Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Activates

Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP)Activates Global and Heterogeneous Local Ca2� Signals fromNAADP- and Ryanodine Receptor-gated Ca2� Stores inPulmonary Arterial Myocytes*

Received for publication, September 26, 2012, and in revised form, February 8, 2013 Published, JBC Papers in Press, February 26, 2013, DOI 10.1074/jbc.M112.423053

Yong-Liang Jiang‡§, Amanda H. Y. Lin‡, Yang Xia‡, Suengwon Lee‡, Omkar Paudel‡, Hui Sun‡, Xiao-Ru Yang‡,Pixin Ran§1, and James S. K. Sham‡2

From the ‡Division of Pulmonary and Critical Care Medicine, Department of Medicine, The Johns Hopkins University School ofMedicine, Baltimore, Maryland 21224 and the §State Key Laboratory of Respiratory Diseases, The First Affiliated Hospital,Guangzhou Medical University, 510120 Guangzhou, China

Background: NAADP activates Ca2� release from endolysosomal organelles.Results: NAADP activates two-pore channels in pulmonary arterial smooth muscle cells to elicit global and heterogeneoussubcellular Ca2� signals fromNAADP- and ryanodine-sensitive Ca2� stores, which contribute to the agonist-induced response.Conclusion:NAADPmediates complex Ca2� interactions between endolysosomes and the sarcoplasmic reticulum to regulatevascular reactivity and other cellular functions.Significance: The results improve our understanding of NAADP-dependent regulation of pulmonary vascular functions.

Nicotinic acid adenine dinucleotide phosphate (NAADP) isthe most potent Ca2�-mobilizing messenger that releases Ca2�

from endolysosomal organelles. Recent studies showed thatNAADP-induced Ca2� release is mediated by the two-porechannels (TPCs) TPC1 and TPC2. However, the expression ofTPCs and theNAADP-induced local Ca2� signals have not beenexamined in vascular smooth muscle. Here, we found that bothTPC1 andTPC2 are expressed in rat pulmonary arterial smoothmuscle cells (PASMCs), with TPC1 being the major subtype.Application of membrane-permeant NAADP acetoxymethylester to PASMCs elicited a biphasic increase in global [Ca2�]i,whichwas independent of extracellular Ca2� and blocked by theNAADP antagonist Ned-19 or the vacuolar H�-ATPase inhibi-tor bafilomycin A1, indicating Ca2� release from acidic endoly-sosomal Ca2� stores. The Ca2� response was unaffected by xes-tospongin C but was partially blocked by ryanodine orthapsigargin. NAADP triggered heterogeneous local Ca2� sig-nals, including a diffuse increase in cytosolic [Ca2�], Ca2�

sparks, Ca2� bursts, and regenerative Ca2� release. The diffuseCa2� increase and Ca2� bursts were ryanodine-insensitive, pre-sumably arising from different endolysosomal sources. Ca2�

sparks and regenerative Ca2� release were inhibited by ryano-dine, consistent with cross-activation of loosely coupled ryano-dine receptors. Moreover, Ca2� release stimulated by endothe-lin-1 was inhibited by Ned-19, ryanodine, or xestospongin C,suggesting that NAADP-mediated Ca2� signals interact withboth ryanodine and inositol 1,4,5-trisphosphate receptors dur-ing agonist stimulation.Our results show thatNAADPmediates

complex global and local Ca2� signals. Depending on the phys-iological stimuli, these diverse Ca2� signals may serve to regu-late different cellular functions in PASMCs.

Ca2� ion serves as a ubiquitous signal for numerous cellularfunctions ranging frommuscle contraction to gene expression.Depending on the specific agonists and physiological stimuli,global and local Ca2� signals with unique spatiotemporal prop-erties are generated by a multitude of extracellular Ca2� influxand intracellular Ca2� release pathways to precisely regulatethe specific effectors in various subcellular compartments (1).There are three Ca2�-mobilizing messengers, namely inositol1,4,5-trisphosphate (InsP3),3 cyclic ADP-ribose (cADPR), andnicotinic acid adenine dinucleotide phosphate (NAADP).NAADP is the most powerful Ca2�-mobilizing messenger ofthese three endogenousmessengers and is capable of activatingCa2� release at lownanomolar concentrations (2), but its actionmechanism is the least understood.NAADP is generated from inactive NADP by the multifunc-

tional enzyme CD38, which is also known as ADP-ribosylcyclase for its cyclase activity of converting ADP-ribose tocADPR (3). Unlike InsP3 and cADPR, which activate InsP3receptors (InsP3Rs) and ryanodine receptors (RyRs) of the sar-coplasmic (SR)/endoplasmic reticulum, NAADP targets spe-cific Ca2� release channels on acidic endolysosomes (4, 5).Recent studies have indicated that the two-pore channels

* This work was supported, in whole or in part, by National Institutes of HealthGrants R01 HL071835 and R01 HL075134 (to J. S. K. S.).

1 To whom correspondence may be addressed. E-mail: [email protected] To whom correspondence may be addressed: Div. of Pulmonary and Critical

Care Medicine, The Johns Hopkins University School of Medicine, 5501Hopkins Bayview Circle, Baltimore, MD 21224. Tel.: 410-550-7751; Fax: 410-550-2612; E-mail: [email protected].

3 The abbreviations used are: InsP3, inositol 1,4,5-trisphosphate; InsP3R, InsP3

receptor; cADPR, cyclic ADP-ribose; NAADP, nicotinic acid adenine dinu-cleotide phosphate; RyR, ryanodine receptor; SR, sarcoplasmic reticulum;TPC, two-pore channel; VSMC, vascular smooth muscle cell; ET-1, endothe-lin-1; PASMC, pulmonary arterial smooth muscle cell; PA, pulmonary artery;lPA, large PA; sPA, small PA; HBSS, HEPES-buffered salt solution; SOCE,store-operated Ca2� entry; Bt3-InsP3/AM, 2,3,6-tri-O-butyryl-myo-inositol1,4,5-triphosphate hexakis(acetoxymethyl) ester.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 15, pp. 10381–10394, April 12, 2013© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

APRIL 12, 2013 • VOLUME 288 • NUMBER 15 JOURNAL OF BIOLOGICAL CHEMISTRY 10381

by guest on April 9, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(TPCs) TPC1 and TPC2 are the NAADP-activated Ca2�

release channels (6–8). TPC1 is expressed in all stages of endo-somes and lysosomes, whereas TPC2 is present predominantlyin late endosomes and lysosomes (6–10). Functional studieshave shown that overexpression of TPC1orTPC2 enhances theNAADP-inducedCa2� response (6–8); reconstitution of TPCsin lipid bilayers exhibits NAADP-induced channel activity (11,12); and knockdown of endogenous TPCs or deletion of thetpcn2 gene abbreviates NAADP-induced responses in intactnative cells (7, 8, 12–14). These breakthrough discoveries haveattracted unprecedented interest in the study of NAADP-de-pendent Ca2� signaling mechanisms.Increasing evidence suggests that NAADP plays important

roles in vascular smooth muscle cell (VSMC) function, andNAADP-mediated Ca2� release is linked to agonist-inducedvasoconstriction. For example, application of NAADP tomicrosomes of aortic smoothmuscle cells elicited Ca2� releaseindependent of InsP3 and cADPR (15, 16). Endothelin-1 (ET-1)caused an increase in NAADP production and activated theCa2� response in coronary arterial myocytes (17). ET-1 andnorepinephrine triggered the Ca2� response and vasoconstric-tion in renal afferent arterioles, and these responses were atten-uated by the vacuolar H�-ATPase inhibitors concanamycin Aand bafilomycinA1 and by theNAADP antagonist Ned-19 (18).In addition, a recent study showed that Fas ligand, an inducer ofapoptosis, elicits NAADP-mediated lysosomal Ca2� release inmouse coronary arterial myocytes, suggesting that NAADPmay involve in the inflammatory/apoptotic response inVSMCs(19).In pulmonary arterial smooth muscle cells (PASMCs), intra-

cellular dialysis of NAADP triggered “bursts” of spatiallyrestricted Ca2� release and global Ca2� waves, which wereblocked by depleting lysosomal Ca2� with bafilomycin A1 or byinhibition of RyRs (20, 21). It has been suggested that lysosomesand the RyR-gated SR are coupled to form specialized “triggerzones,” atwhichNAADP-dependentCa2� signals are amplifiedby RyRs through Ca2�-induced Ca2� release (21, 22). We havepreviously found that integrin-specific ligandsmobilizeCa2� inpart through Ca2� release from the acidic lysosomal Ca2�

stores in PASMCs (23), and the expression of integrins andtheir associated Ca2� responses are altered during the develop-ment of pulmonary hypertension (24). These studies suggestthat NAADP-dependent Ca2� signals may be criticallyinvolved in the regulation of pulmonary circulation. However,the expression of NAADP channels and the properties ofNAADP-dependent local Ca2� signals have not been examinedin VSMCs.In this study, we examined systematically the NAADP-de-

pendent Ca2� signaling pathway in PASMCs by characterizingthe expression of TPCs, identifying the associated Ca2�

sources, quantifying the spatiotemporal properties of localCa2� events activated by NAADP, and determining the contri-bution of NAADP in an agonist-induced Ca2� response. Theseexperiments provide essential information for our understand-ing of NAADP-dependent Ca2� signaling in the pulmonaryvasculature.

