation of storagecompounds in dek15. The dek15 mutation also affected the ex-pression of genes that respond to stimuli (GO:0050896), sug-gesting that the mutant cells likely experienced an unfavorableintracellular environment during kernel development.

The expression levels of 24 genes involved in the DNA binding,cell cycle, and zein and starch biosynthesis in the wild-type anddek15 endosperm were analyzed using RT-quantitative PCR.These results validated those of the RNA-seq analysis of the wild-type and dek15 transcriptomes (Figure 9B).

SCC4 Interacts with SCC2, and the ChromosomeRemodeling Proteins CHR4 and Chromatin RemodelingComplex Subunits B 102, 105, and 106

SCC4 is known to form a complex with SCC2 through its in-teractionwith theSCC2N terminus (Ciosk et al., 2000;Chao et al.,2015). The maize SCC2 homolog (Zm00001d018657) was iden-tified using a BLASTp search with the SCC2 sequence fromArabidopsis. The cDNA coding for the N terminus of ZmSCC2(SCC2-N; 1–214 amino acids) was constructed into pGADK7,whereas the full-length ORF or truncated segments of Scc4(encodingSCC4-N, 1–219aminoacids; SCC4-M, 220–473aminoacids; or SCC4-N, 474–727 amino acids) were individually con-structed into pGBKT7. Yeast two-hybrid (Y2H) assays were usedto show that SCC2-N interactswithSCC4, and that the interactingsegment was contained within the N terminus of SCC4 (1–474amino acids; Figure 10A). The results of luciferase complemen-tation image (LCI) assays showed that the co-expression ofSCC4-NLUC (N-terminal domainsof LUCIFERASE) andSCC2-N-CLUC (C-terminal domains of LUCIFERASE) resulted in strongluciferase activity, indicating that SCC4 and SCC2-N can interactinNicotiana benthamiana cells (Figure 10B). The results indicatedthat SCC4 interacts with SCC2.In the SCC2/SCC4 complex, SCC4 may be responsible for

identifying chromatin loci for cohesin loading (Chao et al., 2015;

Figure 7. Flow Cytometric Profiles of Wild-Type (WT) and dek15 Endosperms at 12 DAP and 15 DAP.

(A)Histograms of the relative nuclear DNA contents (relative fluorescence intensities) obtained from the analysis of wild-type and dek15 endosperms at 12DAP (left) and 15 DAP (right) using a flow cytometer. The C-value is indicated for each peak.(B)Meanploidy levels in thewild-type anddek15endospermsat 12DAPand15DAP.Meanploidywascalculatedbyweighting thenumber of nuclei by theirploidy.(C) and (D) Distribution of DNA contents in the wild-type and dek15 endosperms at 12 DAP (C) and 15 DAP (D).Values are means 6SE; n = 4 (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant; Student’s t test).

Mitotic Chromosome Segregation Requires Dek15/Scc4 475

Figure 8. Mitotic Chromosome Behaviors and Chromosome Number Analysis in the Wild-Type (WT) and dek15 mutant.

(A) to (H) The chromosome behavior of endosperm cells in the wild type and dek15 at 15 DAP, stained with DAPI. Themicronuclei interphase (E), the sisterchromatid cohesion defects at prophase (F), themisaligned chromosomes at metaphase (G), and the lagging chromosomes at anaphase (H) in dek15 areindicated by arrows. Bars = 10 mm.(I) The proportion of micronuclei at interphase in the endosperm cells (>2000) of wild type and dek15 at 15 DAP.

476 The Plant Cell

Hinshaw et al., 2015; Uhlmann, 2016). To identify other potentialSCC4-interacting proteins involved in cohesin loading, the full-lengthScc4ORFwasconstructed into pGBKT7 asbait, then usedto screen a Y2H cDNA library constructed frommaize developingkernels (Zhang et al., 2012). After 250 SCC4-interacting cloneswere sequenced, a list of putative SCC4-interacting proteins wasobtained (Supplemental Data Set 4), which included four chro-matin remodelingproteins (CHR4, chromatin remodelingcomplexsubunit B [CHB]102, CHB105, and CHB106) as potential SCC4interaction partners. In yeast, the RSC (remodels the structure ofchromatin) complex has the potential function of recruiting theSCC2/SCC4 complex (Lopez-Serra et al., 2014). CHR4 is a ho-molog of Chromodomain helicase DNA binding protein 3, anATPase involved in NURD (nucleosome-remodeling and histonedeacetylase) complexes (Ho and Crabtree, 2010; Hu et al., 2012).CHB102, CHB105, andCHB106 are SWI3-type proteins inmaize,and are highly similar to SWI3B (CHB102) or SWI3C (CHB105 andCHB106) in Arabidopsis. SWI3B andSWI3C are the core subunitsof the SWI/SNF (SWITCH/SUCROSE NONFERMENTING) chro-matin remodeling complex (Sarnowski et al., 2005). To verify theirinteraction with SCC4, the full-length ORFs of Chb102, Chb105,and Chb106 were cloned into pGADT7 and were cotransformedinto yeast cells alongside pGBKT7-Scc4. For CHR4, the full-length ORF was too long to include (6570 bp); therefore, thefragment encoding the C terminus of CHR4 (CHR4-C; 406 aminoacids) was selected for these experiments. These proteins werefound to interact with SCC4 (Figure 10C). A LCI assay was per-formedbycotransformingN.benthamianacellswithSCC4-CLUCand either CHR4-C-NLUC, CHB102-NLUC, CHB105-NLUC, orCHB106-NLUC. The transformed cells had a strong luciferaseactivity (Figure 10D), which taken together with the Y2H resultsindicated that SCC4 interacts with CHR4, CHB102, CHB105, andCHB106.

DISCUSSION

Dek15 Encodes SCC4 and Is Required for CohesionFunction during Mitosis in Maize Kernels

In this study, the classic maize kernel mutant dek15 was clonedand found to contain a mutation in a gene encoding a cohesinloader, SCC4. In yeast andanimals, SCC4 formsa loader complexwith SCC2 to facilitate the loading of the cohesin complex ontochromatin during interphase (Ciosk et al., 2000;Seitan et al., 2006;

Watrin et al., 2006). Multiple pieces of evidence indicated thatDek15 encodes amaize homolog of SCC4; for example, ZmSCC4has a high similarity to AtSCC4 (Figure 5A; Supplemental Figure 4)and containsmultiple tandem repeats of TPR, which is a commonpattern of SCC4 protein (Watrin et al., 2006; Hinshaw et al., 2015).ZmSCC4 could also be detected in both the nucleus and cyto-plasm, similar to the distribution of SCC4-homologous proteinsand cohesin subunits in other organisms (Ciosk et al., 2000; Lamet al., 2005; Seitan et al., 2006; Minina et al., 2017). Previousstudies have shown that SCC4 interacts with the N terminus ofSCC2 (Ciosk et al., 2000; Chao et al., 2015; Minina et al., 2017),whichwasalsodemonstrated for theN terminusofZmSCC4 in thepresent study using Y2H and LCI assays (Figures 10A and 10B).PSCS is a typical feature of plants with a functional deficiency ofSCC4 (Ciosk et al., 2000; Seitan et al., 2006; Watrin et al., 2006),and was observed in both the embryo and endosperm cells of thedek15 and dek15-cas9 mutants (Figure 8F; Supplemental Fig-ure 9), suggesting that SCC4 is necessary for sister chromatidcohesion in maize.Although SCC4 is well studied in yeast and animals, it remains

