ELSEVIER Biochimica et Biophysica Acta 1186 (1994) 133-136

Biochi ~mic~a et Biophysica A~ta

Short Sequence-Paper

Isolation and sequence analysis of a c D N A encoding an adenine nucleotide translocator from Plasmodium falciparum

Michael Dyer *, Ivy Hing Wong, Michael Jackson, Phuong Huynh, Ross Mikkelsen Department of Radiation Oncology, Medical College of Virginia, PO Box 980058, Richmond VA 23298-0058, USA

(Received 30 December 1993; revised manuscript received 3 March 1994)

Abstract

A cDNA clone encoding the polypeptide for Plasmodium falciparum adenine nucleotide translocator (ANT) was isolated by screening a cDNA library with a 150 base pair fragment of genomic DNA which had been enzymatically amplified using two oligonucleotide primers designed from conserved regions of ANT's from other sources. The deduced amino acid sequence of the P. falciparum cloned insert was highly homologous to ANT of other organisms. Features of the sequence are discussed with reference to the targeting and membrane insertion of ANT. The protein has a molecular mass of 35 kDa as predicted from the 303 amino acids encoded in the open reading frame.

Key words: Adenine nucleotide translocator; cDNA; Sequence; (Plasmodium falciparum)

The nuclear-encoded eukaryotic mitochondrial A D P / A T P carrier catalyses the exchange of adenine nucleotides across the mitochondrial inner membrane [1]. This exchange is essential to the transfer of energy from oxidative phosphorylation to extramitochondrial processes and so ANT would be a logical site for regulating cell dependence on oxidative energy metabolism [2,3].

In erythrocytic asexual forms of P. falciparum, there is no conclusive evidence that the parasite mito- chondria are involved in ATP production [4] This situation may be quite different during sexual develop- ment and so differential expression a n d / o r activity of ANT throughout the malarial life cycle may be critical to the parasites' development. In addition, two inde- pendent investigations have demonstrated the presence of an ANT at the parasite plasma membrane (or para- sitophorous vacuole membrane) which regulates the flow of A D P / A T P between host erythrocyte and asex- ual parasite [5,6]. This transport process is inhibited by atractyloside--an inhibitor of mitochondrial ANT.

As a first step in investigating the host-parasite and mitochondria-parasite metabolic interconnections, we

* Corresponding author. Fax: 1 (804) 3716042.

0005-2728/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0 0 0 5 - 2 7 2 8 ( 9 4 ) 0 0 0 3 7 - 6

have undertaken the cloning of P. falciparum ANT(s). Two oligonucleotides ( 5 ' G G G G A T C C G C T / A C C T / A A T T / A G A A C / A G T / A G T I ' / A A A A and 5 'GG- C T C G A G T - f f F A T C T T T A A A A / T G C A A A A T I ' ) cor- responding to regions which are highly conserved amongst the ANT's of other species (see Fig. 2) incor- porated an A / T bias at the third position of each codon where applicable, in accordance with the high AT content of the P. falciparum genome [7]. These oligonucleotides were used to prime a polymerase chain reaction (PCR) utilizing P. falciparum K1 genomic DNA as a template (30 cycles, annealing at 37°C). The reaction amplified a single DNA fragment of approxi- mately the predicted size (150 bp). This fragment was cloned into the plasmid vector pBluescript (Stratagene) and both strands of the insert from three independent clones were sequenced in their entirety using the M13 universal primers. The sequence obtained (Fig. 1, nu- cleotides 111-279) contains a single open reading frame throughout and is homologous to the expected portion of ANT sequences of other organisms (Fig. 2).