EXPERIMENTAL PROCEDURES

Isolation of Intralobar Pulmonary Arteries and Aortas—Allanimal procedures in this study were performed in accordancewith the guidelines approved by The Johns Hopkins AnimalCare and Use Committee. Pulmonary arteries (PAs) and aortaswere isolated from male Wistar rats (150–250 g) anesthetizedwith sodium pentobarbital (130 mg/kg intraperitoneally).Lungs and thoracic aortas were removed after exsanguinationand transferred to a Petri dish filled with HEPES-buffered saltsolution (HBSS) containing 130 mM NaCl, 5 mM KCl, 1.2 mM

MgCl2, 1.5 mM CaCl2, 10 mM HEPES, and 10 mM glucose (pH7.4 adjusted with NaOH). Intralobar large PAs (lPAs; �300–800 �m), small PAs (sPAs;�300 �m), and descending thoracicaortas were isolated and cleaned free of connective tissue. Theendothelium was removed by gently rubbing the luminal sur-face with a cotton swab.Isolation and Transient Culture of PASMCs—PASMCs were

enzymatically isolated and transiently cultured as describedpreviously (25). In brief, endothelium-denuded PAs wereallowed to recover for 30 min in cold (4 °C) HBSS, followed by20 min in reduced Ca2� (20 �M) HBSS at room temperature.The tissue was digested at 37 °C for 20 min in 20 �M Ca2�/HBSS containing collagenase (type I, 1750 units/ml), papain(9.5 units/ml), BSA (2mg/ml), and dithiothreitol (1 mM). It wasthen washed with Ca2�-free HBSS to stop digestion, andPASMCswere dispersed gently by triturationwith a small-borepipette in Ca2�-free HBSS at room temperature. The dispersedPASMCs were placed on 25-mm glass coverslips and culturedtransiently (16–24 h) in Ham’s F-12 medium (with L-gluta-mine) supplemented with 0.5% FCS, 100 units/ml streptomy-cin, and 0.1 mg/ml penicillin under 21% O2 and 5% CO2 beforeuse.RNA Preparation and RT-PCR—Endothelium-denuded

intralobar PAs, sPAs, and aortas were frozen in liquid nitrogenand then mechanically pulverized and homogenized with amortar and pestle kept on dry ice. Total RNA was extractedusing the RNeasy mini kit (Qiagen) following standard proce-dures. Genomic DNA contamination was removed by TURBODNA-freeTM DNase (Ambion, Austin, TX). 1 �g of total RNAwere used for first-strand cDNA synthesis with random hex-amer primers and Superscript III reverse transcriptase (Invit-rogen) according to the manufacturer’s protocol. The resultingfirst-strand cDNAs were directly used as templates for PCRamplification. Sense and antisense primers specific for TPC1and TPC2 (listed in Table 1) were used. Reactions were carriedout using PCR SuperMix (Invitrogen) with the followingparameters: denaturation at 94 °C for 30 s, annealing at 60 °Cfor 45 s, and extension at 72 °C for 90 s. A total of 35 cycles wereperformed.Thiswas followedby a final extension at 72 °C for 10min and then storage at 4 °C. PCR products were analyzed by1.5% agarose gel electrophoresis and visualized by staining withethidium bromide, and the sequences of PCR products weredetermined for verification. Parallel reactionswere run for eachRNA sample in the absence of Superscript III to access thedegree of genomic DNA contamination.Quantitative Real-time RT-PCR—Gene-specific real-time

PCR primers for TPC1 and TPC2 were designed (Table 1).

NAADP-induced Ca2� Signaling in PASMCs

10382 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 15 • APRIL 12, 2013


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

PCRs were set up with iQTM SYBR Green PCR Supermix (Bio-Rad) using 1 �l of cDNA as the template in each 20-�l reactionmixture. The PCR protocol consisted of an initial step at 95 °Cfor 5 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s,and 72 °C for 1min andwas performed using an iQ5multicolorreal-time PCR detection system (Bio-Rad). Using the same pro-tocol, we generated standard curves from serial dilutions ofpurified PCR products with known copy numbers measured byabsorbance at 260 nm.The absolute copy number of themRNAof interest was determined by interpolation of the standardcurvewith the threshold cycle value of each sample. To confirmthe specificity of the PCR products, a melting curve wasobtained at the end of each run. Standard gel electrophoresiswas also performed to ensure the end product generated a sin-gle band with the predicted size (100–150 bases). Data werenormalized with the quantity of 18 S rRNA in individual sam-ples to correct for sample variability.Western Blotting—PAs frozen in liquid nitrogen were

crushed and homogenized using amortar and pestle and resus-pended in ice-cold lysis buffer containing 50 mM Tris-Cl (pH7.4), 150 mM NaCl, 1% deoxycholic acid, 0.1% SDS, 0.5% Non-idet P-40, and protease inhibitor mixture (Roche Applied Sci-ence). The homogenatewas centrifuged at 1000� g for 5min at4 °C, the supernatant was collected, and the protein concentra-tion was estimated using the BCA assay. 20 �g of proteinsamplewas resolved on an 8%SDS-polyacrylamide gel and elec-trotransferred onto a PVDF membrane (Millipore). The mem-brane was blocked with 5% (w/v) nonfat dry milk in PBS con-taining 0.02% Tween 20 for 1 h at room temperature, followedby overnight incubation at 4 °C with a specific primary anti-body. The primary antibodies were polyclonal rabbit anti-TPC1 (1:500 dilution) from Abcam (Cambridge, MA) andanti-TPC2 (1:2500 dilution) from Alomone Labs (Jerusalem,Israel). The actin level was also determined and used as a load-ing control. The membrane was washed and incubated withperoxidase-conjugated goat anti-rabbit secondary antibody(Bio-Rad) at 1:2500 dilution at room temperature for 1 h. Pro-tein bands were detected by enhanced chemiluminescence(Pierce) and imaged using a Gel Logic 200 image system(Kodak).Deglycosylationassayswereperformedonsomesamplesto verify the double bands detected by the anti-TPC1 and anti-TPC2 antibodies. Protein samples (10 �g) were incubated in theabsenceorpresenceofpeptide:N-glycosidaseF (NewEnglandBio-labs) according to the manufacturer’s instruction. Protein dena-turation was performed at 45 °C for 10 min, and enzyme incuba-tionwas carriedout at 37 °C for 1h. Protein sampleswere resolvedand analyzed by immunoblotting as described above.

Measurement of Global [Ca2�]i—[Ca2�]i was monitoredusing themembrane-permeableCa2�-sensitive fluorescent dyefluo 3-AM. PASMCs were loaded with 5–10 �M fluo 3-AM(dissolved inMe2SOwith 20%pluronic acid) for 45min at roomtemperature (�23 °C) in normal Tyrode’s solution containing137 mM NaCl, 5.4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM

HEPES, and 10mM glucose (pH 7.4 adjusted with NaOH). Cellswere then washed and rested for 15–30 min to allow completede-esterification of the cytosolic dye. fluo 3 was excited at 488nm, and emission light at�515 nmwas detected from cells in amicroscopic field using aNikonDiaphotmicroscope (objective,Fluor 40�/1.3 numerical aperture) equipped with a photomul-tiplier tube-based microfluorometer. Protocols were executedand data were collected on-line with a Digidata analog-to-dig-ital interface and a pCLAMP software package (Axon Instru-ments, Inc., Foster City, CA). [Ca2�]i was calibrated using theequation [Ca2�]i � KD�(F � Fbg)/(Fmax � F) (26), where KD is1.1 �M for fluo 3, Fbg is the background fluorescence, and Fmaxis the maximum fluorescence determined in situ in cells super-fused with 10 �M 4-bromo-A23187 after each experiment.Measurement of Local Ca2� Events—Ca2� events were visu-

alized using fluo 3-AM as described previously (25). Confocalimages were acquired using a Zeiss LSM 510 inverted confocalmicroscope with a Zeiss Plan-Neofluar 40�/1.3 oil immersionobjective. The confocal pinhole was set to render a spatial res-olution of 0.4 �m in the x-y axis and 1.7 �m in the z axis. fluo3-AM was excited by the 488 nm light of an argon laser, andfluorescence was measured at �505 nm. Images were acquiredin the line scan mode (digital zoom rendering a 38-�m scanline), scanning at 0.075 �m/pixel and 512 pixels/line at 2-msintervals. Photobleaching and laser damage to the cells wereminimized by attenuating the laser to �1% of its maximumpower (25milliwatts) with an acousto-optical tunable filter, andeach cell was imaged for �20 s. Images were processed andCa2� sparks were analyzed by custom-written algorithms usingthe IDL software package (27) or the SparkMaster plug-in ofImageJ software (28).Statistical Analysis—Data are expressed asmeans� S.E. Sta-

tistical significance (p � 0.05) of the changes was assessed bypaired or unpaired Student’s t tests, non-parametric Mann-Whitney U tests, or one- or two-way analysis of variance withTukey’s range test for post hoc analysis, wherever applicable.