unknown whether it has additional functions in plants. Our phy-logenetic analysis revealed that ZmSCC4 has a distant relation-ship and low sequence similarity with its homologs in yeast andanimals (Figure5A;Supplemental Figure4). In yeastscc4mutants,the only cell cycle error observed was PSCS, whereas in culturedhuman cells, misaligned chromosomes were observed aftertransfection with Scc4 short interfering RNAs (Ciosk et al., 2000;Watrin et al., 2006). In this study, much more severe mitotic al-terations were observed in the dek15 mutants, including mis-aligned chromosomes, lagging chromosomes, and the presenceofmicronuclei (Figure 8; Supplemental Figure 9), which are typicalfeatures of chromosome segregation errors (Solomon et al., 2011;Siegel and Amon, 2012; Haarhuis et al., 2013). Highly variablechromosome number (aneuploidy) in dek15 was demonstratedusing the chromosome counts and flow cytometry analyses(Figures 7 and 8). In humans, deficiency in the cohesin subunits(such as SA1 and SA2; SCC3-homologous protein) causes an-euploidy (Solomon et al., 2011; Remeseiro et al., 2012; Losada,2014). The aneuploidy resulting from the loss of Scc4 function inmaize may be associated with an aberrant cohesin function.The FISH results and observations of the chromosome be-

havior at prophase confirmed the presence of disassociatedsingle sister chromatids in the dek15mutant cells (Figures 8L and8M; Supplemental Figure 10). In yeast and humans, the loss ofScc4 function is known to result in reduced amounts of cohesin

Figure 8. (continued).

(J)Themitotic indexwasanalyzedby counting the proportion ofmitoticM-phase cells in the assessedcell population (>2000). Values aremeans6SE;n=3(*, P < 0.05, Student’s t test).(K) The proportion of cells at different M-phases in the total assessed cell population (>2000). Values are means6SE; n = 3 (*, P < 0.05; ns, not significant,Student’s t test).(L) and (M) FISHwith 45S rRNA gene (red) probes in the 15-DAP endosperm (L) and embryo (M) of thewild type and dek15. In (L), the histogram representsthenumberof45Ssignaldetected in thewild-type (n=220)anddek15 (n=316)endospermcells at interphase. In (M), thehistogramrepresents thenumberof45S signal detected in the wild-type (n = 164) and dek15 (n = 283) embryo cells at interphase. Blue indicates the chromosomes stained with DAPI.Bars = 10 mm.(N) The chromosomenumberwas identified in thewild-type and dek15 embryo cells at 15DAP; n= 35 endosperm cells in thewild type, n= 149 endospermcells in dek15.

Mitotic Chromosome Segregation Requires Dek15/Scc4 477

ontochromatin, butdoesnotaffectcohesinassembly (Ciosketal.,2000; Watrin et al., 2006). This suggests that cohesin is formednormally in scc4 mutants but cannot bind to chromatin, therebycausing cohesion defects. The deficient cohesion of dek15 waslikely the main cause of its mitotic defects.

Scc4 Affects Cell Division and Cell Function during MaizeKernel Development

Many genes involved in sister chromatid cohesion also playa role in developmental regulation (Nasmyth and Haering, 2009;Sebastian et al., 2009; Bolaños-Villegas et al., 2017). The dek15and dek15-cas9 mutant alleles had small but variably sizedkernels, with structurally deficient embryos and a reduced en-dosperm (Figures 1 and 4). The loss of Scc4 function wasdemonstrated to be responsible for these kernel-defective

phenotypes using a transgenic functional complementation andallelism tests (Figures 3 and 4). The seed defects were similar tophenotypes caused by the loss of the cohesin loader (SCC2 andSCC4) or cohesin subunits (SMC1 and SMC3) in Arabidopsis (LiuCm et al., 2002; Sebastian et al., 2009; Minina et al., 2017), whichimplied that Scc4 could affect plant development through itsfunction in cohesion regulation.Our results indicated that the loss of Scc4 function caused the

defects in cohesin loading and function, which eventually lead todefects in cell division and plant development. The developmentof the dek15 embryo was strongly inhibited, whereas the effecton its endosperm during kernel development was less severe(Figure 1; Supplemental Figure 2). Embryonic growth relies oncontinuous cell division, whichmeansmutations affectingmitosisresult in a much stronger inhibition of embryonic than endospermdevelopment. The endospermundergoesmultiple developmental

Figure 9. GO Classification of Differentially Expressed Genes (DEGs) Based on RNA-seq Data and a Quantitative RT-PCR Confirmation in the 15-DAPEndosperms of Wild-type (WT) and dek15.

(A)Themost significantly enrichedGOterms in theDEGs,basedonanRNA-seqanalysis of 15-DAPwild-typeanddek15endosperms.A total of 1173geneswere functionally annotated classified in theGOanalysis. Thenumberof genesand theP-value for eachGO termareshown. E indicates 10 raised to apowerin scientific notation.(B)RT-quantitativePCRconfirmationof24selectedDEGsassociatedwith theDNAbinding, cell cycle, andzeinandstarchbiosynthesis in15-DAPwild-typeand dek15 endosperms. Values are means 6SE; n = 3 (**, P < 0.01; ***, P < 0.001, Student’s t test).

478 The Plant Cell

Figure 10. Interaction Analysis of SCC4 with SCC2, CHR4, CHB102, CHB105, or CHB106, Revealed Using Yeast Two-hybrid and Luciferase Com-plementation Image Assays.

(A) Yeast two-hybrid analysis of the interaction between SCC4 and the N terminus of SCC2 (SCC2-N). The interaction between the T-antigen and HumanP53 was used as a positive control. The interaction between the empty pGBKT7 and pGADT7 vectors was used as a negative control.(B) Luciferase complementation image assay of the interaction between SCC4 and the SCC2-N. Fluorescence signal intensities represent their interactionactivities.(C) Yeast two-hybrid analysis of the interaction between SCC4 and CHR4-C, CHB102, CHB105, or CHB106.(D)Luciferasecomplementation imageassayof the interactionbetweenSCC4andCHR4-C,CHB102,CHB105,orCHB106 inNicotianabenthamianacells.Fluorescence signal intensities represent their interaction activities.(E) Model depicting the function of SCC4 in cohesin loading and chromosome segregation.

Mitotic Chromosome Segregation Requires Dek15/Scc4 479

stages inmaize (Sabelli and Larkins, 2009), and the relatively shortduration of mitotic cell division likely reduced the negative effectsof the mitotic defects during dek15 endosperm development. Inthe central endosperm cells, an endoreduplication stage is fol-lowed by mitosis in maize. At this stage, even though the dek15endosperm could contain a mixture of aneuploid cells (Figures 7and 8), these cells would still survive because they no longer needto divide.

The dek15 kernels exhibited a drastic reduction in their totalstarch and protein contents (Figure 2), which in turn reduced theirkernel weights. The decrease in nutrient storage is presumed toresult from the functional failure of the endosperm cells. Nutrientsare transported from the maternal vascular tissue through theBETL into the endosperm (Gómez et al., 2009); however, thereducedBETLcellwall ingrowth indek15was likely anobstacle fornutrition transportation into the developing kernels (Figures 6Cand 6D). In addition, the decreased cell number and abnormalmorphology of the dek15 SE cells may also affect grain filling(Figures 6E and 6F; Supplemental Figure 7).