A P. falciparum cDNA library in the vector, Agtll (donated by L. Miller, NIH) was screened at high stringency using the 150 bp PCR-generated ANT insert as a probe. A 1.2 kb insert was excised from a single positively hybridising plaque and subcloned into pBlue-

134 M. Dyer etal./Biochimica et Biophysica Acta 1186 (1994) 133-136

1 ctttttataatgagttctgatataaaaacc

MetSerSerAspIleLysThr 61 atatcagccqcaatatcaaaaacagtggtt ileSerAlaAlaIleSerLysThrValVal 121 cagacccaagattctatacctgagatcaaa GlnThrG1nAspSerI1eProGluIleLy8 181 ataaattgtttcaaaagggtttctaaagaa IleAanCysPheLysArgValSerLysGlu 241 gtagctaatgttattagatattttc=aact VaIAlaAsnValIleArgTyrPhePToThr 301 tttaaaaatntatt~cctagatacgatcaa PheLysA~nIlePheProArgTyrAspGln 361 aatatttta~ctggtgcaacagctg~tgct AsnIleLeuSerGlyA1aThrAlaGlyAla 421 ttt~ctagaacta~attagca~cagatatn PheAlaArgThrArgLeuAlaSerAspIle 481 ctctttgattgtttaggtaaaatttataaa LeuPheAspCysLeuGlyLyaIleTyrLys 541 tttggtgtttcagttactggtattartgta PheGlyValSerValThrGlyIleIleVal 601 ~gt~ctaaa~cacttttatttacgaat~at SerAlaLysAlaLeuLeuPheThrAllnAsp 661 gttgctcaatctgttaccatattagctggt ValAlaGlnSerValThrIleLeuAlaGly 721 agacgtatgatgatgatgtcaggtagaaaa ArgArgMetMetMetMetSerGlyArgLys 781 att~att~t~gat~aaaatactaagaaat ileAspCysTrpIleLysIleLeuArgAsn 841 tgggccaatgttatcagnggagctggtgga TrpAlaAsnValIleArgGlyAlaGlyGly 901 caaaaattaatttaataatctacttttca GlnLysLeuIle *

nat tttgcagccgat t ttt tgatgggcggt AsnPheAl aAlaAspPheLellMetGlyG i y

gctccaattgaaagagt aaagatgt t ant t A1 aProI i eGluArgVa I LysMet LeuI le

toaggacaagtggaaagatattcaggt t t a SerGlyGI nValGluArgTyrSerGlyLeu

caaggtgtgttat cot t atggagaggaaat G I nalyVa 1 LeuSer LeuTrpArgGlyAsn

caagcttttaattttgcttttaa99att nc G I hal a PheAsnPheAlaPlleLysAspTyr

aatacagatttctcaaaattcttttgtgtt AsnThrAspPheSer LyaPllePheCysVa 1

atttctttattaatcgtatatcctttagat I I eS e r LeuLeuI I eva ITyrProLeuAsp

~gaaaaggtaaa~ata~Itcaatttaca~qa G lyLysGlyLysAspArgG1 nPheThrG ly

caaactggattactttctttatatagtggt GlnThrGlyLeuLeuSerLeuTyrSe rG ly

tatagaggttcctactttgqactttatgat TyrArgGlySerTyr PheGlyLeuTyrAsp

aaaaatacaaatatt~tattgaaat~Jg~ct LysAsnThrAsn I i eva i LeuLysTrpAl a

ctcatttcgtatccattcgatactgtcaga Leu 11 eS erTyrProPheAspThrVa IArg

ggtaaagaagaaatacaatataaaaatact G lyLyaGluGluI leg I nTyrLyaAsnThr

~aa~atttaaa~gatttttcaaa~agct G IuGI yPheLysGlyPhePheLyaG1yA1 a

gctttggtcct~gtcttttatgatgaatta AI aLeuVa 1 LeuVa 1 PheTyrAspG 1 uLeu

Fig. 1. Nucleotide sequence of the ANT cDNA of P. falciparum. The predicted amino acid sequence of the putative coding region is shown below the nucleotide sequence for the coding regions. A candidate polyadenylation signal is underlined. This sequence data will appear in the EMBL/GenBank DDBJ Nucleotide Sequence Data Libraries under the accession number U04335.

script for sequencing by the dideoxy chain termination method [8] in a custom primer walking strategy.