RESULTS

Expression of TPC1 and TPC2 mRNAs and Proteins—Tostudy theNAADP-dependent Ca2� response, the expression ofthe NAADP channels TPC1 and TPC2 was first characterized

TABLE 1Primers for conventional and real-time RT-PCR experiments

GeneNCBI

accession no. Primer Sequence (5�–3�)Nucleotideposition

Predictedsize in bp

Rat tpc1 NM_139332.3 Sensea GTGCGAGTCACCCGCTGTCC 375–394 122Antisensea GGAAGCCCAGCCACCGCAAT 496–477Sense TCCCTGCGCTCAAGCTCCGA 392–411 309Antisense TGAAAGGCGGCAGCGACTGG 700–681

Rat tpc2 NM_001107566.1 Sensea GCCCCCTGTCGCTTTGGGAC 1487–1506 107Antisensea GGTGCTGGCTACCACAGCCG 1593–1574Sense TACTCCGGCCCGTGGTCGAT 1870–1889 262Antisense TGCACAGATGCAAGTGTGGATGC 2131–2109

a Primers used in real-time PCR.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

in sPAs, lPAs, and aortas using conventional RT-PCR. Fig. 1 (Aand B) shows the amplified PCR products generated after 35cycles from endothelium-denuded sPAs, lPAs, and aortas.TPC1 and TPC2 transcripts were detected in all three types ofvascular tissues. The PCR-amplified products had sizes corre-sponding to the predicted values (309 bp for TPC1 and 262 bpfor TPC2) and matched the predicted sequences. The relativeexpression of TPC1 and TPC2 was quantified by real-time RT-PCR. The TPC1 mRNA level was �4–5-fold higher than theTPC2 mRNA level in all three vascular tissues, with the valuesof individual samples normalized with 18 S rRNA. In addition,TPC1 and TPC2 mRNA expression in lPAs was the highest ofthe three vascular tissues, with the order lPAs� sPAs� aortas.TPC1 and TPC2 proteins in sPAs, lPAs, and aortas were

detected by immunoblotting (Fig. 1, C and D). Specific anti-TPC1 antibodies detected two clear bands at �100 and �75kDa; double bands were also detected at �75 and �60 kDausing anti-TPC2 antibody. The double bands were related toN-glycosylation of TPC1 and TPC2 proteins as previouslydescribed (6). Pretreatment of samples with peptide:N-glycosi-dase F to remove the N-glycan chains converted the blots to asingle band of �75 kDa for TPC1 and �60 kDa for TPC2. Thedisappearance of the higher molecular mass bands after pep-tide:N-glycosidase F treatment indicated that they were themature glycosylated proteins, whereas the lower bandswere thecore proteins. TPC1 and TPC2 protein levels were similar insPAs, lPAs, and aortas (TPC1, n � 7; and TPC2, n � 7), with�-actin used as the internal standard for normalization. Theseresults clearly show that the two types of NAADP-sensitiveCa2� channels are expressed in pulmonary arterial smoothmuscle.NAADP-induced Mobilization of Global Ca2� in PASMCs—

The presence of functional NAADP-sensitive Ca2� channels in

PASMCs was examined using the cell-permeant NAADP ana-log NAADP-AM (ISIS Innovation Ltd., Oxford, United King-dom). Application of NAADP-AM activated a concentration-dependent increase in [Ca2�]i (Fig. 2,A and B). NAADP-AM at0.25 and 0.5 �M elicited sustained increases in [Ca2�]i, whereas1 �M activated a biphasic response with an initial transient rise,followed by a sustained increase in [Ca2�]i. The 1 �MNAADP-AM-induced responsewas unaffected by exchangingCa2�-freesolution (with 1mM EGTA) 1min prior to NAADP application(Fig. 2, C and D). The peak and sustained Ca2� responses were216� 13 and 91� 6 nM (n� 5), respectively, in the presence ofCa2� and 185 � 86 and 86 � 16 nM (n � 5), respectively, in theabsence of extracellular Ca2�. These results indicate that theNAADP-induced Ca2� response is solely dependent on Ca2�

mobilization from intracellular Ca2� stores.There is substantial evidence suggesting that NAADP-sensi-

tive channels are expressed mainly in the acidic endolysosomalorganelles (29, 30). To examine the importance of endolyso-somal Ca2� stores in the NAADP-activated Ca2� response,acidic Ca2� stores were depleted by inhibiting the vacuolarH�-ATPase to disrupt the lysosomal H� gradient for Ca2�

entry via Ca2�/H� exchange. Preincubation of PASMCs for 1 hwith bafilomycin A1 (3 �M), a specific vacuolar H�-ATPaseinhibitor (31), significantly inhibited the peak and completelyabolished the sustained phase of theCa2� response activated byNAADP-AM (1 �M) (Fig. 3A). The peak Ca2� response was164 � 15 nM (n � 5) in the control PASMCs and 50 � 11 nM(n � 5; p � 0.05) in the bafilomycin A1-pretreated PASMCs(Fig. 3B). The specificity of the NAADP-AM-induced Ca2�

responses was further verified using the selective NAADPreceptor antagonist Ned-19 (Enzo Life Sciences, Ann Arbor,MI) (Fig. 3, C and D) (32). Pretreatment of PASMCs withNed-19 (1 �M) for 20 min eliminated the initial transient peak

FIGURE 1. Expression of TPC1 and TPC2 mRNAs and proteins in rat PAs and aortas. A and B, conventional (upper panels) and real-time (lower panels) RT-PCRquantification of TPC1 and TPC2 mRNAs in endothelium-denuded sPAs, intralobar lPAs, and aortas. Values were normalized to those of 18 S rRNA and wereaveraged from five rats for each channel subtype. C and D, Western blot analysis of TPC1 and TPC2 proteins. The upper panels show TPC protein bands resolvedfrom lPA samples with (�) and without (�) incubation with peptide:N-glycosidase F (PNGase). Deglycosylation of TPC1 or TPC2 protein with peptide:N-glycosidase F reduced the double band signals to a single band (upper panels). The middle panels show representative blots of TPC1 and TPC2 proteins insamples of sPAs, lPAs, and aortas. The lower panels show averaged values measured from samples of five rats for TPC1 and seven rats for TPC2.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

and significantly reduced the sustained phase of the NAADP-AM-activated Ca2� response (control, 97 � 12 nM (n � 6), andNed-19, 52 � 4 nM (n � 6); p � 0.01). The NAADP-AM-acti-vated Ca2� response was completely abolished by furtherincreasing the concentration of Ned-19 to 100 �M. The signif-icant inhibition of the Ca2� response by bafilomycin A1 andNed-19 indicates that NAADP-AM mobilizes Ca2� mainlythrough the activation of specific NAADP receptors of theacidic endolysosomal organelles in PASMCs.Previous studies in other cell types suggest that NAADP-

induced Ca2� release is amplified by cross-activation ofInsP3Rs andRyRs (20, 33). To examine the possible interactionsbetween NAADP-induced Ca2� signals and the InsP3R- andRyR-gated Ca2� stores, InsP3R- and RyR-dependent Ca2�

release were either blocked separately using xestospongin Cand ryanodine, respectively, or disabled simultaneously usingthe SERCA (sarco/endoplasmic reticulum Ca2�-ATPase)inhibitor thapsigargin. A 15-min pretreatment of PASMCswith 10�MxestosponginChad no significant effect on the peakand sustained Ca2� responses activated by NAADP-AM (Fig.4A), suggesting that InsP3R does not contribute toNAADP-de-pendent Ca2� release in PASMCs. In contrast, inhibition ofRyR with 50 �M ryanodine caused a significant reduction in theinitial transient Ca2� release (control, 244� 31 nM (n� 6), andryanodine, 151� 15 nM (n� 7); p� 0.05) but did not affect thesustained phase of the Ca2� response (Fig. 4B). Similar to RyRinhibition, depletion of the SR Ca2� store with thapsigargin (10

FIGURE 2. NAADP-AM-induced concentration-dependent Ca2� responsein PASMCs. A, mean traces showing the change in [Ca2�]i ([Ca2�]i) evokedby different concentrations of NAADP-AM. B, mean values of peak [Ca2�]iactivated by 0.25, 0.50, and 1.00 �M NAADP-AM. Values are mean data fromsix experiments for each concentration. *, significantly different (p � 0.05)from the control; #, significantly different between 0.50 and 1.00 �M. C, meantraces of Ca2� transients activated by 1 �M NAADP-AM in the absence andpresence of extracellular Ca2�. D, mean values of the peak and sustainedincreases in [Ca2�]i activated by NAADP-AM (n � 5 for each condition). Valuesof the sustained response were measured at 500 s.