The Chromatin Remodeling Complex Plays a Potential Rolein Recruiting the Cohesin Ring to Chromatin

In yeast and animals, SCC4 andDNAbinding proteins are thoughtto be responsible for determining the localization of cohesin onchromatin (Chao et al., 2015; Hinshaw et al., 2015, 2017). In theAfrican clawed frog (Xenopus laevis), CDC7-DRF1 protein kinasewas found to recruit SCC2/SCC4 to chromatin (Takahashi et al.,2008). In yeast, the phosphorylation of the Ctf19 kinetochoreprotein by Dbf4-dependent kinase provides a binding site forSCC4 to the centromeres (Hinshaw et al., 2017). Other studieshave also suggested that cohesin and the chromatin remodelingcomplex might interact directly (Hakimi et al., 2002; Baetz et al.,2004; Huang et al., 2004; Clapier and Cairns, 2009) and that thechromatin remodeling complex may recruit the SCC2/SCC4complex toaspecific locationon thechromatin (Lopez-Serraetal.,2014; Hinshaw et al., 2015).

In this study, four chromatin remodeling proteins, CHR4,CHB102, CHB105, and CHB106, were found to interact withSCC4 (Figures 10C and 10D; Supplemental Data Set 4). Thechromatin remodeling complexes play a vital role in regulatingchromatin structure and assembly, the dynamic nature of chro-matin, DNA methylation, and histone modification (Ho andCrabtree, 2010). In maize, CHB101 is involved in maintainingnucleosome density and chromosome structure (Yu et al., 2016).In Arabidopsis, the SWI3 proteins may alter the interaction be-tween the histones and DNA to affect plant development andtranscription (Sarnowski etal., 2005;Zhuetal., 2013). In rice (Oryzasativa), theCHR4homologOsCHR729 recognizes andmodulatesthemethylation of the H3K4 andH3K27 histones to regulate geneexpression (Hu et al., 2012). The loss of function of any Chr4-,Chb102-, Chb105-, or Chb106-homologous gene causes severedevelopment defects in plants, including developmental re-tardationanddwarfing (Sarnowski et al., 2005;Huetal., 2012). Theidentification of these SCC4-interacting chromatin remodelingproteins enabled us to propose a model by which SCC4 canfacilitate the recruitment of cohesin to chromatin (Figure 10E),which is consistent with the hypothesis that cohesin loading is

dependent on the chromatin remodeling complex in yeast (Lopez-Serra et al., 2014; Hinshaw et al., 2015).The manipulation of cohesin has potential applications in plant

breeding, such as the production of clonal seeds using apomixis(Bolaños-Villegas et al., 2017). In two recent reports, genes as-sociated with meiosis were knocked out using CRISPR/Cas9to produce of clonal seeds in rice (Khanday et al., 2019; Wanget al., 2019). One of these genes encoded the cohesin subunitRECOMBINATION8 (REC8, homologous to SCC1 in mitosis).Considering its function in regulating cohesion in plants, SCC4could be a potential target for engineering apomixis in plants.

METHODS

Plant Materials

Themaize (Zeamays) EMS-generated dek15mutant (dek15-N1427A) wasobtained from the Maize Genetics Cooperation Stock Center (http://maizecoop.cropsci.uiuc.edu/). The dek15 stock was crossed into theW22inbred line, and kernelswere collected froma self-pollinateddek15/+ ear ina predominantly W22 genetic background.

Root, stem, leaf, silk, tassel, and ear tissueswere collected from at leastthree field-cultivatedW22 plants at the V12 stage, whichwere grown in theExperimental Station in Shangzhuang, China Agricultural University,Beijing. Immature kernels were harvested at 6, 9, 12, 15, 18, 21, 24, 27, and30 DAP. Nicotiana benthamiana plants were grown in growth chambersunder a 16-h:8-h light (white fluorescent lamp, 20,000 LUX):dark photo-period at 25°C.

Histological Analysis

The histological analysis was performed as previously described (Leiva-Neto et al., 2004;Wanget al., 2011; Fenget al., 2018). Five developingwild-type and dek15 kernels were each harvested from the same segregatingwell-filled ear. Three independent earswere used for subsequent analyses.

For the paraffin sections, fresh dek15 and wild-type kernels were fixedinformalin-acetic acid-alcohol fixative (50% [v/v] ethanol, 5% [v/v] aceticacid, and 3.7% [v/v] formaldehyde), after which they were evacuated threetimes for5minwithavacuumpump.Thefixedmaterialsweredehydrated ina gradient of ethanol (50%, 60%, 70%, 85%, 95%, and 100% ethanol inwater [v/v] ) and a gradient of xylene solution (25%, 50%, 75%, and 100%xylene in ethanol [v/v] ). The samples were then soaked three times inparaffin at 58°C for 12 h, after which they were embedded in a paraffinblock. Thin sections (10 mm) were obtained using a microtome (RM2265;Leica), which were then dewaxed in xylene and stained with fuchsin ortoluidine blue. To detect the nuclei, the sections were stained with DAPI(H-1200; Vector Laboratories). Fluorescent images were observed usinga Nikon Ci-S fluorescence microscope with a DS-Qi2 CCD camera at-tached to a Epi-fluorescence attachment (Nikon).

For the resin sections, the endosperm tissues were fixed overnight informalin-acetic acid-alcohol fixative at 4°C. The sampleswere sequentiallysoaked in a concentration gradient of ethanol, acetone, and resin, thenembedded in Spurr’s epoxy resin at 70°C for 8 h. Thin sections (4mm)weremounted on glass slides and stained with fuchsin. The dyed sections wererinsed sequentially with deionized water, 50% ethanol, and absoluteethanol, then air-dried. The slices were sealed with cover slips over gumand imaged in a bright field using a Leica microscope (DM2000LED).

For the transmission electron microscopy, endosperm tissues werefixed in 4% paraformaldehyde then transferred to osmium tetraoxide. Thefixed samples were dehydrated in an ethanol gradient then transferred topropylene oxide solution, after which they were slowly polymerized inacrylic resin (London Resin Company) for at least 48 h. Thin sections

480 The Plant Cell

(70 nm) were obtained using a diamond knife microtome (Ultracut E;Reichert Technologies). The sections were placed on 100-mesh coppergrids, stained with uranyl acetate for 30 min, then stained with lead citratefor 15min. ThesectionswereobservedusingaHitachiH7600 transmissionelectron microscope (Japan).

Analysis of Total Protein and Starch

The total protein and starch contents of the kernels were analyzed aspreviously described (Wang et al., 2011; Feng et al., 2018; Li et al., 2018a).The mature wild-type or dek15 kernels were collected from the samesegregating well-filled ears. The seed coats and embryos were removedfrom the kernels after being soaked inwater (30min). A total of 20wild-typeor dek15 endosperms from the same ear were pooled as a single replicate,and ground into a fine powder in liquid nitrogen. Three biological replicateswere used for the subsequent analysis.

A 50-mg sample was incubated overnight in 1mL lysis buffer (12.5 mMsodiumborate, 1%SDS,2%b-mercaptoethanol, 1%cocktail [Merck], and1% phenylmethylsulfonyl fluoride) in a 37°C shaker. The mixture wascentrifuged for 10 min at 12,000 rpm, after which the supernatant wascarefully transferred into a new 1.5-mL centrifuge tube. The total proteinwas measured according to abicinchoninic acid standard kit (ThermoFisher Scientific).

For total starch measurements, starch quantification was performedfollowed the method described by instructions of amyloglucosidase/a-amylase starch assay kit (Megazyme).