The complete nucleotide sequence of the ANT-I clone isolated from the P. falciparum cDNA library is presented in Fig. 1. It consists of 929 nucleotides with a single open reading frame of 903 nucleotides, from the putative initiation codon AUG (nucleotides 10-12) to the termination codon nucleotides UAA (913-915), yielding a deduced amino acid sequence of 301 residues, with a predicted mass of 35 kDa. The termination codon UAA is followed by a putative polyadenylation signal AATAA(T) at nucleotides 914-919, 10 nu- cleotides to the 5' of the poly(A) tract. The presence of characteristic initiation and polyadenylation sequences and the homologies to other ADP/ATP translocators (see below) suggests that this cDNA contains the entire coding sequence.

Database searches revealed the most similar pro- teins by far were ANT of other species, the most similar being that of Chlorella kessleri [9] (66% amino acid (aa) identity) and the least similar, that of a

human ANT [3] (62% aa identity). The sequence com- parison in Fig. 2 indicates conservation particularly with segments TM1 ~ 6 which have been previously defined as likely transmembrane hydrophobic se- quences [12]. The ANT of P. falciparum, like other ANT proteins, comprises three homologous domains (see Fig. 2) each of approximately 100 aa [14]. It should be noted that a partial amino-acid-only sequence has been published for P. falciparum ANT, corresponding to amino acids 96 to 242 of the P. falciparum sequence

i TK1 TK2 107

P l a n t N ~ S D ~ K ~ F k A ~ ) ~ k / t ~ S K T V V ~ P ~ R . . R ~ ` M L ~ C ~ i ` Q b ~ P ~ G Q V E ~ R ¥ S G L ~ N C F Y ` R V S K E Q ~ L S ~ 2 h R G ~ ` ~ h ~ R ¥ ? ~ F ~ F K D ¥ F K ~ F . ~ Cant MLSSALYQQ^GLSGI/XASAMGI~TPFIASPKI~PMA VK L A TAG A .. L L N M P. T IV V S A F L V TI CL . K SPK

Scant NSHTET~T~SH GV V A GA .. L M N EEM..L Q SLDT K ILD TATHE IV F T L L KI SLL..S RE Ncant MAEQQI~/IENPP V V V AA .. I L V N EM.. RA RLDR N I D TTADE MA T L R K KM . .G KKD Hssnt HO YtA~S LK A ~A V h . L L ~ HASKQ ShEK...Q K I D ~/ IP F F L L KY QL [EGV RH Consensus ............ f..d.l.gg...a..kt..avle.lr.k.l.q.q .............. y.g...c..r ..... g .... wrgn.anv.ryfptqa.nfaf.d..k ..........

Plane Cant

Scant N c a n t Hsant Consensus

Plane Cane

Scant Ncsnt Hssnt Consensus

K o p a a t C o n s e n s u s

108 ~II~ ~i All2 l~h 206 TD~ FSKFFCVNILSGATAGAI S LLIVYPLDFARTRLASDIG • KGK.. . DRQ .... FTGLFDCLGKIYKQTGLLSLYSG FGVSVTG I I W/RG SyFG LYDSAKALLFTN

• I~R V LA GL G A V S . . . . S E . . . . V S W RG PNA Q Q A T GV KD R GYA ~/ AG LF CA CL F S Y A ARCS. STSQ .... N L VYK TL TD G R VP L L F PV L G V G ~ ~14AG [A G& T F S Y N AKSA~ KGGE . . . . N V VYR TIASD IAG R P A V L I PV LVG KQ. WRY AG LA GA T CF A V . AA. .Q E . . . . H C I I F SD RG Q N Q I AA V T GM .PD . . . . . . . . . . n . . s g . . a g . . s l . . v y , I d . a r e r l a . d . . . . . . . . . . r . . . . . f . g l . d . . . k . . . . . g . , . l y , g f . , s v . g f , . y r . . y f g . y d , . k . . 1 . . .

207 T145 All3 All4 TM6 - - 3 0 1 DKI~I~IIVLIG/AVAQSVTILAGLI SYPFI)TVRRR/4/~ISGRKGK. . EEIQ . . . . YIC~ITI DCWIKILRNEGFKGFFKGAWh/qVIR. GAGGALVLVFYDEI.QKLI ERTA FFA A AC VL L Q ..... G R .... NG R VAQQ M A S L . F L IK F NI~AVSSASE ALEGSF ASFLL~I HG STA L T ...... QT K .... DGAL LR VQK AYSL CG IF . VAA G ISL Q LIMF~

LKN FLASF LGWC TA IA L I T . . . . . . AVK . . . . SSF AASQ VAK V SL G I L . VA C S I Q V LFGK FROG G p VII FVS MI AV V Q .. .AD M .... TG V R AKD A A S L . M F L IK YV ................ t..a.., syp.dt, rrr.Hl, sg .............. y .... d ........ eg .... fkg...n..r.g...a.v...yd ................