FIGURE 3. Effects of bafilomycin A1 and Ned-19 on Ca2� release induced by NAADP-AM in PASMCs. A, averaged Ca2� transients activated by 1 �M

NAADP-AM with or without preincubation with the vacuolar H�-ATPase inhibitor bafilomycin A1 (3 �M) for 1 h. B, mean values of the peak and sustainedincreases in [Ca2�]i activated by 1 �M NAADP-AM in the absence and presence of bafilomycin A1 (n � 5). C, mean Ca2� transients activated by 1 �M NAADP-AMin the absence and presence of the NAADP antagonist Ned-19 (1 and 100 �M; 25-min incubation). D, mean values of the peak and sustained increases in [Ca2�]iactivated by 1 �M NAADP-AM in PASMCs with or without pretreatment with Ned-19 (n � six experiments for each group). *, significantly different comparedwith the control.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�M) also attenuated the peak Ca2� response (control, 278 � 33nM (n � 5), and ryanodine, 116 � 17 nM (n � 6); p � 0.05),whereas the sustained Ca2� increase elicited by NAADP-AMwas unaltered (Fig. 4C). These results suggest that the initialtransient increase in [Ca2�]i was mediated by the cross-activa-tion of RyRs on the SR and that the sustained Ca2� responsecame from the NAADP-sensitive Ca2� stores independent ofSR Ca2� release.NAADP-induced Local Ca2� Events in PASMCs—Local

Ca2� signals were further examined at the subcellular levelusing confocal Ca2� fluorescence microscopy in the line scanmode. Application of NAADP-AM to quiescent PASMCs acti-vated robust local and global Ca2� events. The Ca2� responsewas heterogeneous, usually led by a diffuse increase in basal[Ca2�]i, followed by an upsurge of Ca2� sparks, which fused to

generate a global increase in [Ca2�]i, where Ca2� sparks wereno longer discernible (Fig. 5A,upper andmiddle panels). Repet-itive local Ca2� events were observed in some subcellular sites,and large repetitive non-inactivating Ca2� bursts were alsooccasionally observed (Fig. 5A, lower panel). These Ca2� burstshad a higher amplitude, a larger spatial spread, and a muchlonger duration compared with Ca2� sparks (Fig. 6, A and B).However, they were not always associated with a regenerativeglobal release. In 23 cells, NAADP-AM(0.5�M) caused an aver-age increase in the frequency of discernible sparks (excludingclusters) from 1.01 � 0.26 to 2.81 � 0.39 sparks/100 �m/s andan increase in global Ca2� fluorescence of 0.99 � 0.17 (F/F0)at the end of a 20-s recording. Consistent with observations inglobal Ca2� transients, the NAADP-induced Ca2� sparks andregenerative global Ca2� release were significantly suppressed

FIGURE 4. Inhibition of SR Ca2� stores upon Ca2� release induced by NAADP-AM in PASMCs. A and B, mean traces of Ca2� transients and mean values ofCa2� responses activated by 1 �M NAADP-AM in PASMCs with (n � 6) or without (n � 7) pretreatment with xestospongin C (10 �M) for 15 min. C and D, meantraces of Ca2� transients and mean values of Ca2� responses activated by 1 �M NAADP-AM in PASMCs with (n � 6) or without (n � 7) pretreatment withryanodine (50 �M) for 20 min. E and F, mean traces of Ca2� transients and mean values of Ca2� responses activated by 1 �M NAADP-AM in PASMCs with (n �5) or without (n � 5) pretreatment with thapsigargin (10 �M) for 30 min. *, significantly different compared with the control.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

by 50 �M ryanodine (spark frequency of 0.68 � 0.14 sparks/100�m/s (n � 22 cells), p � 0.05; F/F0 � 0.45 � 0.13, p � 0.05)(Fig. 7), indicating that the RyR-gated Ca2� stores contributedsignificantly to both the local and global Ca2� signals. However,the diffuse increase in basal [Ca2�]i and Ca2� bursts persistedin ryanodine-treated PASMCs (Fig. 7A,middle and lower pan-

els), suggesting that theywereCa2� signals originating from theTPCs.The spatiotemporal characteristics of local Ca2� events acti-

vated by NAADP-AM were further examined under steady-state conditions in a separate set of experiments in which Ca2�

sparks were recorded in either the absence or continuouspresence of 1 �M NAADP-AM. The spark frequency was sig-nificantly higher in PASMCs continuously exposed toNAADP-AM compared with the control cells (control, 0.56 �0.08 sparks/100 �m/s (n � 71 cells), and NAADP, 2.18 � 0.24sparks/100 �m/s (n � 58 cells); p � 0.001). However, the sparkamplitude (F/F0; control, 0.58 � 0.01 (n � 436), and NAADP,0.61� 0.02 (n� 438)), full duration at half-maximum (control,59.9 � 4.3 ms (n � 436), and NAADP, 46.0 � 2.68 ms (n �438)), and the spatial spread or full-width at half-maximum(control, 1.76� 0.14�m(n� 436), andNAADP, 1.5� 0.04�m(n � 438)) were not significantly different between the controland NAADP-AM-treated cells (Fig. 8). Hence, the spatiotem-poral properties of local Ca2� events activated byNAADPwereindistinguishable from spontaneous Ca2� sparks recordedunder resting conditions. Our results therefore suggest thatNAADP-dependent Ca2� signaling in PASMCs consists of het-erogeneous Ca2� events, some of which are mediated by directactivation of NAADP receptors and others by cross-activationof RyRs.NAADP-dependent Agonist-induced Ca2� Response in

PASMCs—To further examine the contribution of NAADP tothe agonist-induced response, we compared the effects ofNAADP receptor, RyR, and InsP3R antagonists on the ET-1-inducedCa2� response. ET-1 (10 nM) activated a biphasic Ca2�

response in PASMCs (peak [Ca2�]i � 265 � 55 nM and sus-

FIGURE 5. Activation of local Ca2� events by NAADP-AM in PASMCs. A, representative confocal line scan images from three different cells showing local andglobal Ca2� events elicited by NAADP-AM (0.5 �M). The upper and lower panels show the progressive increase in cytosolic [Ca2�], spark frequency, localizedCa2� bursts, and global Ca2� release. The lower panel illustrates a solitary Ca2� burst that was not associated with global Ca2� release. Blue circles denote thepositions of discernible local Ca2� events, red bars denote repetitive burst, and yellow bars indicate diffuse increases in cytosolic [Ca2�]. B, a combined figureshowing the spark frequency (number of sparks/100 �m/cell) distribution and the averaged global Ca2� transient (F/F0; red line and symbols) generated from23 different cells. The asterisk indicates the value is significantly lower (p � 0.05) than that of NAADP alone.

FIGURE 6. Ca2� sparks and Ca2� bursts activated by NAADP-AM inPASMCs. A, the upper panel is a surface plot of Ca2� fluorescence immedi-ately after the addition of NAADP-AM showing Ca2� sparks originating fromtwo separate sites (marked 1 and 2) and the diffuse increase in cytosolic[Ca2�]. The lower panel shows the time course of F/F0 recorded at sites 1 and2 and the mean F/F0 across the image. B, the upper panel is a surface plot ofa Ca2� burst activated by NAADP in a different cell. The lower panel shows thetime course of F/F0 recorded at site 3.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tained [Ca2�]i � 120 � 16 nM, n � 8). Pretreatment ofPASMCs with various concentrations of Ned-19 (0.01–1 �M)inhibited the peak Ca2� response in a concentration-depen-dentmannerwithout altering the sustainedCa2� response (Fig.9,A and B), suggesting that the peak Ca2� response is mediatedby a NAADP-dependent mechanism. Consistent with cross-activation of RyRs by Ca2� signals from NAADP-sensitivechannels, the peak Ca2� response activated by ET-1 was signif-icantly reduced by ryanodine (50 �M), and the remaining peakCa2� response was further inhibited by 1 �M Ned-19 (Fig. 9, CandD). It is well established in VSMCs that ET-1 binds to ET-Areceptors, leading to activation of phospholipaseC and produc-tion of InsP3 to activate Ca2� release. Inhibition of InsP3R with10 �M xestospongin C almost completely abolished the peakCa2� response of ET-1. The addition of Ned-19 did not furtherreduce the Ca2� signal (Fig. 9, E and F). These results suggestthat both functional NAADP receptors and InsP3Rs arerequired for Ca2� release triggered by ET-1. In contrast, thesustained Ca2� response of ET-1 was mediated primarily byextracellular Ca2� influx, which was unaffected by Ned-19,ryanodine, or xestospongin C (Fig. 9, B,D, and F) but was com-pletely abolished by removing extracellular Ca2� 100 s prior tothe application of ET-1 (Fig. 10, A and B). Removal of extracel-lular Ca2� did not affect the ET-1-induced peakCa2� response.