Genetic Mapping of dek15 Locus

Initial mapping of dek15was usingmaize SNP3072 genotyping array (Tianet al., 2015) with the pooled DNA samples extracted from endospermtissue of 40 mutant kernels and 40 wild-type kernels from a segregated F2ear. The dek15 was mapped to a 28.236 Mb interval from 160,472,432to 188,708,387 on chromosome 4 (maize B73 RefGen_v4). The markerswere developed in the loci interval, and 252 kernels were used to narrowthe candidate interval between 181.433 (13 recombinants) M and 183.711M (5 recombinants). Additional markers AC190640.21, AC185627.2,AC185638.10, and AC185456.15 were developed within this interval(Supplemental Data Set 5), and a total of 979 mutant kernels from theF2 population were used to narrow down the dek15 to a 43-kb intervalfrom 182.738 M (7 recombinants) to 183.169 M (3 recombinants) onchromosome 4.

Vector Construction

For the targeting sequences from the cDNA ofDek15 (1000 bp – 1019 bp),20 bp (GGCACCACCGCTGATGCATG) was chosen. Oligonucleotidesincluding targeting sequences and gRNA was synthesized as primer, andcloned intopCAMBIA3301 vector using asimplex editing strategy (Qi et al.,2016a). The construct was transformed into Agrobacterium tumefaciens(EHA105).

The full-lengthORFofDek15with the restriction enzymesites forBamHIand XbaI was cloned from mRNA extracted from 15 DAP B73 endospermusing primers 59-CGGGATCCATGTCCATCGCCGCCGTG-39 and 59-GCTCTAGACTACCGCCGCCTCCTGGTAC-39. The fragment was cloned intoa pHB expression vector, in which Cauliflower mosaic virus 35S promoterwas replaced by SCC4-promoter (2030 bp upstream DNA sequence frominitiation codon ofSCC4) using primers 59-CGGAATTCCGGCCTTCGACAGTTTTTGC-39 and 59-CGGGATCCGGCGGCGAGGAGGG-39. The con-struct harbors a Basta selection marker. The construct was transformedinto A. tumefaciens (EHA105).

Maize Transformation

Transgenic plants were generated by A. tumefaciens–mediated maizetransformation (Frameetal., 2002).AcrossbetweenpBandpA lines (pBpA)was used as the recipient for maize transformation experiments. This Barprimer was used for molecular characterization of T0 transgenic plants.For CRISPR/Cas9 editing plants, sequencing was used to identify editingsites near the target position. Three transgene lines were obtained aftercrossed to W22. Two independent transgenic lines were selected forfunctional complementation tests. Six independent transgenic lines withZm00001d052197 knockout were obtained via CRISPR/Cas9, and twotransgenic lines were selected for allelism tests.

Subcellular Localization of SCC4

The full-length ORF (2181 bp) of Scc4 was cloned into pENTR/D-TOPO(primers listed in Supplemental Data Set 5) using aGateway TOPO cloningkit (Thermo Fisher Scientific). The DNA fragments were fused into thepB7CWG2plant expression vector through the LR reactionof theGatewaysystem (Thermo Fisher Scientific), after which the fusion constructs weretransformed into onion (Allium cepa) epidermal cells, as previously de-scribed (Qiao et al., 2016). The YFP signal was captured using a confocalmicroscope (A1; Nikon). To examine the subcellular localization of SCC4 inmaize kernels, the proteins of the cytoplasm and nucleus were carefullyextracted, as previously described (Qi et al., 2016b).

Polyclonal Antibodies

To get the antibody against DEK15/SCC4, a specific cDNA fragmentsof Scc4 (1500 to 2181 sequence site, representing 500 to 727 aminoacids) was cloned into pGEX-4T-1 (Amersham Biosciences). GlutathioneS-transferase-taggedSCC4 fusion proteinwas purified using aGSTrap FFcolumn in the ÄKTA purification system (GE Healthcare). Protein ex-pression, purification, and subsequent production of antibodies withrabbits were performed by Shanghai ImmunoGen Biological Technologyaccording to standard protocol.

Immunoblot Analysis

The total proteins were separated using SDS-PAGE and then transferredonto a polyvinylidene difluoridemembrane (0.45mm;Millipore Sigma, MA,USA) using the Mini-transblot system (Bio-Rad Laboratories). The mem-braneswere blocked using 5%skimmilk inTris-buffered salinewith Tween20 (TBST) (20mMTris-HCl, pH7.5; 150mMNaCl; and0.05%Tween20) for1 h at 25°C, then incubatedwith the primary antibodies (anti-SCC4 [1:500],anti-actin [1:5,000; Bioeasytech], anti-tubulin [1:5,000; Bioeasytech], anti-bip [1:1,000; Santa Cruz Biotechnology], anti-histone [1:1,000; Cell Sig-naling]) in 5% milk in TBST for 1 h. These membranes were washed fivetimes for5minusingTBST,afterwhich thesecondaryantibodywasappliedat a 1:5,000 dilution in 5%milk in TBST for 1 h. The SCC4-, bip-, and actin-specific antibodieswere detected using goat anti-rabbit IgG conjugated tohorseradish peroxidase (Bioeasytech). The tubulin- and histone-specificantibodies were detected using goat anti-rat IgG conjugated to horse-radish peroxidase (Bioeasytech). After the sampleswerewashed five timeswith TBST, the secondary antibodies were visualized using the SuperSignalWestPicochemiluminescent substrate kit (ThermoFisherScientific)and the Tanon-5200 imaging system (Biotanon, China).

Flow Cytometry

The flow cytometry procedure was performed as previously described(Dolezel et al., 2007). Five developing wild-type or dek15 mutant kernelswere each collected from the same ears at 12 and 15DAP. The endospermwas obtained by removing the seed coat and embryos from each kernel. A

Mitotic Chromosome Segregation Requires Dek15/Scc4 481

single wild-type or dek15 endospermwas analyzed for each repeat. Threeindividual ears were used for the flow cytometry analysis.

The endosperm was rapidly chopped using a new razor blade in 1 mLice-cold Galbraith’s buffer (45 mM MgCl2, 20 mM MOPS, 30 mM sodiumcitrate, 0.1% [v/v] Triton X-100, adjusted to pH 7.0 using 1 M NaOH, andfiltered through a0.22-mm filter) on aglassPetri dish. Thehomogenatewasfiltered through a 42-mmnylonmesh into a 1.5-mL sample tube. Propidiumiodide and RNasewere added until their final concentration reached 50mgmL21 and 50 mg mL21, respectively, after which the tubes were shakengently. The homogenate was measured immediately using a flow cy-tometer (BDFACSCalibur), with an argon-ion laser tuned to 488 nm. A totalof 15,000particleswere collected and analyzed usingSummit V5.0.1.3804software (Dako Colorado, Inc.).

Chromosome Preparation

The chromosome preparation procedure was performed as previouslydescribed (Katoet al., 2004).Developingwild-typeordek15mutant kernelswere collected from the same segregating ears at 15 DAP, and the embryoand endosperm tissues were obtained by removing the seed coat. Threeindividual ears were used for subsequent analyses. The embryos or en-dospermswere fixedovernight inCarnoy's Fluid (ethanol: acetic acid=3:1,[v/v]), and stored in 70%ethanol at220°C. After beingwashed three timeswith ddH2O, the tissue sample was transferred to a 20-mL solution of 1%pectolyase and 2% cellulose and hydrolyzed at 37°C for 2 h. After beingwashed three timeswith 70%ethanol, the samplewashomogenized usinga blunt dissecting needle. After the ethanol had evaporated, 100% aceticacid was added to form amixed-cell suspension. Themixture placed ontoglass slides for cell rupture in a humidity chamber, then stained with 10 mLDAPI (Vector Laboratories). The stained homogenate was covered witha cover slip and observed on a fluorescence microscope (Nikon).