F G S YP D R ItL Y G DO KI G SL G AI~ R A F LID K 14 & & AS E laq F N N'V RT &F S S I G G L FK Q I S A qV G V I IR

P

Fig. 2. Comparison of predicted amino acid sequences for P. falciparum, Chlorella kessleri [9], S. cerevisiae [10], N. crassa [11], and H. sapiens [3] ANT's. The predicted amino acid sequence for the P. falciparum protein is presented in the top line and amino acids are indicated for other ANT's only where they differ from the P. falciparurn sequence. A consensus (ANT) sequence is shown on the bottom line. The amino acid regions (residues 59-66 and 123-130) on which the ANT oligonucleotides used for PCR were based, are underlined. Putative transmembrane domains TM1-6 and amphipathic or-helices AH1-4 are overlined [12]. A broken line represents the extended hydrophobic a-helix of P. falciparum. The three conserved repeats are aligned (lll], with adjustments based on our analysis) with a repeat consensus sequence indicating conserved aa's (top line) and their replacements. Computational analysis of the sequence data obtained was carried out using the University of

Wisconsin Genetics Computer Group (UWGCG) programs [13].

M. Dyer et al. / Biochimica et Biophysica Acta 1186 (1994) 133-136 135

given here. Of these 147 amino acids, there are four substitutions (aal00 I ~ K, aa162 G ---> A, aa202 L --* I and aa221 V ~ L) the latter three of which are conser- vative. These differences are likely to be s t ra in/ isola te differences, but misincorporation during PCR may also be responsible, since it is not clear whether the se- quence published by Hat in et al. [15] is a consensus of several products. All four amino acid changes may be brought about by single base substitutions from the sequence in Fig. 1.

At present we are undertaking experiments de- signed to determine whether this sequence represents the protein which is located at the parasite plasma (or vacuolar) membrane or the mitochondrial membrane, or whether the same protein is targeted to both loca- tions. Southern blotting indicates only one gene (Ref. [15], and our unpublished data). If the protein does target to two discrete cellular locations, this may be achieved by a carrier-receptor system, as appears to be the case for other (mitochondrial) A N T [16]. Specific targetting to either location at different stages of para- site development may be brought about by differential expression of components of this carrier system unique to either mitochondrial or plasma membrane target- ting. It could also be achieved by stage-specific post translational modification of A N T or through use of specific signal sequences contained in the A N T brought about by alternative translational s t a r t / s top sites or by differential splicing.

While targetting to the parasite plasma membrane does not pose a conceptual problem, it is at first difficult to envisage how the P. falciparum A N T pro- tein may insert into it. It has been shown that following the binding to a receptor protein and integration into the outer mitochondrial membrane , A N T inserts into the inner membrane via membrane contact sites, in a membrane potent ial-dependent step [16]. (Completion of integration and dimerisation are not membrane po- tential-dependent.) Studies utilising deletion constructs of A N T have shown apparently contradictory results in determining the regions of A N T (which has no cleav- able leader sequence) responsible for both directing it to and inserting it into the inner mitochondrial mem- brane: Pfanner et al. [17] demonstra ted the carboxy two thirds (aa 's 104-313) of N. crassa A N T contain a l l the necessary targetting and insertion information, whereas Adrian et al. [10] showed the N-terminal third (aa's 1-115) of S. cerevisiae targets and inserts cor- rectly. Perhaps each of the three repeats which com- prise A N T contain sufficient information for both tar- getting and correct insertion into the inner mitochon- drial membrane . The translated sequence reveals the P. fa[ciparum protein to be highly basic overall - a feature shared with other mitochondrial proteins. It is the basic C-terminal hydrophilic portion of each of the three repeat units which is presumed to be necessary

for this initial potent ial-dependent translocation into the inner mitochondrial membrane . However, insertion into the parasite plasma membrane by such a mecha- nism is improbable, since the polarity of the potential across the parasite membrane is opposite to that across the mitochondrial inner membrane.