The specificity of Ned-19 was further verified by examiningits effect on voltage-gated Ca2� entry, store-operated Ca2�

entry (SOCE), and RyR- and InsP3R-dependent Ca2� release inPASMCs. Application of 60 mM KCl caused a significantincrease in [Ca2�]i through the activation of voltage-gatedCa2� channels by membrane depolarization. The Ca2�

response was unchanged in PASMCs treated with Ned-19 (10�M) for 20 min (control, 89 � 19 nM (n � 6), and Ned-19, 69 �19 nM (n � 7)) (Fig. 10C). SOCE was evaluated by reintroduc-tion of extracellular Ca2� to PASMCs after SRCa2� storesweredepleted with thapsigargin (10 �M) for 20min in the absence of

Ca2� (34). The peak values of SOCE elicited in control andNed-19 (10�M)-treated cellswere essentially the same (control,229 � 36 nM (n � 9), and Ned-19, 289 � 59 nM (n � 9)) (Fig.10D). The amplitudes of Ca2� release activated by rapid appli-cation of caffeine (10 mM) were identical in the absence andpresence of 10�MNed-19 (control, 1104� 167 nM (n� 7), andNed-19, 996 � 120 nM (n � 7)( (Fig. 10E), indicating that RyR-gated Ca2� release was unaltered. Moreover, Ca2� release acti-vated by a membrane-permeant InsP3 analog, 2,3,6-tri-O-bu-tyryl-myo-inositol 1,4,5-triphosphate hexakis(acetoxymethyl)ester (Bt3-InsP3/AM; 20 �M; AG Scientific, Inc., San Diego,CA), was unaffected after a 20-min pretreatment with 10 �M

Ned-19 (control, 119 � 17 �M (n � 9), and Ned-19, 113 � 20�M (n � 8)) (Fig. 10F). These results confirm that Ned-19 is ahighly specific NAADP antagonist and support our findingsthat the NAADP-dependent Ca2� signaling pathway contrib-utes significantly to the ET-1-induced Ca2� response inPASMCs.

DISCUSSION

Recent studies have demonstrated that TPCs are the endoly-sosomal NAADP-sensitive channels, and they are widelyexpressed in major organs, including the brain, heart, kidney,liver, lung, intestine, spleen, thymus, ovary, and testis (6, 8).Here, we detected themRNAs and proteins of TPC1 and TPC2in endothelium-denuded rat sPAs, lPAs, and aortas. Prelimi-nary screening also showed TPC1 and TPC2 expression in ratmesenteric, cerebral, and tail arteries (data not shown), sug-gesting that TPCs are expressed ubiquitously in VSMCs andmay play essential roles in vascular functions. Quantitative RT-PCR data showed that the level of the TPC1 transcript is sever-alfold higher compared with TPC2 in PAs and aortas, indicat-ing that TPC1 is the major endogenous NAADP channel inPASMCs. This is congruent with the observation that TPC1 isthe predominant TPC subtype expressed in native human

FIGURE 7. Activation of local Ca2� events by NAADP-AM in ryanodine-treated PASMCs. A, representative confocal line scan images from three differentcells. The upper and lower panels show the suppression of NAADP-induced Ca2� sparks in the presence of ryanodine. The lower panel shows the occurrence ofrepetitive Ca2� events in a single site, leading to a burst in a ryanodine-treated cell. B, a combined figure showing the spark frequency (number of sparks/100�m/cell) distribution and the averaged global Ca2� transient (F/F0; red line and symbols) generated from 22 different cells. C, bar graph showing the averagedspark frequency recorded after the application of NAADP in PASMCs with (n � 22) or without (n � 23) pretreatment with ryanodine. D, bar graph showing theaveraged global F/F0 recorded in PASMCs with (n � 22) or without (n � 23) pretreatment with ryanodine at the end of the line scan image (20 s).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

endothelial cells (35) and rat PC12 cells (7), as well as in thehuman cell lines SKBR3 and HEK293 (7, 12). TPC1 alsoaccounts for most of the NAADP-induced Ca2� response inSKBR3 and HEK293 cells (7, 12). In this study, both N-glyco-sylated and non-glycosylated TPC1 and TPC2 were found innative PASMCs. This is similar to heterologously expressedTPCs in several cell lines (6, 8, 36, 37). The different N-glyco-sylated forms of TPCsmay reflect different stages of post-trans-lational processing, but they could also be related to theregulation of TPC functions. It has been shown that the N-glycosylation sites of TPCs are located luminally, close to thepore-forming region in domain II (6, 37). Removal of N-glyco-sylation residues of TPC1 had no effect on its subcellular local-ization but greatly enhanced the NAADP-induced Ca2�

response (37). Because TPC1 is expressed in all stages ofendolysosomes (including the recycling endosomes, early andlate endosomes, and lysosomes) and TPC2 is confined more to

the late endosomes and lysosomes (6–10), the different glyco-sylated forms of TPCs in PASMCs may be related to specifictypes of endolysosomal organelles, which have different lumi-nal environments, such as pH and [Ca2�].Cell-permeable NAADP-AM activates a robust biphasic

global Ca2� response in PASMCs. Both the initial transient andsustained components of the NAADP-induced Ca2� responsewere independent of extracellular Ca2� but were inhibited bydepleting Ca2� in acidic organelles with bafilomycin A1 orusing the specific NAADP antagonist Ned-19. This is consist-ent with endolysosomal Ca2� release via TPCs (11, 17, 18, 21,32). The initial component of theCa2� response is due to cross-activation of RyRs because it could be blocked by ryanodine andthapsigargin but not by xestospongin C. This supports theassertion that the NAADP-mediated Ca2� signal is amplifiedby Ca2�-induced Ca2� release in PASMCs (20–22). However,the presence of a prominent sustained component of the thap-

FIGURE 8. Frequency distribution of spatiotemporal properties of Ca2� sparks recorded under steady-state conditions in the absence and presence ofNAADP-AM (1 �M). The number of events is expressed as a function of amplitude (F/F0) (A and B), duration (full duration at half-maximum (FDHM)) (C and D),and spatial spread (full-width at half-maximum (FWHM)) (E and F). The control group consisted of 424 sparks recorded from 71 cells, and the NAADP groupconsisted of 434 sparks recorded from 58 cells. The box plots show the median and range of each parameter.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

sigargin-insensitive but bafilomycin-sensitive Ca2� releaseclearly suggests that endolysosomes are capable of generatingsizable Ca2� signals independent of SR Ca2� release. TheNAADP-mediated sustained Ca2� release corresponds nicelywith the sustained bafilomycin-sensitive Ca2� transient acti-vated by the integrin ligand GRGDSP peptide reported previ-ously in PASMCs (23).The heterogeneous local Ca2� events activated by NAADP

provide a close-up glimpse of the dynamic interactions of theNAADP-dependent Ca2� signaling pathways. At least four dis-tinctive Ca2� events, namely the small diffuse rise in cytosolic[Ca2�], the spatially discernible Ca2� sparks, the repetitivelarge localized Ca2� bursts, and the regenerative Ca2� releases,have been identified. The small diffuse increase in [Ca2�] acti-vated by NAADP is the initial Ca2� release directly fromNAADP channels because it is insensitive to ryanodine andusually precedes the other Ca2� events. The diffuse nature of

the Ca2� signal suggests that it arises from asynchronous TPCsand/or from Ca2� stores with a low Ca2� capacity. It has beenshown that spatially discernible Ca2� events, such as Ca2�

sparks, require concerted activation of multiple RyRs (38),whereas Ca2� signals from individual RyRs (Ca2� quarks) aresubmicroscopic (39, 40). Because the single channel conduct-ance of TPCs (�15 picosiemens) (11) is significantly smallerthan that of RyRs (�120 picosiemens) (41) and the Ca2� con-tent of endosomes and early lysosomes is lower than in the SR,Ca2� release via individual asynchronous TPCs from endo-somes is unlikely to be resolved by confocal imaging. NAADPalso activates discernible local Ca2� events, which are sensitiveto ryanodine and have spatiotemporal properties indistinguish-able from spontaneousCa2� sparks (25, 27, 42, 43). The gradualincrease in spark frequency during the slow initial rise in cyto-solic [Ca2�] could be related to an increase in SR Ca2� loadingas the result of continuous uptake of Ca2� released from the

FIGURE 9. Effects of the NAADP antagonist Ned-19, ryanodine, and xestospongin C on ET-1-induced Ca2� response in PASMCs. A and B, mean traces andmean values of peak and sustained Ca2� responses activated by ET-1 (10 nM) in the presence of various concentrations of Ned-19. The sustained Ca2� responseis the averaged value between 700 and 800 s. There were six to nine experiments in each group. C and D, mean traces and mean values of Ca2� responsesactivated by ET-1 (10 nM) in the absence and presence of 50 �M ryanodine (Ryan; red trace) alone or with 1 �M Ned-19 (green trace). There were eightexperiments in each group. E and F, mean traces and mean values of Ca2� responses activated by ET-1 (10 nM) in the absence and presence of 10 �M

xestospongin C (Xes; red trace) alone or with 1 �M Ned-19 (green trace). There were six to eight experiments in each group. *, significantly different (p � 0.05)from control cells.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

acidic stores. This scenario has been demonstrated in guineapig ventricular and atrial myocytes (44, 45).Previous studies using conventional Ca2� fluorescence

microscopy showed that intracellular dialysis of NAADP intoPASMCs activated bursts of Ca2� release over a sizable regionclose to the perimeter of the cell (20–22). These Ca2� burstseither stopped or eventually triggered global Ca2� waves thatcould be blocked by ryanodine or thapsigargin. It was later pro-posed that lysosomes localized around the nucleus are closelyassociated with the perinuclear SR, where NAADP-sensitivechannels and RyR3 form a highly organized trigger zone forNAADP-mediated Ca2� signaling (21, 22). In this study, weobserved repetitive localized Ca2� bursts activated by NAADP.These Ca2� bursts were insensitive to ryanodine, thus unre-lated to cross-activation of RyRs. However, the spatiotemporalprofile of these Ca2� bursts is similar to the non-inactivationCa2� events we reported previously in the perinuclear regionsof PASMCs (42), where lysosomes are abundant (21–23). Therobust Ca2� signal of these bursts suggests that a large numberof NAADP channels are being activated simultaneously andthat the Ca2� content of the store is high. Because the Ca2�

content of mature lysosomes is the highest among endolyso-somal organelles (46) and TPC2 is preferentially expressed inlysosomes (8), it is possible that Ca2� bursts are Ca2� signalscoming primarily fromTPC2 (and TPC1) of mature lysosomes.However, it is unclear how multiple TPCs are coordinated togenerate repetitive Ca2� bursts. There is no information onCa2�-induced activation of TPCs as in the case of RyRs, besidesevidence for TPC regulation by voltage, luminal pH, and Ca2�

(11, 12). The diffuse increase in cytosolic [Ca2�], Ca2� sparks,and Ca2� bursts activated by NAADP generally triggeredregenerative global Ca2� release, which could be abolished byryanodine. However, the occurrence of Ca2� bursts was not

always associated with regenerative Ca2� release. In fact, soli-tary Ca2� bursts were frequently observed (Fig. 5A,middle andlower panels). This suggests that even thoughNAADP-inducedCa2� signals are amplified by RyRs, the coupling between lyso-somes and SR Ca2� stores in PASMCs is loose, for example,compared with the coupling of L-type Ca2� channels and RyRsin cardiacmyocytes (47, 48) and the coupling of RyRs andCa2�-activated K� channels in cerebral arteries (49, 50).Previous studies in systemic and pulmonary arteries sug-

gested significant contributions ofNAADPand lysosomalCa2�

stores to the agonist-induced Ca2� response (17, 18, 21, 23).This notion is supported by our finding that Ned-19 inhibitsdose-dependently the initial transient phase of the ET-1-in-ducedCa2� response. trans-Ned-19 is a highly specificNAADPantagonist. It inhibits NAADP-mediated Ca2� release with anIC50 of 10–70nM (32, 51) and completely antagonizes the singlechannel activity of TPC2 at 1 �M (11), but it does not affectInsP3- or cADPR-induced Ca2� release at concentrations up to100 �M (32, 51). Ned-19 at 10 �M also has no apparent effect onCa2� influx through voltage-gated Ca2� channels activated byKCl, SOCE induced by thapsigargin, RyR-gated Ca2� releasetriggered by caffeine, or Ca2� release activated by Bt3-InsP3/AM in PASMCs. Complete inhibition of the transientCa2� response by a low concentration of Ned-19 (1 �M) there-fore indicates that NAADP is a major mechanism for ET-1-induced Ca2� release.In contrast to the biphasic Ca2� response activated by

NAADP-AM, endogenous NAADP generated by ET-1 stimu-lation contributes predominantly to the initial peak Ca2�

response. The sustained phase of the ET-1-induced responseis supported solely by extracellular Ca2� influx because it isinsensitive to Ned-19, ryanodine, and xestospongin C but iscompletely abolished by the removal of extracellular Ca2�. The

FIGURE 10. A and B, effect of removing extracellular Ca2� on the ET-1-induced Ca2� response in PASMCs. Shown are the mean traces and mean values of peakand sustained Ca2� responses activated by ET-1 (10 nM) in 2 mM Ca2�-containing solution or in Ca2�-free solution (with 1 mM EGTA) (n � eight experiments foreach group), which was added 100 s prior to the application of ET-1. C, mean peak of the change in the Ca2� response elicited by 60 mM KCl in the absence (n �6) and presence (n � 7) of 10 �M Ned-19. D, mean peak of the change in SOCE elicited by readmission of extracellular Ca2� (2 mM) to PASMCs exposed to 10 �M

thapsigargin for 20 min under Ca2�-free conditions in the absence (n � 9) and presence (n � 9) of 10 �M Ned-19. E, mean peak of the change in the Ca2�

response elicited by rapid application of 10 mM caffeine in the absence (n � 7) and presence (n � 7) of 10 �M Ned-19. F, mean peak of the change in [Ca2�]ielicited by Bt3-InsP3/AM (20 �M) in the absence (n � 9) and presence (n � 8) of 10 �M Ned-19. The asterisk indicates significant difference from 2 mM Ca2�.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

transient nature of NAADP-dependent Ca2� release could berelated to the kinetics of ET-1-induced CD38 activation, pro-duction, and metabolism of NAADP, as well as desensitizationof ET-1 receptors and inactivation ofNAADPchannels (52, 53),such that endogenously produced NAADP is no longer avail-able or effective after prolonged ET-1 exposure. It is interestingthat the initial Ca2� release activated by ET-1 requires all threeCa2� stores. The interdependence of RyR- and NAADP-gatedCa2� stores is consistent with cross-activation of RyRs by Ca2�

released fromNAADP channels, as demonstrated by the earlierNAADP-AM experiments. However, the complete inhibitionof the peak Ca2� response by xestospongin C suggests thatInsP3R also plays a permissive role in ET-1-induced Ca2�

release. Interactions between the three types of Ca2� stores arevery complex. First, InsP3Rs are Ca2�-sensitive. They can beactivated by Ca2�-induced Ca2� release, and this process ismodulated by InsP3 binding (54). It has been shown in othercells that NAADP-mediated Ca2� signals can be amplified bytriggering further Ca2� release from InsP3Rs by Ca2� primingof the SR (8, 10, 33, 55, 56). We have demonstrated previouslythat Ca2� release from the InsP3R can cross-activate RyRs inPASMCs (27), in a manner similar to NAADP and RyRsobserved in this study. Furthermore, recent evidence obtainedwithHEK cells shows that lysosomes are closely associatedwiththe InsP3-gated SR, and they can selectively sequester releasedCa2� from InsP3Rs (57). This process may facilitate lysosomalCa2� loading for subsequent release. All of these mechanismsmay be operating in PASMCs during agonist stimulation whenInsP3Rs are sensitized by an increased level of InsP3 and mayallow InsP3Rs to play a much larger role in the integrated Ca2�

release process compared with Ca2� release activated byNAADP-AM alone. However, it is unclear whether InsP3 orNAADP is the primary trigger for the integrated Ca2�

release event. The intricate interactions between these inter-dependent Ca2� stores during agonist stimulation requirefurther investigations.It is also interesting that exogenously applied NAADP-AM

activates a sustained component of Ca2� release. The fact thatthe sustained response is not associated with RyR-mediatedCa2� release and is relatively insensitive to Ned-19 suggeststhat these NAADP-sensitive stores are not coupled to RyRs.They are perhaps gated by NAADP channels with propertiesdifferent from those activated by ET-1. This group of NAADP-sensitive stores could be endo/lysosomes gated by TPC1 ormaybe even gated by channels other than TPCs. It has beensuggested that the transient receptor potential channelTRPML1 is a NAADP-sensitive lysosomal Ca2� release chan-nel (58–60), but its role as a NAADP-sensitive channel is cur-rently under dispute (61). Nevertheless, this group of NAADP-sensitive stores may participate in other signaling pathwaysserving different cellular functions. In fact, NAADP-dependentsignaling is involved in many endolysosomal functions, such asregulation of lysosomal pH, endocytosis, lipid transport andstorage, and autophagy (46, 56, 62), in addition to contributionsto vascular reactivity.In conclusion, we have characterized the expression of TPCs

and the global and local Ca2� signals mediated by NAADP inPASMCs. We found that TPC1, which is widely expressed in

endosomes and lysosomes, is the major NAADP channel inPASMCs.Moreover,NAADP-induced subcellularCa2� signalsare heterogeneous, reflecting Ca2� release from differentendolysosomal organelles cross-activating loosely coupledRyRs of the SR. NAADP also plays a crucial role in the agonist-stimulated Ca2� release response through complex interac-tions with RyRs and InsP3Rs. Depending on the physiologicalstimuli and conditions, these heterogeneous NAADP-medi-ated Ca2� signals serve to regulate different endolysosomalfunctions in PASMCs.

Acknowledgment—We thank Dr. Grant Churchill for supplyingNAADP-AM.

REFERENCES1. Berridge, M. J., Bootman, M. D., and Roderick, H. L. (2003) Calcium sig-

nalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol.4, 517–529

2. Clapper, D. L., Walseth, T. F., Dargie, P. J., and Lee, H. C. (1987) Pyridinenucleotide metabolites stimulate calcium release from sea urchin egg mi-crosomes desensitized to inositol trisphosphate. J. Biol. Chem. 262,9561–9568

3. Guse, A. H., and Lee, H. C. (2008) NAADP: a universal Ca2� trigger. Sci.Signal. 1, re10

4. Churchill, G. C., Okada, Y., Thomas, J. M., Genazzani, A. A., Patel, S., andGalione, A. (2002) NAADP mobilizes Ca2� from reserve granules, lyso-some-related organelles, in sea urchin eggs. Cell 111, 703–708

5. Lee, H. C., and Aarhus, R. (1995) A derivative of NADPmobilizes calciumstores insensitive to inositol trisphosphate and cyclic ADP-ribose. J. Biol.Chem. 270, 2152–2157

6. Zong, X., Schieder, M., Cuny, H., Fenske, S., Gruner, C., Rötzer, K., Gries-beck, O., Harz, H., Biel, M., and Wahl-Schott, C. (2009) The two-porechannel TPCN2 mediates NAADP-dependent Ca2�-release from lyso-somal stores. Pflugers Arch. 458, 891–899

7. Brailoiu, E., Churamani, D., Cai, X., Schrlau,M.G., Brailoiu, G. C., Gao, X.,Hooper, R., Boulware, M. J., Dun, N. J., Marchant, J. S., and Patel, S. (2009)Essential requirement for two-pore channel 1 in NAADP-mediated cal-cium signaling. J. Cell Biol. 186, 201–209

8. Calcraft, P. J., Ruas, M., Pan, Z., Cheng, X., Arredouani, A., Hao, X., Tang,J., Rietdorf, K., Teboul, L., Chuang, K. T., Lin, P., Xiao, R., Wang, C., Zhu,Y., Lin, Y.,Wyatt, C.N., Parrington, J.,Ma, J., Evans, A.M.,Galione,A., andZhu, M. X. (2009) NAADP mobilizes calcium from acidic organellesthrough two-pore channels. Nature 459, 596–600

9. Lin-Moshier, Y., Walseth, T. F., Churamani, D., Davidson, S. M., Slama,J. T., Hooper, R., Brailoiu, E., Patel, S., and Marchant, J. S. (2012) Photoaf-finity labeling of nicotinic acid adenine dinucleotide phosphate (NAADP)targets in mammalian cells. J. Biol. Chem. 287, 2296–2307

10. Ruas, M., Rietdorf, K., Arredouani, A., Davis, L. C., Lloyd-Evans, E., Koe-gel, H., Funnell, T.M.,Morgan, A. J.,Ward, J. A.,Watanabe, K., Cheng, X.,Churchill, G. C., Zhu,M. X., Platt, F. M.,Wessel, G.M., Parrington, J., andGalione, A. (2010) Purified TPC isoforms form NAADP receptors withdistinct roles for Ca2� signaling and endolysosomal trafficking.Curr. Biol.20, 703–709

11. Pitt, S. J., Funnell, T. M., Sitsapesan,M., Venturi, E., Rietdorf, K., Ruas, M.,Ganesan, A., Gosain, R., Churchill, G. C., Zhu, M. X., Parrington, J.,Galione, A., and Sitsapesan, R. (2010) TPC2 is a novel NAADP-sensitiveCa2� release channel, operating as a dual sensor of luminal pH and Ca2�.J. Biol. Chem. 285, 35039–35046

12. Rybalchenko, V., Ahuja, M., Coblentz, J., Churamani, D., Patel, S., Kise-lyov, K., and Muallem, S. (2012) Membrane potential regulates nicotinicacid adenine dinucleotide phosphate (NAADP) dependence of the pH-andCa2�-sensitive organellar two-pore channel TPC1. J. Biol. Chem. 287,20407–20416

13. Tugba Durlu-Kandilci, N., Ruas, M., Chuang, K. T., Brading, A., Par-rington, J., and Galione, A. (2010) TPC2 proteins mediate nicotinic acid




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

adenine dinucleotide phosphate (NAADP)- and agonist-evoked contrac-tions of smooth muscle. J. Biol. Chem. 285, 24925–24932

14. Aley, P. K.,Mikolajczyk, A.M.,Munz, B., Churchill, G. C., Galione, A., andBerger, F. (2010) Nicotinic acid adenine dinucleotide phosphate regulatesskeletal muscle differentiation via action at two-pore channels. Proc. Natl.Acad. Sci. U.S.A. 107, 19927–19932

15. Yusufi, A. N., Cheng, J., Thompson, M. A., Burnett, J. C., and Grande, J. P.(2002) Differential mechanisms of Ca2� release from vascular smoothmuscle cell microsomes. Exp. Biol. Med. 227, 36–44

16. Yusufi, A. N., Cheng, J., Thompson, M. A., Chini, E. N., and Grande, J. P.(2001) Nicotinic acid adenine dinucleotide phosphate (NAADP) elicitsspecific microsomal Ca2� release frommammalian cells. Biochem. J. 353,531–536

17. Zhang, F., Zhang, G., Zhang, A. Y., Koeberl, M. J., Wallander, E., and Li,P. L. (2006) Production of NAADP and its role in Ca2� mobilization as-sociated with lysosomes in coronary arterial myocytes. Am. J. Physiol.Heart Circ. Physiol. 291, H274–H282

18. Thai, T. L., Churchill, G. C., and Arendshorst,W. J. (2009) NAADP recep-tors mediate calcium signaling stimulated by endothelin-1 and norepi-nephrine in renal afferent arterioles. Am. J. Physiol. Renal Physiol. 297,F510–F516

19. Zhang, F., Xia, M., and Li, P. L. (2010) Lysosome-dependent Ca2� releaseresponse to Fas activation in coronary arterial myocytes throughNAADP:evidence from CD38 gene knockouts. Am. J. Physiol. Cell Physiol. 298,C1209–C1216

20. Boittin, F. X., Galione, A., and Evans, A. M. (2002) Nicotinic acid adeninedinucleotide phosphate mediates Ca2� signals and contraction in arterialsmooth muscle via a two-pool mechanism. Circ. Res. 91, 1168–1175

21. Kinnear, N. P., Boittin, F. X., Thomas, J. M., Galione, A., and Evans, A. M.(2004) Lysosome-sarcoplasmic reticulum junctions. A trigger zone forcalcium signaling by nicotinic acid adenine dinucleotide phosphate andendothelin-1. J. Biol. Chem. 279, 54319–54326

22. Kinnear, N. P., Wyatt, C. N., Clark, J. H., Calcraft, P. J., Fleischer, S., Jeya-kumar, L. H., Nixon, G. F., and Evans, A. M. (2008) Lysosomes co-localizewith ryanodine receptor subtype 3 to form a trigger zone for calciumsignalling by NAADP in rat pulmonary arterial smooth muscle. Cell Cal-cium 44, 190–201

23. Umesh, A., Thompson, M. A., Chini, E. N., Yip, K. P., and Sham, J. S. K.(2006) Integrin ligands mobilize Ca2� from ryanodine receptor-gatedstores and lysosome-related acidic organelles in pulmonary arterialsmooth muscle cells. J. Biol. Chem. 281, 34312–34323

24. Umesh, A., Paudel, O., Cao, Y. N., Myers, A. C., and Sham, J. S. K. (2011)Alteration of pulmonary artery integrin levels in chronic hypoxia andmonocrotaline-induced pulmonary hypertension. J. Vasc. Res. 48,525–537

25. Remillard, C. V., Zhang, W. M., Shimoda, L. A., and Sham, J. S. K. (2002)Physiological properties and functions of Ca2� sparks in rat intrapulmo-nary arterial smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol.283, L433–L444

26. Takahashi, A., Camacho, P., Lechleiter, J. D., and Herman, B. (1999) Mea-surement of intracellular calcium. Physiol. Rev. 79, 1089–1125

27. Zhang, W. M., Yip, K. P., Lin, M. J., Shimoda, L. A., Li, W. H., and Sham,J. S. K. (2003) ET-1 activates Ca2� sparks in PASMC: local Ca2� signalingbetween inositol trisphosphate and ryanodine receptors. Am. J. Physiol.Lung Cell. Mol. Physiol. 285, L680–L690

28. Picht, E., Zima, A. V., Blatter, L. A., and Bers, D. M. (2007) SparkMaster:automated calcium spark analysis with ImageJ.Am. J. Physiol. Cell Physiol.293, C1073–C1081

29. Galione, A. (2011) NAADP receptors. Cold Spring Harb. Perspect. Biol. 3,a004036

30. Patel, S., Ramakrishnan, L., Rahman, T., Hamdoun, A., Marchant, J. S.,Taylor, C. W., and Brailoiu, E. (2011) The endolysosomal system as anNAADP-sensitive acidic Ca2� store: role for the two-pore channels. CellCalcium 50, 157–167

31. Yoshimori, T., Yamamoto, A., Moriyama, Y., Futai, M., and Tashiro, Y.(1991) Bafilomycin A1, a specific inhibitor of vacuolar-type H�-ATPase,inhibits acidification and protein degradation in lysosomes of culturedcells. J. Biol. Chem. 266, 17707–17712

32. Naylor, E., Arredouani, A., Vasudevan, S. R., Lewis, A. M., Parkesh, R.,Mizote, A., Rosen, D., Thomas, J. M., Izumi, M., Ganesan, A., Galione, A.,and Churchill, G. C. (2009) Identification of a chemical probe for NAADPby virtual screening. Nat. Chem. Biol. 5, 220–226

33. Churchill, G. C., andGalione, A. (2001)NAADP induces Ca2� oscillationsvia a two-pool mechanism by priming IP3- and cADPR-sensitive Ca2�

stores. EMBO J. 20, 2666–267134. Lin, M. J., Leung, G. P., Zhang, W. M., Yang, X. R., Yip, K. P., Tse, C. M.,

and Sham, J. S. K. (2004) Chronic hypoxia-induced upregulation of store-operated and receptor-operated Ca2� channels in pulmonary arterialsmoothmuscle cells: a novel mechanism of hypoxic pulmonary hyperten-sion. Circ. Res. 95, 496–505

35. Esposito, B., Gambara, G., Lewis, A. M., Palombi, F., D’Alessio, A., Taylor,L. X., Genazzani, A. A., Ziparo, E., Galione, A., Churchill, G. C., and Filip-pini, A. (2011) NAADP links histamine H1 receptors to secretion of vonWillebrand factor in human endothelial cells. Blood 117, 4968–4977

36. Brailoiu, E., Rahman, T., Churamani, D., Prole, D. L., Brailoiu, G. C.,Hooper, R., Taylor, C.W., and Patel, S. (2010)AnNAADP-gated two-porechannel targeted to the plasmamembrane uncouples triggering from am-plifying Ca2� signals. J. Biol. Chem. 285, 38511–38516

37. Hooper, R., Churamani, D., Brailoiu, E., Taylor, C.W., and Patel, S. (2011)Membrane topology of NAADP-sensitive two-pore channels and theirregulation by N-linked glycosylation. J. Biol. Chem. 286, 9141–9149

38. Wang, S. Q., Stern, M. D., Ríos, E., and Cheng, H. (2004) The quantalnature ofCa2� sparks and in situ operation of the ryanodine receptor arrayin cardiac cells. Proc. Natl. Acad. Sci. U.S.A. 101, 3979–3984

39. Lipp, P., Egger, M., and Niggli, E. (2002) Spatial characteristics of sarco-plasmic reticulum Ca2� release events triggered by L-type Ca2� currentand Na� current in guinea pig cardiac myocytes. J. Physiol. 542, 383–393

40. Lipp, P., and Niggli, E. (1996) Submicroscopic calcium signals as funda-mental events of excitation-contraction coupling in guinea pig cardiacmyocytes. J. Physiol. 492, 31–38

41. Tinker, A., and Williams, A. J. (1992) Divalent cation conduction in theryanodine receptor channel of sheep cardiac muscle sarcoplasmic reticu-lum. J. Gen. Physiol. 100, 479–493

42. Yang, X. R., Lin, M. J., Yip, K. P., Jeyakumar, L. H., Fleischer, S., Leung,G. P., and Sham, J. S. K. (2005) Multiple ryanodine receptor subtypes andheterogeneous ryanodine receptor-gated Ca2� stores in pulmonary arte-rial smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 289,L338–L348

43. Zhang, W. M., Lin, M. J., and Sham, J. S. K. (2004) Endothelin-1 and IP3inducedCa2� sparks in pulmonary arterial smoothmuscle cells. J. Cardio-vasc. Pharmacol. 44, S121–S124

44. Collins, T. P., Bayliss, R., Churchill, G. C., Galione, A., and Terrar, D. A.(2011) NAADP influences excitation-contraction coupling by releasingcalcium from lysosomes in atrial myocytes. Cell Calcium 50, 449–458

45. Macgregor, A., Yamasaki, M., Rakovic, S., Sanders, L., Parkesh, R.,Churchill, G. C., Galione, A., and Terrar, D. A. (2007) NAADP controlscross-talk between distinct Ca2� stores in the heart. J. Biol. Chem. 282,15302–15311

46. Morgan, A. J., Platt, F. M., Lloyd-Evans, E., and Galione, A. (2011) Molec-ular mechanisms of endolysosomal Ca2� signalling in health and disease.Biochem. J. 439, 349–374

47. Sham, J. S. K. (1997) Ca2� release-induced inactivation of Ca2� current inrat ventricularmyocytes: evidence for local Ca2� signalling. J. Physiol. 500,285–295

48. Sham, J. S. K., Cleemann, L., andMorad,M. (1995) Functional coupling ofCa2� channels and ryanodine receptors in cardiac myocytes. Proc. Natl.Acad. Sci. U.S.A. 92, 121–125

49. Jaggar, J. H., Porter, V.A., Lederer,W. J., andNelson,M.T. (2000)Calciumsparks in smooth muscle. Am. J. Physiol. Cell Physiol. 278, C235–C256

50. Nelson, M. T., Cheng, H., Rubart, M., Santana, L. F., Bonev, A. D., Knot,H. J., and Lederer, W. J. (1995) Relaxation of arterial smooth muscle bycalcium sparks. Science 270, 633–637

51. Rosen, D., Lewis, A.M., Mizote, A., Thomas, J. M., Aley, P. K., Vasudevan,S. R., Parkesh, R., Galione, A., Izumi,M., Ganesan, A., and Churchill, G. C.(2009) Analogues of the nicotinic acid adenine dinucleotide phosphate(NAADP) antagonist Ned-19 indicate two binding sites on the NAADP




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

receptor. J. Biol. Chem. 284, 34930–3493452. Aarhus, R., Dickey, D.M., Graeff, R.M., Gee, K. R.,Walseth, T. F., and Lee,

H. C. (1996) Activation and inactivation of Ca2� release by NAADP�.J. Biol. Chem. 271, 8513–8516

53. Yanai, K., Maeyama, K., Nakahata, N., Nakanishi, H., and Watanabe, T.(1992) Calcium mobilization and its desensitization induced by endothe-lins and sarafotoxin in human astrocytoma cells (1321N1): comparison ofhistamine-induced calcium mobilization. Naunyn-Schmiedebergs Arch.Pharmacol. 346, 51–56

54. Narayanan, D., Adebiyi, A., and Jaggar, J. H. (2012) Inositol trisphosphatereceptors in smooth muscle cells. Am. J. Physiol. Heart Circ. Physiol. 302,H2190–H2210

55. Zhu, M. X., Ma, J., Parrington, J., Calcraft, P. J., Galione, A., and Evans,A.M. (2010) Calcium signaling via two-pore channels: local or global, thatis the question. Am. J. Physiol. Cell Physiol. 298, C430–C441

56. Zhu, M. X., Ma, J., Parrington, J., Galione, A., and Evans, A. M. (2010)TPCs: endolysosomal channels for Ca2� mobilization from acidic organ-elles triggered by NAADP. FEBS Lett. 584, 1966–1974

57. López Sanjurjo, C. I., Tovey, S. C., Prole, D. L., and Taylor, C. W. (2013)

Lysosomes shape IP3-evoked Ca2� signals by selectively sequesteringCa2� released from the endoplasmic reticulum. J. Cell Sci., in press

58. Zhang, F., Jin, S., Yi, F., and Li, P. L. (2009) TRP-ML1 functions as alysosomal NAADP-sensitive Ca2� release channel in coronary arterialmyocytes. J Cell. Mol. Med. 13, 3174–3185

59. Zhang, F., and Li, P. L. (2007) Reconstitution and characterization of anicotinic acid adenine dinucleotide phosphate (NAADP)-sensitive Ca2�

release channel from liver lysosomes of rats. J. Biol. Chem. 282,25259–25269

60. Zhang, F., Xu, M., Han, W. Q., and Li, P. L. (2011) Reconstitution oflysosomal NAADP-TRP-ML1 signaling pathway and its function in TRP-ML1�/� cells. Am. J. Physiol. Cell Physiol. 301, C421–C430

61. Yamaguchi, S., Jha, A., Li, Q., Soyombo, A. A., Dickinson, G. D., Chura-mani, D., Brailoiu, E., Patel, S., and Muallem, S. (2011) Transient receptorpotential mucolipin 1 (TRPML1) and two-pore channels are functionallyindependent organellar ion channels. J. Biol. Chem. 286, 22934–22942

62. Lloyd-Evans, E., and Platt, F. M. (2011) Lysosomal Ca2� homeostasis:role in pathogenesis of lysosomal storage diseases. Cell Calcium 50,200–205




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Sun, Xiao-Ru Yang, Pixin Ran and James S. K. ShamYong-Liang Jiang, Amanda H. Y. Lin, Yang Xia, Suengwon Lee, Omkar Paudel, Hui

Stores in Pulmonary Arterial Myocytes2+Ca Signals from NAADP- and Ryanodine Receptor-gated2+Heterogeneous Local Ca

Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Activates Global and

doi: 10.1074/jbc.M112.423053 originally published online February 26, 20132013, 288:10381-10394.J. Biol. Chem.

10.1074/jbc.M112.423053Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/288/15/10381.full.html#ref-list-1

This article cites 61 references, 29 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M112.423053

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;288/15/10381&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/15/10381

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=288/15/10381&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/15/10381

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/288/15/10381.full.html#ref-list-1

http://www.jbc.org/

Documents

Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Activates