Probes and FISH Assay

Plasmids containing the maize tandem repeat 45S rDNA and Cent4-specific sequences were reported previously (Zhao et al., 2013). The45S and Cent4 probes were nick-translated and labeled with digoxigenin-11-dUTP (Roche). The in situ hybridization protocol was slightly modifiedfrom a previously described method (Rayburn and Gill, 1985; Kato et al.,2004).Theembryosorendospermswereobtained fromthree15-DAPwild-type or dek15 kernels in a segregating ear and independently pooled asindividual replicates. Two individual earswere used for the FISHanalysis. A5-mL mixture containing 0.4 mg labeled probe and 40 mg salmon spermDNA was incubated at 65°C for 5 min. Subsequently, the probe was de-natured at 80°C for 10 min, after which it was transferred into a 20-mLmixture of 50% deionized formamide, 10% dextran sulfate, and 23SSC(0.6 M sodium chloride, 0.06 M sodium citrate). Slides were prepared bydripping 100-mL of 70% deionized formamide and 23SSC onto theirsurfaces and incubating them at 85°C for 2 min. The slides were rapidlydehydrated in an alcohol series (70%, 95%, and 100%) at 220°C, afterwhich a 20-mL aliquot of the probe mixture was applied to the slides. Theslides were then incubated for 16–24 h at 37°C in a humidity chamber.Theseprobesweredetectedusinganantidigoxigenin antibodyconjugatedwith Rhodamin (Vector Laboratories). The samples were stained using10 mL DAPI (Vector Laboratories), then imaged using a fluorescence mi-croscope (Nikon).

Yeast Two-Hybrid Assay

The Y2H library was constructed previously (Zhang et al., 2012). TheORFsof Scc4 and its potentially interacting proteins were cloned into thepGADT7 vector at the EcoRI and BamHI restriction sites usinga ClonExpress II One Step Cloning Kit (Vazyme Biotech). These ORFs

were amplified from B73 cDNA using the primers listed in SupplementalData Set 5. These constructs were co-transfected into AH109 andpGBKT7-Scc4. The interaction of these constructs with pGBKT7-empty, aswell as the interaction between pGBKT7-Scc4 and pGADT7-empty, wasusedasnegative controls. The interactionbetween theT-antigenandhumanP53 was used as a positive control. Subsequently, the resulting transformantswere spotted onto SD/-Leu/-Trp medium and SD/-Ade/-His/-Leu/-Trpmedium.

Luciferase Complementation Image Assay

TheN-terminal sequenceofSCC2 (642 bp) and the full-lengthORFofScc4and four genes encoding putative SCC4-interacting proteins werecloned into JW772 (CLUC) and JW771 (NLUC; Zhang et al., 2015) usingClonExpress II One Step Cloning Kit (Vazyme Biotech). These constructswere transfected into A. tumefaciens (strain GV3101), after which the Agro-bacterium cells were cultured to OD600 = 0.8, pelleted, and suspended ina buffer (10 mM methylester sulfonate, 10 mM MgCl2, and 150 mM ace-tosyringone, pH 5.7). The suspended cells were infiltrated into 5-week-oldN. benthamiana leaves in different combinations using a needleless sy-ringe. After incubation for 48 h in a growth chamber (16-h:8-h light:dark), theleaves were injected with 1 mM luciferin (Promega Corporation). The lu-ciferase signals were imaged using a Tanon-5200 imaging system. Theseexperiments were independently repeated at least three times.

RNA-seq and qPCR

RNA samples were collected from pooled wild-type or dek15 mutantkernels obtained from the same F2 ear at 15 DAP (15 kernels per sample).Three biological replicates were collected from three independent ears.The total RNA was extracted from each sample using an RNAprep PurePlant Kit (Tiangen Biotech, China). The integrity and concentration of RNAsamples were tested using a 2100 RNA Nano 6000 Assay Kit (AgilentTechnologies). The libraries were constructed and sequenced using anIllumina HiSeq 2500 with Annoroad Gene Technology, which eventuallyproduced;48million reads per sample. The clean readswere obtained byexcluding reads containing apoly-Nsequence, aswell as adapter-pollutedand low-quality reads using fqtools_plus (Annoroad). The clean readsweremapped to maize B73 RefGen_v4.37 using TopHat (version: 2.0.13;Langmead et al., 2009). The gene expression levels were estimated usingCufflinks (version: 2.2.1) and cuffdiff2 (version: 2.2.1; Trapnell et al., 2013),and the datawere normalized as fragments per kilobase of exon permillionfragments mapped (FPKM) after excluding rRNA and tRNA. Genes withexpression fold changes > 2 (P < 0.01) were considered significant DEGs.

For the qPCR analysis, cDNA was synthesized from 1 mg total RNAusing an oligo-dT andMoloney Murine Leukemia Virus reverse transcrip-tase (Promega), following themanufacturer's instructions.Gene fragmentswere amplified using SYBR Select Master Mix (Tiangen Biotech) on an ABI7500 Real-Time PCR system (Thermo Fisher Scientific). The gene ex-pression levelswereassessedusing theDCt (thresholdcycle)method,withUbiquitin expression as the internal control. The primers used are listed inSupplemental Data Set 5.

Statistical Analysis

All Student’s t tests are shown in the Supplemental Table.

Accession Numbers

Sequence data from this article can be found in the GenBank/EMBLdatabases under the following accession numbers: ZmSCC4/DEK15,NP_001352441.1. Sequences used for phylogenetic analysis are as fol-lows: Sorghum bicolor, XP_002446219.2; Oryza sativa Japonica Group,

482 The Plant Cell

CAD40351.2; Brachypodium distachyon, XP_003581104.1; Arabidopsis(Arabidopsis thaliana), NP_199947.1; Vitis vinifera, XP_010650792.1;Glycine max, XP_003519302.1; Medicago truncatula, XP_003616084.1;Physcomitrella patens, XP_024387203.1; Drosophila melanogaster,NP_650428.1; Xenopus laevis, NP_001124425.1; Homo sapiens,NP_056144.3; Mus musculus, NP_083269.4; Saccharomyces cerevisiaeS288C, NP_011074.3; and Eremothecium gossypii, NP_986799.1. RNA-Seq data are available from the National Center for Biotechnology In-formation Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo)under the series entry GSE120674.

Supplemental Data

Supplemental Figure 1. Kernel phenotype inheritance and a compar-ison of developing wild-type (WT) and dek15 kernels at differentdevelopmental stages.

Supplemental Figure 2. Longitudinal paraffin sections of developingwild-type (WT) and dek15 kernels at different developmental stages.

Supplemental Figure 3. Ears of the Zm00001d052197 knockoutalleles and those used for the allelism test with dek15.

Supplemental Figure 4. Protein sequence alignment of SCC4 and itshomologs in other organisms.

Supplemental Figure 5. Full, scanned images of the immunoblots.

Supplemental Figure 6. Subcellular localization of SCC4-YFP inonion (Allium cepa) mesophyll cells.

Supplemental Figure 7. Comparison of the cell morphology of wild-type (WT) and dek15 endosperm at 15 DAP.