However, when compared to other A N T proteins (Fig. 2-) P. falciparum ANT is the only one with an overall negative charge at the extreme carboxy-terminus at physiological pH. Hydropathy plots of these se- quences reveal that this same region of the P. falci- parum A N T is highly hydrophobic and likely to be a-helical. Thus the C-terminus is likely to be anchored in the membrane and so is neither highly basic nor in a position which would enable it to extend into the mitochondrial matrix for potent ial-dependent inser- tion. Thus, if P. falciparum A N T does indeed insert also into the mitochondrial inner membrane, it must do so by a mechanism which does not require the extreme C-terminus for the membrane potential-de- pendent portion of the translocation. The evidence for localisation of A N T in the P. falciparum mitochondria is entirely based upon electron microscopy with anti- bovine A N T [15]. However, the labelled structures claimed to be mitochondria lack both cristae and a discernable double membrane typically observed in P. falciparum mitochondria, casting doubt on their iden- tity. In addition, evidence to date [4] indicates that P. falciparum' mitochondria may not be involved in oxida- tive phosphorylation.

The membrane-potent ia l -dependent step of inser- tion of A N T into the inner mitochondrial membrane may be necessary to supply the energy with which to pull the N-terminal stop transfer sequences from the outer membrane to the inner membrane. In this case, a membrane-potent ia l -dependent step would not be nec- essary for direct insertion into the parasite plasma membrane .

This work was supported by grant N I H AI24307.

References

[1] Klingenberg, M. (1976) in The Enzymes of Biological Mem- branes (Martorosi, A.N., ed.), Vol. 3, pp. 383-438, Plenum, New York.

[2] Neckelmann, N., Li, K., Wade, R.P., Shuster, R. and Wallace, D.C. (1987) Proc. Natl. Acad. Sci. USA 84, 7580-7584.

[3] Battini, R., Ferrari, S., Kaczmarek, L., Calabrena B., Chen, S. and Baserga, R. (1987) J. Biol. Chem. 262, 4355-4359.

[4] Fry, M.,Webb, E. and Pudney, M. (1990) Comp. Biochem. Physiol. 96b no. 4, 775-782.

[5] Choi, I. and Mikkelsen, R.B. (1990) Exp. Parasitol. 71,452-462. [6] Kanaani, J. and Ginsburg, H. (1989) J. Biol. Chem. 264, 3194-

3199. [7] Hyde, J.E., Kelly, S.L., Holloway, S.P., Snewin, V.A. and Sims,

P.F.G. (1989) Mol. Biochem. Parasitol. 32, 247-262.

136 M. Dyer et al. /Biochimica et Biophysica Acta 1186 (1994) 133 136

[8] Sanger, F., Nieklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.

[9] Hilgarth, C., Sauer, N. and Tanner, W. (1991) J. Biol. Chem. 226, 24044-24047.

[10] Adrian, G.S., McCammon, M.T., Montgomery, D.L. and Dou- glas, M.G. (1986) Mol. Cell. Biol. 6, 626-634.

[11] Arends, H. and Sebald, W. (1984) EMBO J. 3, 377-382. [12] Marty, I., Brandolin, G., Gagnon, J., Brasseur, R. and Vignais,

P.V. (1992) Biochemistry 31, 4058-4065.

[13] Devereux, J., Haeberli, P. and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395.

[14] Saraste, M. and Walker, J.E. (1982) FEBS Lett. 144, 250-254. [15] Hatin, I., Jambou, R., Ginsburg, H. and Jaureguiberry, G.

(1992) Biochem. Pharmacol. 43, 71-75. [16] Pfanner, N. and Neupert, W. (1987) J. Biol. Chem. 262, 7528-

7536. [17] Pfanner, N., Hoeben, P., Tropschung M. and Neupert, W.

(1987) J. Biol. Chem. 262, 14851-14854.