Supplemental Figure 8. Analysis of the nuclear morphology of wild-type (WT) and dek15 endosperm cells using transmission electronmicroscopy (TEM) and DAPI-stained paraffin sections.

Supplemental Figure 9. The chromosome behavior of embryo cells indek15, and endosperm cells and embryo cells in dek15-cas9-1.

Supplemental Figure 10. FISH with chromosome 4-specific sequen-ces (Cent4) probe in 15-DAP wild-type (WT) and dek15 embryos.

Supplemental Table. Student’s t test Tables.

Supplemental Data Set 1. Text file of the alignment used for thephylogenetic analysis shown in Figure 3A.

Supplemental Data Set 2. Significantly differentially expressed genesof dek15 compared with WT at 15 DAP.

Supplemental Data Set 3. GO terms classifications in dek15 DEGswith functional annotations.

Supplemental Data Set 4. Summary of putative ZmSCC4-interactingproteins by a yeast two-hybrid assay.

Supplemental Data Set 5. List of primers.

ACKNOWLEDGMENTS

WethankWeiZhang (SchoolofLifeSciences,ShanghaiUniversity),YanHeand Yazhong Wang (College of Agronomy and Biotechnology, ChinaAgricultural University), Liying Du (School of Life Sciences, Peking Uni-versity), and Fangpu Han and Yang Liu (Institute of Genetics and De-velopmental Biology, Chinese Academy of Sciences) for technicalassistance, and Weiwei Jin (College of Agronomy and Biotechnology,China Agricultural University) for providing the plasmids with Cent4 or45S rDNA repeat. This work was supported by National Key Research and

Development Program of China (2016YFD0101003 to R.S.) and theNational Natural Science Foundation of China (NSFC) (91635303 and31425019 to R.S.).

AUTHOR CONTRIBUTIONS

Y.H. and R.S. wrote the article and designed research; Y.H. and J.W.performed the research; all authors analyzed the data.

Received December 4, 2018; revised January 22, 2019; accepted January31, 2019; published January 31, 2019.

REFERENCES

Baetz, K.K., Krogan, N.J., Emili, A., Greenblatt, J., and Hieter, P.(2004). The ctf13-30/CTF13 genomic haploinsufficiency modifierscreen identifies the yeast chromatin remodeling complex RSC,which is required for the establishment of sister chromatid co-hesion. Mol. Cell. Biol. 24: 1232–1244.

Bénard, C.Y., Kébir, H., Takagi, S., and Hekimi, S. (2004). mau-2acts cell-autonomously to guide axonal migrations in Caeno-rhabditis elegans. Development 131: 5947–5958.

Bernard, P., Drogat, J., Maure, J.F., Dheur, S., Vaur, S., Genier, S.,and Javerzat, J.P. (2006). A screen for cohesion mutants uncoversSsl3, the fission yeast counterpart of the cohesin loading factorScc4. Curr. Biol. 16: 875–881.

Blatch, G.L., and Lässle, M. (1999). The tetratricopeptide repeat: Astructural motif mediating protein-protein interactions. BioEssays21: 932–939.

Bolaños-Villegas, P., De, K., Pradillo, M., Liu, D., and Makaroff, C.A. (2017). In favor of establishment: Regulation of chromatid co-hesion in plants. Front. Plant Sci. 8: 846.

Chao, W.C., Murayama, Y., Muñoz, S., Costa, A., Uhlmann, F., andSingleton, M.R. (2015). Structural studies reveal the functionalmodularity of the Scc2-Scc4 cohesin loader. Cell Reports 12:719–725.

Chao, W.C., Murayama, Y., Muñoz, S., Jones, A.W., Wade, B.O.,Purkiss, A.G., Hu, X.W., Borg, A., Snijders, A.P., Uhlmann, F., andSingleton, M.R. (2017). Structure of the cohesin loader Scc2. Nat.Commun. 8: 13952.

Ciosk, R., Shirayama, M., Shevchenko, A., Tanaka, T., Toth, A.,Shevchenko, A., and Nasmyth, K. (2000). Cohesin’s binding tochromosomes depends on a separate complex consisting of Scc2and Scc4 proteins. Mol. Cell 5: 243–254.

Clapier, C.R., and Cairns, B.R. (2009). The biology of chromatin re-modeling complexes. Annu. Rev. Biochem. 78: 273–304.

Dai, D., Luan, S., Chen, X., Wang, Q., Feng, Y., Zhu, C., Qi, W., andSong, R. (2018). Maize Dek37 encodes a P-type PPR protein thataffects cis-splicing of mitochondrial nad2 intron 1 and seed de-velopment. Genetics 208: 1069–1082.

Dolezel, J., Greilhuber, J., and Suda, J. (2007). Estimation of nuclearDNA content in plants using flow cytometry. Nat. Protoc. 2:2233–2244.

Doll, N.M., Depège-Fargeix, N., Rogowsky, P.M., and Widiez, T.(2017). Signaling in early maize kernel development. Mol. Plant 10:375–388.

Feng, F., Qi, W., Lv, Y., Yan, S., Xu, L., Yang, W., Yuan, Y., Chen, Y.,Zhao, H., and Song, R. (2018). OPAQUE11 Is a central hub of theregulatory network for maize endosperm development and nutrientmetabolism. Plant Cell 30: 375–396.

Mitotic Chromosome Segregation Requires Dek15/Scc4 483

Frame, B.R., Shou, H., Chikwamba, R.K., Zhang, Z., Xiang, C.,Fonger, T.M., Pegg, S.E., Li, B., Nettleton, D.S., Pei, D., andWang, K. (2002). Agrobacterium tumefaciens-mediated trans-formation of maize embryos using a standard binary vector system.Plant Physiol. 129: 13–22.

Garcia, N., Li, Y., Dooner, H.K., and Messing, J. (2017). Maize de-fective kernel mutant generated by insertion of a Ds element ina gene encoding a highly conserved TTI2 cochaperone. Proc. Natl.Acad. Sci. USA 114: 5165–5170.

Gligoris, T.G., Scheinost, J.C., Bürmann, F., Petela, N., Chan, K.L.,Uluocak, P., Beckouët, F., Gruber, S., Nasmyth, K., and Löwe, J.(2014). Closing the cohesin ring: Structure and function of its Smc3-kleisin interface. Science 346: 963–967.

Gómez, E., Royo, J., Muñiz, L.M., Sellam, O., Paul, W., Gerentes,D., Barrero, C., López, M., Perez, P., and Hueros, G. (2009). Themaize transcription factor myb-related protein-1 is a key regulatorof the differentiation of transfer cells. Plant Cell 21: 2022–2035.

Haarhuis, J.H., Elbatsh, A.M., van den Broek, B., Camps, D., Erkan,H., Jalink, K., Medema, R.H., and Rowland, B.D. (2013). WAPL-mediated removal of cohesin protects against segregation errorsand aneuploidy. Curr. Biol. 23: 2071–2077.

Haering, C.H., Löwe, J., Hochwagen, A., and Nasmyth, K. (2002).Molecular architecture of SMC proteins and the yeast cohesincomplex. Mol. Cell 9: 773–788.

Hakimi, M.A., Bochar, D.A., Schmiesing, J.A., Dong, Y., Barak, O.G., Speicher, D.W., Yokomori, K., and Shiekhattar, R. (2002). Achromatin remodelling complex that loads cohesin onto humanchromosomes. Nature 418: 994–998.

Hinshaw, S.M., Makrantoni, V., Kerr, A., Marston, A.L., andHarrison, S.C. (2015). Structural evidence for Scc4-dependent lo-calization of cohesin loading. eLife 4: e06057.

Hinshaw, S.M., Makrantoni, V., Harrison, S.C., and Marston, A.L.(2017). The kinetochore receptor for the cohesin loading complex.Cell 171: 72–84.e13.

Ho, L., and Crabtree, G.R. (2010). Chromatin remodelling duringdevelopment. Nature 463: 474–484.

Hu, Y., Liu, D., Zhong, X., Zhang, C., Zhang, Q., and Zhou, D.X.(2012). CHD3 protein recognizes and regulates methylated histoneH3 lysines 4 and 27 over a subset of targets in the rice genome.Proc. Natl. Acad. Sci. USA 109: 5773–5778.

Huang, J., Hsu, J.M., and Laurent, B.C. (2004). The RSCnucleosome-remodeling complex is required for Cohesin’s associ-ation with chromosome arms. Mol. Cell 13: 739–750.

Jiao, Y., et al. (2017). Improved maize reference genome with single-molecule technologies. Nature 546: 524–527.

Kato, A., Lamb, J.C., and Birchler, J.A. (2004). Chromosome paint-ing using repetitive DNA sequences as probes for somatic chro-mosome identification in maize. Proc. Natl. Acad. Sci. USA 101:13554–13559.

Khanday, I., Skinner, D., Yang, B., Mercier, R., and Sundaresan, V.(2019). A male-expressed rice embryogenic trigger redirected forasexual propagation through seeds. Nature 565: 91–95.

Kikuchi, S., Borek, D.M., Otwinowski, Z., Tomchick, D.R., and Yu,H. (2016). Crystal structure of the cohesin loader Scc2 and insightinto cohesinopathy. Proc. Natl. Acad. Sci. USA 113: 12444–12449.

Kowles, R.V., and Phillips, R.L. (1985). DNA amplification patterns inmaize endosperm nuclei during kernel development. Proc. Natl.Acad. Sci. USA 82: 7010–7014.

Kowles, R.V., and Phillips, R.L. (1988). Endosperm Development inMaize. In GH Bourne, KW Jeon, and M Friedlander, eds, InternationalReview of Cytology. Academic Press, California, pp 97–136.

Lam, W.S., Yang, X., and Makaroff, C.A. (2005). Characterization ofArabidopsis thaliana SMC1 and SMC3: Evidence that AtSMC3 may

function beyond chromosome cohesion. J. Cell Sci. 118: 3037–3048.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009).Ultrafast and memory-efficient alignment of short DNA sequencesto the human genome. Genome Biol. 10: R25.

Leiva-Neto, J.T., Grafi, G., Sabelli, P.A., Dante, R.A., Woo, Y.M.,Maddock, S., Gordon-Kamm, W.J., and Larkins, B.A. (2004). Adominant negative mutant of cyclin-dependent kinase A reducesendoreduplication but not cell size or gene expression in maizeendosperm. Plant Cell 16: 1854–1869.

Li, C., Yue, Y., Chen, H., Qi, W., and Song, R. (2018a). The ZmbZIP22transcription factor regulates 27-kD g-zein gene transcription dur-ing maize endosperm development. Plant Cell 30: 2402–2424.

Li, X., Gu, W., Sun, S., Chen, Z., Chen, J., Song, W., Zhao, H., andLai, J. (2018b). Defective Kernel 39 encodes a PPR protein requiredfor seed development in maize. J. Integr. Plant Biol. 60: 45–64.

Lid, S.E., Gruis, D., Jung, R., Lorentzen, J.A., Ananiev, E.,Chamberlin, M., Niu, X., Meeley, R., Nichols, S., and Olsen, O.A. (2002). The defective kernel 1 (dek1) gene required for aleuronecell development in the endosperm of maize grains encodesa membrane protein of the calpain gene superfamily. Proc. Natl.Acad. Sci. USA 99: 5460–5465.

Liu Cm, C.M., McElver, J., Tzafrir, I., Joosen, R., Wittich, P.,Patton, D., Van Lammeren, A.A., and Meinke, D. (2002). Con-densin and cohesin knockouts in Arabidopsis exhibit a titan seedphenotype. Plant J. 29: 405–415.

Lopez-Serra, L., Kelly, G., Patel, H., Stewart, A., and Uhlmann, F.(2014). The Scc2-Scc4 complex acts in sister chromatid cohesionand transcriptional regulation by maintaining nucleosome-free re-gions. Nat. Genet. 46: 1147–1151.

Losada, A. (2014). Cohesin in cancer: Chromosome segregation andbeyond. Nat. Rev. Cancer 14: 389–393.

McIntosh, J.R. (2016). Mitosis. Cold Spring Harb Perspect Biol 8:a023218.

Minina, E.A., Reza, S.H., Gutierrez-Beltran, E., Elander, P.H.,Bozhkov, P.V., and Moschou, P.N. (2017). Arabidopsis homo-logue of Scc4/MAU2 is essential for plant embryogenesis. J Cell Sci130:1051–1063.

Murayama, Y., and Uhlmann, F. (2014). Biochemical reconstitution oftopological DNA binding by the cohesin ring. Nature 505: 367–371.

Nasmyth, K., and Haering, C.H. (2009). Cohesin: Its roles andmechanisms. Annu. Rev. Genet. 43: 525–558.

Neuffer, M.G., and Sheridan, W.F. (1980). Defective kernel mutantsof maize. I. Genetic and lethality studies. Genetics 95: 929–944.

Olsen, O.-A. (2001). Endosperm development: Cellularization and cellfate specification. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52:233–267.

Qi, W., Zhu, T., Tian, Z., Li, C., Zhang, W., and Song, R. (2016a).High-efficiency CRISPR/Cas9 multiplex gene editing using theglycine tRNA-processing system-based strategy in maize. BMCBiotechnol. 16: 58.

Qi, W., Zhu, J., Wu, Q., Wang, Q., Li, X., Yao, D., Jin, Y., Wang, G.,Wang, G., and Song, R. (2016b). Maize reas1 mutant stimulatesribosome use efficiency and triggers distinct transcriptional andtranslational responses. Plant Physiol. 170: 971–988.

Qi, W., Tian, Z., Lu, L., Chen, X., Chen, X., Zhang, W., and Song, R.(2017b). Editing of mitochondrial transcripts nad3 and cox2 byDek10 is essential for mitochondrial function and maize plant de-velopment. Genetics 205: 1489–1501.

Qi, W., Yang, Y., Feng, X., Zhang, M., and Song, R. (2017a). Mito-chondrial function and maize kernel development requires Dek2,a pentatricopeptide repeat protein involved in nad1 mRNA splicing.Genetics 205: 239–249.

484 The Plant Cell

Qiao, Z., Qi, W., Wang, Q., Feng, Y., Yang, Q., Zhang, N., Wang, S.,Tang, Y., and Song, R. (2016). ZmMADS47 regulates zein genetranscription through interaction with opaque2. PLoS Genet. 12:e1005991.

Rayburn, A.L., and Gill, B.S. (1985). Use of biotin-labeled probes to mapspecific DNA sequences on wheat chromosomes. Heredity 76: 78–81.

Remeseiro, S., Cuadrado, A., Carretero, M., Martínez, P.,Drosopoulos, W.C., Cañamero, M., Schildkraut, C.L., Blasco,M.A., and Losada, A. (2012). Cohesin-SA1 deficiency drives an-euploidy and tumourigenesis in mice due to impaired replication oftelomeres. EMBO J. 31: 2076–2089.

Russell, S.D. (1992). Double Fertilization. In SD Russell, and CDumas, eds, International Review of Cytology. Elsevier, New York,pp 357–388.

Sabelli, P.A., and Larkins, B.A. (2009). The development of endo-sperm in grasses. Plant Physiol. 149: 14–26.

Sabelli, P.A., Liu, Y., Dante, R.A., Lizarraga, L.E., Nguyen, H.N.,Brown, S.W., Klingler, J.P., Yu, J., LaBrant, E., Layton, T.M.,Feldman, M., and Larkins, B.A. (2013). Control of cell proliferation,endoreduplication, cell size, and cell death by the retinoblastoma-related pathway in maize endosperm. Proc. Natl. Acad. Sci. USA110: E1827–E1836.

Sarnowski, T.J., Ríos, G., Jásik, J., Swiezewski, S., Kaczanowski,S., Li, Y., Kwiatkowska, A., Pawlikowska, K., Kozbiał, M.,Kozbiał, P., Koncz, C., and Jerzmanowski, A. (2005). SWI3 sub-units of putative SWI/SNF chromatin-remodeling complexes playdistinct roles during Arabidopsis development. Plant Cell 17:2454–2472.

Schweizer, L., Yerk-Davis, G.L., Phillips, R.L., Srienc, F., and Jones,R.J. (1995). Dynamics of maize endosperm development and DNAendoreduplication. Proc. Natl. Acad. Sci. USA 92: 7070–7074.

Sebastian, J., Ravi, M., Andreuzza, S., Panoli, A.P., Marimuthu, M.P., and Siddiqi, I. (2009). The plant adherin AtSCC2 is required forembryogenesis and sister-chromatid cohesion during meiosis inArabidopsis. Plant J. 59: 1–13.

Seitan, V.C., et al. (2006). Metazoan Scc4 homologs link sisterchromatid cohesion to cell and axon migration guidance. PLoS Biol.4: e242.

Siegel, J.J., and Amon, A. (2012). New insights into the troubles ofaneuploidy. Annu. Rev. Cell Dev. Biol. 28: 189–214.

Solomon, D.A., et al. (2011). Mutational inactivation of STAG2 causesaneuploidy in human cancer. Science 333: 1039–1043.

Takahashi, T.S., Basu, A., Bermudez, V., Hurwitz, J., and Walter, J.C. (2008). Cdc7-Drf1 kinase links chromosome cohesion to theinitiation of DNA replication in Xenopus egg extracts. Genes Dev.22: 1894–1905.

Tian, H.L., Wang, F.G., Zhao, J.R., Yi, H.M., Wang, L., Wang, R.,Yang, Y., and Song, W. (2015). Development of maizeSNP3072,a high-throughput compatible SNP array, for DNA fingerprintingidentification of Chinese maize varieties. Mol. Breed. 35: 136.

Trapnell, C., Hendrickson, D.G., Sauvageau, M., Goff, L., Rinn, J.L.,and Pachter, L. (2013). Differential analysis of gene regulation attranscript resolution with RNA-seq. Nat. Biotechnol. 31: 46–53.

Uhlmann, F. (2016). SMC complexes: From DNA to chromosomes.Nat. Rev. Mol. Cell Biol. 17: 399–412.

Uhlmann, F., and Nasmyth, K. (1998). Cohesion between sisterchromatids must be established during DNA replication. Curr. Biol.8: 1095–1101.

Uhlmann, F., Lottspeich, F., and Nasmyth, K. (1999). Sister-chromatid separation at anaphase onset is promoted by cleavageof the cohesin subunit Scc1. Nature 400: 37–42.

Wang, C., Liu, Q., Shen, Y., Hua, Y., Wang, J., Lin, J., Wu, M., Sun,T., Cheng, Z., Mercier, R., and Wang, K. (2019). Clonal seeds fromhybrid rice by simultaneous genome engineering of meiosis andfertilization genes. Nat. Biotechnol. In press.

Wang, G., Sun, X., Wang, G., Wang, F., Gao, Q., Sun, X., Tang, Y.,Chang, C., Lai, J., Zhu, L., Xu, Z., and Song, R. (2011). Opaque7encodes an acyl-activating enzyme-like protein that affects storageprotein synthesis in maize endosperm. Genetics 189: 1281–1295.

Wang, G., Zhong, M., Shuai, B., Song, J., Zhang, J., Han, L., Ling,H., Tang, Y., Wang, G., and Song, R. (2017). E+ subgroup PPRprotein defective kernel 36 is required for multiple mitochondrialtranscripts editing and seed development in maize and Arabidopsis.New Phytol. 214: 1563–1578.

Watrin, E., Schleiffer, A., Tanaka, K., Eisenhaber, F., Nasmyth, K.,and Peters, J.M. (2006). Human Scc4 is required for cohesinbinding to chromatin, sister-chromatid cohesion, and mitotic pro-gression. Curr. Biol. 16: 863–874.

Yu, X., Jiang, L., Wu, R., Meng, X., Zhang, A., Li, N., Xia, Q., Qi, X.,Pang, J., Xu, Z.Y., and Liu, B. (2016). The core subunit of a chro-matin-remodeling complex, ZmCHB101, plays essential roles inmaize growth and development. Sci. Rep. 6: 38504.

Zhang, N., Qiao, Z., Liang, Z., Mei, B., Xu, Z., and Song, R. (2012).Zea mays Taxilin protein negatively regulates opaque-2 transcrip-tional activity by causing a change in its sub-cellular distribution.PLoS One 7: e43822.

Zhang, Z., Yang, J., and Wu, Y. (2015). transcriptional regulation ofzein gene expression in maize through the additive and synergisticaction of opaque2, prolamine-box binding factor, and O2 hetero-dimerizing proteins. Plant Cell 27: 1162–1172.

Zhao, X., Xu, X., Xie, H., Chen, S., and Jin, W. (2013). Fertilizationand uniparental chromosome elimination during crosses with maizehaploid inducers. Plant Physiol. 163: 721–731.

Zhu, Y., Rowley, M.J., Böhmdorfer, G., and Wierzbicki, A.T. (2013).A SWI/SNF chromatin-remodeling complex acts in noncoding RNA-mediated transcriptional silencing. Mol. Cell 49: 298–309.

Zimmermann, L., Stephens, A., Nam, S.Z., Rau, D., Kübler, J.,Lozajic, M., Gabler, F., Söding, J., Lupas, A.N., and Alva, V.(2018). A completely reimplemented MPI bioinformatics toolkit witha new HHpred server at its core. J. Mol. Biol. 430: 2237–2243.

Mitotic Chromosome Segregation Requires Dek15/Scc4 485

DOI 10.1105/tpc.18.00921; originally published online January 31, 2019; 2019;31;465-485Plant Cell

Yonghui He, Jinguang Wang, Weiwei Qi and Rentao SongChromosome Segregation and Kernel Development

Encodes the Cohesin-Loading Complex Subunit SCC4 and Is Essential forDek15Maize

 This information is current as of December 26, 2020

 

Supplemental Data /content/suppl/2019/01/31/tpc.18.00921.DC2.html /content/suppl/2019/01/31/tpc.18.00921.DC1.html

References /content/31/2/465.full.html#ref-list-1

This article cites 75 articles, 32 of which can be accessed free at:

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists