Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
Identifying Adaptations that Promote Softwood Utilization
by the White-Rot Basidiomycete Fungus, Phanerochaete carnosa
by
Jacqueline MacDonald
A thesis submitted in conformity with the requirements for the degree of Doctorate of Philosophy
Department of Chemical Engineering & Applied Chemistry University of Toronto
© Copyright by Jacqueline MacDonald 2012
ii
Identifying Adaptations that Promote Softwood Utilization by the
White-Rot Basidiomycete Fungus, Phanerochaete carnosa
Jacqueline MacDonald
Doctorate of Philosophy
Department of Chemical Engineering & Applied Chemistry
University of Toronto
2012
Abstract
Softwood is the predominant form of land plant biomass in the Northern hemisphere, and
is among the most recalcitrant biomass resources to bioprocess technologies. The white rot
fungus Phanerochaete carnosa has been isolated almost exclusively from softwoods, while most
other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated
from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes
and proteins that promote softwood decomposition.
To elucidate the genetic basis of softwood bioconversion by P. carnosa, its genome was
sequenced and transcriptomes were evaluated after growth on wood compared to liquid medium.
Results indicate that P. carnosa differs from P. chrysosporium in the number and expression
levels of genes that encode lignin peroxidase (LiP) and manganese peroxidase (MnP), two
enzymes that modify lignin present in wood. P. carnosa has more genes for MnP with higher
expression levels than LiP, while the reverse has been observed for P. chrysosporium.
The abundances of transcripts predicted to encode lignocellulose-modifying enzymes
were then measured over the course of P. carnosa cultivation on four wood species. Profiles
iii
were consistent with decay of lignin before carbohydrates. Transcripts encoding MnP were
highly abundant, and those encoding MnP and LiP featured significant substrate-dependent
response.
Since differences in modes of lignin degradation catalyzed by MnP and LiP could affect
the ability of each to degrade lignin from different types of wood, their activity on various
hardwoods and softwoods were tested. Results suggest that MnP degrades softwood lignin more
effectively than hardwood lignin, consistent with high levels of this enzyme in P. carnosa.
iv
Acknowledgments
Jacqueline MacDonald would like to acknowledge the help and support of her supervisor, Dr.
Emma Master, and committee members Dr. Malcolm Campbell, Dr. Elizabeth Edwards, and Dr.
Krishna Mahadevan; as well as her colleagues including Robyn Goacher, Dragica Jeremic,
Sonam Mahajan, and Hitoshi Suzuki. She was supported in part by the William and Dorothy
Palm/Government of Ontario Graduate Scholarship in Science and Technology; University of
Toronto Open Fellowship; School of Graduate Studies Doctoral Completion Grant; Biozone
Graduate Scholarship; and McAllister Graduate Fellowship (Faculty of Applied Science and
Engineering). This work is dedicated to the G-unit, without whom none of this would be
possible.
v
Table of Contents
List of tables........................................................................................................................ viii
List of figures....................................................................................................................... ix
List of appendices................................................................................................................ xi
List of abbreviations............................................................................................................ xii
1. Chapter 1: Literature review............................................................................................ 1
1.1 Wood composition............................................................................................. 2
1.1.1 Evolution of woody plants.................................................................. 2
1.1.2 Structure and composition of xylem cells........................................... 2
1.1.3 Lignin synthesis, composition, and structure...................................... 4
1.2 Wood-rot fungi................................................................................................... 8
1.2.1 White- and brown-rot fungi................................................................. 8
1.2.2 Phanerochaete species as model organisms....................................... 8
1.2.3 Enzymatic hydrolysis of cellulose and hemicellulose......................... 10
1.2.4 Lignin depolymerization by LiP and MnP.......................................... 11
1.3 Regulation of genes encoding ligninolytic activity............................................ 13
1.3.1 Gene expression in ligninolytic conditions......................................... 14
1.3.2 Role of calmodulin / cyclic AMP....................................................... 17
1.3.3 Reactive oxygen species..................................................................... 18
1.3.4 Promoter elements............................................................................... 19
1.3.5 Transcript splicing............................................................................... 21
1.4 Gene expression during growth on wood.......................................................... 22
1.5 Justification and objective of current research................................................... 27
2. Chapter 2: Comparative genomics of P. carnosa and P. chrysosporium to elucidate
the genetic basis of the distinct wood types they colonize................................................... 29
2.1 Introduction........................................................................................................ 30
2.2 Materials and Methods....................................................................................... 31
2.2.1 Nucleic acid isolation and sequencing................................................ 31
2.2.2 Microscopy.......................................................................................... 32
2.2.3 Single copy gene sequencing.............................................................. 32
2.2.4 Prediction of FOLymes and oxidoreductases...................................... 32
vi
2.2.5 Phylogenetics...................................................................................... 33
2.2.6 Prediction of polysaccharide-degrading activity and P450s................. 33
2.2.7 Wood extractive analysis..................................................................... 34
2.3 Results and Discussion...................................................................................... 34
2.3.1 Confirming homokaryosis................................................................... 34
2.3.2 Prediction of FOLymes and oxidoreductases...................................... 36
2.3.3 Peroxidase evolution........................................................................... 39
2.3.4 Prediction of polysaccharide-degrading activity and P450s............... 42
2.3.5 Wood extractive analysis..................................................................... 43
2.4 Conclusions........................................................................................................ 43
3. Chapter 3: Transcriptomic responses of P. carnosa during growth on coniferous and
deciduous wood.................................................................................................................. 45
3.1 Introduction........................................................................................................ 46
3.2 Materials and Methods....................................................................................... 46
3.2.1 Fungal strain and culture conditions................................................... 46
3.2.2 RNA extraction and sequencing.......................................................... 47
3.2.3 Gene set enrichment analysis............................................................... 48
3.2.4 Manual gene annotation...................................................................... 48
3.2.5 RT-qPCR............................................................................................. 48
3.3 Results................................................................................................................ 49
3.3.1 Validation of mRNA-Seq patterns...................................................... 49
3.3.2 Differentially regulated transcripts..................................................... 51
3.3.3 Lignin degradation.............................................................................. 54
3.3.4 Carbohydrate-active enzymes............................................................. 55
3.4 Discussion.......................................................................................................... 57
4. Chapter 4: Time-dependent profiles of transcripts encoding lignocellulose-modifying
enzymes of P. carnosa grown on multiple wood substrates................................................ 59
4.1 Introduction........................................................................................................ 60
4.2 Materials and Methods....................................................................................... 61
4.2.1 Fungal cultures.................................................................................... 61
4.2.2 RT-qPCR............................................................................................. 61
4.2.3 FT-IR................................................................................................... 63
vii
4.3 Results................................................................................................................ 64
4.3.1 Fungal cultures.................................................................................... 64
4.3.2 Pattern of transcript abundance for internal standards........................ 65
4.3.3 Abundance of transcripts encoding lignin-degrading activity............. 69
4.3.4 Abundance of transcripts encoding carbohydrate-active enzymes..... 70
4.3.5 FT-IR................................................................................................... 75
4.4 Discussion.......................................................................................................... 76
5. Chapter 5: Comparative analysis of lignin peroxidase and manganese peroxidase
activity on coniferous and deciduous wood........................................................................ 79
5.1 Introduction........................................................................................................ 80
5.2 Materials and Methods....................................................................................... 81
5.2.1 Reaction conditions............................................................................. 81
5.2.2 Sequence alignment of commercial MnP and LiP.............................. 82
5.2.3 UV analysis......................................................................................... 82
5.2.4 ToF-SIMS............................................................................................ 82
5.3 Results................................................................................................................ 83
5.3.1 Commercial MnP and LiP alignments................................................. 83
5.3.2 UV analysis......................................................................................... 84
5.3.3 ToF-SIMS surface analysis................................................................. 85
5.4 Discussion.......................................................................................................... 90
6. Conclusions and future directions................................................................................... 92
7. Engineering relevance...................................................................................................... 96
8. References........................................................................................................................ 97
Appendices.......................................................................................................................... 108
viii
List of Tables
Table 1.1 Publications for Phanerochaete species.
Table 1.2 Transcriptomic and proteomic studies of Phanerochaete grown in ligninolytic
conditions.
Table 1.3 Splicing of lip transcripts in P. chrysosporium under various culture conditions.
Table 1.4 Splicing of cel transcripts in P. chrysosporium ME-446 under various culture
conditions.
Table 1.5 Transcriptomic and proteomic studies of Phanerochaete grown on wood.
Table 2.1 Summary of oxidoreductases potentially involved in lignocellulose degradation by
P. carnosa and P. chrysosporium.
Table 3.1 Primers used for RT-qPCR.
Table 3.2 The 30 most abundant transcripts from P. carnosa during growth on wood relative to
growth on YMPG.
Table 3.3 The 30 most abundant transcripts from P. carnosa during growth on wood (absolute
values).
Table 4.1 Primers for RT-qPCR.
Table 4.2 Primers used to generate plasmid standards.
Table 4.3 Two-way ANOVA to determine the effects of time (growth point) and wood substrate
on the abundance of each target transcript in P. carnosa.
Table 4.4 Bonferroni's multiple comparison post-test of transcript abundance at each growth
point (GP) following repeated measures ANOVA.
Table 4.5 Assignment of FTIR peaks that correspond to wood polysaccharides and lignin and
were decreased in maple cultivation collected at GP 3.
ix
List of Figures
Figure 1.1 Polymerization of lignin.
Figure 1.2 Catalytic cycle of LiP and MnP.
Figure 1.3 Summary of pathways affecting LiP and MnP expression.
Figure 2.1 Absence of clamp connections suggests homokaryosis.
Figure 2.2 Phylogeny, genome position, and intron distribution of genes encoding manganese
peroxidases of P. carnosa and P. chrysosporium.
Figure 2.3 Phylogeny, genome position, and intron distribution of genes encoding lignin
peroxidases of P. carnosa and P. chrysosporium.
Figure 3.1 Biological reproducibility of the transcript abundances determined by mRNA-Seq.
Figure 3.2 Heat maps and abundances for selected transcripts expressed by P. carnosa during
growth on wood and YMPG substrates.
Figure 4.1 Harvest times for P. carnosa cultivations grown on fir, pine, spruce, and maple.
Figure 4.2 Abundance of transcripts encoding chitin synthase (chs) is less variable than
abundance of transcripts encoding actin or gapdh in P. carnosa.
Figure 4.3 Time-dependent abundance of transcript sequences in triplicate cultivations of P.
carnosa grown on fir, pine, spruce, and maple.
Figure 5.1 UV analysis of MnP reactions.
Figure 5.2 ToF-SIMS peaks used to calculate lignin modification.
Figure 5.3 Lignin metric for MnP and LiP reactions.
Figure 5.4 Percent modification of G- and S-lignin from hardwood exposed to MnP and LiP.
Figure A2.1 Light microscopy of P. carnosa grown on sugar maple.
Figure A2.2 Inoculation tool.
Figure A2.3 Pictures of membranes with P. carnosa taken from hardwood and softwood
cultivations moistened with water
Figure A2.4 Measurement of P. carnosa growth on hardwoods and softwoods with water or B3.
Figure A2.5 P. carnosa colony diameter on hardwoods and softwoods with water or B3.
Figure A3.1 Details of mRNA-Seq.
Figure A5.1 Species phylogeny of selected Basidiomycete and Ascomycete fungi.
Figure A5.2 Bayesian tree of fungal glucuronoyl esterase amino acid sequences.
x
Figure A6.1 Alignment of P. chrysosporium LiP with LiP sequences from P. carnosa.
Figure A6.1 Alignment of Phlebia MnP with MnP sequences from P. carnosa.
Figure A7.1 Percent modification of lignin from softwood and hardwood species exposed to
MnP and LiP (with statistics).
Figure A7.2 Percent modification of lignin from softwood and hardwood species exposed to
MnP and LiP (showing individual replicates).
xi
List of Appendices
Appendix 1: PhD research publications and conference presentations
Appendix 2: Quantitative estimation of P. carnosa growth on hardwood and softwood
Appendix 3: Details of mRNA-Seq
Appendix 4: Revised gene models
Appendix 5: Evolution of glucuronoyl esterase
Appendix 6: Commercial LiP and MnP alignments
Appendix 7: Supplemental ToF-SIMS data
xii
List of Abbreviations
AXE - acetyl xylan esterase
B3 - a buffer consisting mainly of KH2PO4, MgSO4, and CaCl2, with various minerals and
vitamins
BKM-F-1767 - a heterokaryotic, wildtype strain of P. chrysosporium
CaM - calmodulin
cAMP - cyclic adenosine monophosphate
CAZyme - carbohydrate active enzyme
Cbd - cellobiose dehydrogenase
Cbh - cellobiohydrolase
CCP - cytochrome C peroxidase
CE - carbohydrate esterase
Chs - chitin synthase
CIRMBRFM41 - a peroxide hypersecretory mutant strain of P. chrysosporium
COMT - caffeic acid O-methyltransferase
CRO - copper radical oxidase
CuSE - copper signaling element
DMSO - dimethyl sulfoxide
F5H - ferulate 5-hydroxylase
FOLyme - fungal oxidative lignin enzyme
FTIR - Fourier transform infrared spectroscopy
G - guaiacyl
GAPDH - glyceraldehyde 3-phosphate dehydrogenase
GE - glucuronoyl esterase
GH - glycoside hydrolase
GLOX - glyoxal oxidase
GP - growth point
GS - guaiacyl-syringyl
H - p-hydroxyphenyl
IBMX - 3-isobutyl-1-methylxanthine
JGI - Joint Genome Institute
xiii
LC-MS/MS - liquid chromatography tandem mass spectrometry
Lcs - laccase
LDA - lignin degrading auxiliary enzyme
LiP - lignin peroxidase
LMM - lignin modification metric
LO - lignin oxidase
LongSAGE - long serial analysis of gene expression
Man - mannanase
MCO - multicopper oxidase
ME-446 - a heterokaryotic, wildtype strain of P. chrysosporium
MnP - manganese peroxidase
MnSOD - superoxide dismutase
MRE - metal response element
OGC101 - a heterokaryotic, wildtype strain of P. chrysosporium, derived from strain ME-446
PCR - polymerase chain reaction
RACE - rapid amplification of cDNA ends
RNAi - RNA interference
ROS - reactive oxygen species
RP-78 - a homokaryotic strain of P. chrysosporium, derived from strain BKM-F-1767
RT-PCR - reverse transcriptase polymerase chain reaction
RT-qPCR - reverse transcriptase real-time quantitative polymerase chain reaction
S - syringyl
SEC - size exclusion chromatography
T25VN - a DNA primer with 25 thymidine nucleotides, followed by an adenosine, cytosine, or
guanosine, and then any of the 4 nucleotides
ToF-SIMS - time-of-flight secondary ion mass spectrometry
UPLC - ultra high performance liquid chromatography
USDA - United States Department of Agriculture
YMPG - a medium composed mainly of yeast extract, malt extract, peptone, and glucose
Xyl - xylanase
xiv
1
Chapter 1 Literature Review
Parts of this chapter are published in the review article:
MacDonald J, Suzuki H, Master ER. Regulation of genes encoding lignocellulose-degrading
activity in the genus Phanerochaete. Applied Microbiology and Biotechnology 94(2), 339-351.
All parts included in this chapter were composed by J. MacDonald.
2
1.1. Wood composition
1.1.1 Evolution of woody plants
Wood can be classified as either hardwood or softwood. Hardwood is derived from trees
that are angiosperms (flowering plants), which are typically deciduous, having a seasonal loss of
leaves. Softwood is derived from coniferous gymnosperms, which bear cones and have naked
seeds directly exposed to the air for wind pollination (Wiedenhoeft and Miller, 2005). All extant
gymnosperms are trees, while in dicotyledonous angiosperms the tree habit is polyphyletic
(Raven and Andrews 2010). Extant fern trees and monocot angiosperm trees (such as palm trees)
are not considered true trees because they lack real wood (Thomas 2000).
The phylogeny of both gymnosperms and angiosperms can be traced back to the
pteridosperms, or seed ferns, that were woody and first appeared around 380 million years ago
during the Late Devonian period (Raven and Andrews 2010). Gymnosperms evolved during the
Carboniferous period 360-290 million years ago (Thomas 2000), while the earliest evidence of
angiosperms is from 136 million years ago during the Cretaceous period. Angiosperms evolved
either from a now extinct group of gymnosperms or from among the pteridosperms (Frohlich and
Chase, 2007).
During the Carboniferous period, when gymnosperms arose, most of the Earth's land was
part of the super-continent Pangaea. By the time angiosperms evolved, this land mass was
breaking into Laurasia, which would give rise to present-day Northern hemisphere continents;
and Gondwana, which would become Australia, Africa, South America, India, and Antarctica.
The rapid diversification of angiosperms in Gondwana largely displaced gymnosperms in the
Southern hemisphere (Thomas, 2000).
1.1.2 Structure and composition of xylem cells
In trees, cell division and radial growth take place in the cambial zone, a thin layer of
cells that separate the xylem (wood) from the inner bark (phloem); these cells divide to produce
cells that become xylem, phloem, or more cambium. However, more cells are produced toward
the inside of the tree to become xylem than are produced toward the outside to become phloem;
3
and xylem cells divide more frequently than phloem cells. This is why trees contain more wood
than bark (Sjostrom 1993).
The xylem cell wall is built up in layers. From external to internal, these consist of
middle lamella, primary cell wall, three layers of secondary cell wall, and the warty layer which
is present in all softwoods but only some hardwoods. The secondary wall, in particular the
middle layer of secondary wall, is the thickest layer and contributes to much of the volume of
wood (Sjostrom 1993).
Wood xylem includes multiple cell types. In softwood, the majority of cells are vertical
tracheids, often referred to as fibers, with ray parenchyma cells running perpendicular. The
tracheids function to transport water and to provide mechanical support. In contrast, hardwood
structure is more complicated, with a greater variety of cell types as well as greater variability
within cell types. The vertical system is composed of vessels, fibers, and axial parenchymal cells.
Here, water transport is provided mainly by vessels, which are larger in diameter than the
tracheids of softwood. Like softwoods, the horizontal system is composed of rays, but these are
more diverse than softwood rays in both size and shape (Wiedenhoeft and Miller, 2005).
Wood is largely composed of the secondary cell walls of tracheids, vessels, and fibers.
These walls consist mainly of lignocellulose: a combination of the polymers cellulose,
hemicellulose, and lignin. Cellulose is a polymer of β(1→4)-linked glucose that provides
strength to the wood. Hemicellulose refers to polysaccharides that are extracted from plant cell
walls with molar concentrations of alkali. Most hemicelluloses are cross-linking glycans that
comprise a β(1→4)-linked sugar backbone and branching sugars that provide flexibility, and
cross-linkages between cellulose and lignin. Lignin, a polyaromatic compound, increases the
rigidity of plant cell walls and provides resistance to decay and diseases. It also increases the
surface hydrophobicity of fibres, thereby increasing the efficiency of water transport in plants
(Schmidt 2006, Sjostrom 1993).
The types of hemicellulose and lignin vary between hardwoods and softwoods. The
principle hemicelluloses of softwood are galactoglucomannans, which have a backbone of β-1,4-
linked glucose and mannose sugars with branching galactose units. The molar ratio of
glucose:mannose:galactose can range from 0.1:1:4 to 1:1:3. In addition, the C-2 and C-4
positions of the backbone sugars are partially substituted by O-acetyl groups, with an average of
4
one acetyl group per 3-4 sugar units. In hardwood, the principle hemicellulose is glucuronoxylan,
with a backbone of β-1,4-linked xylose. Here, O-acetyl substitution occurs at the C-2 or C-3
position, with an average of seven acetyl residues per ten xylose units. The xylose units also
contain an average of one 1,2-linked 4-O-methyl-α-D-glucuronic acid residues per ten xylose
units. A less abundant hemicellulose of hardwoods is glucomannan, while other softwood
hemicelluloses are arabinoglucuronoxylan and arabinogalactan (Sjostrom 1993).
1.1.3 Lignin synthesis, composition, and structure
Lignin is a poly-aromatic compound produced through combinatorial free radical
coupling between monomers and a growing polymer, and between lignin oligomers. The three
most abundant lignin monomers (monolignols) are p-coumaryl (4-hydroxycinnamyl) alcohol,
coniferyl (3-methoxy 4-hydroxycinnamyl) alcohol, and sinapyl (3,5-dimethoxy 4-
hydroxycinnamyl) alcohol (Fig. 1.1a). While positions within the phenyl group are numbered 1
through 6, carbons within the propanoid moiety are referred to as being in the , , or position.
When p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol are incorporated into lignin,
resulting structures are referred to as p-hydroxyphenyl (H), guaiacyl (G), and syringyl (S) units,
respectively (Ralph et al. 2004).
The H and G lignin units occur in all vascular plants, but S lignin units are specific to
certain lineages, mostly the angiosperms (including hardwoods). In angiosperms, the core
monolignol biosynthesis pathway has evolved enzymes that can convert the G unit and its
immediate precursor, coniferaldehyde, into S units. These enzymes are ferulate 5-hydroxylase
(F5H) and caffeic acid O-methyltransferase (COMT), which lead to the addition of a 5-methoxy
group to coniferaldehyde to form sinapaldehyde, or to coniferyl alcohol (G unit) to form sinapyl
alcohol (S unit), respectively (Weng and Chapple 2010). While S units occur predominantly in
angiosperms, they have also been found in species that diverged prior to the angiosperms and
gymnosperms: these include members of the Pteridophyta (ferns), Lycopodiophyta (the oldest
division of extant vascular plants), and the Marchantiophyta (liverworts, which lack roots and
vascular systems) (Espineira et al. 2011), as well as the gymnosperm species Podocarpus
macrophyllus (yew plum pine) and Tetraclinis articulata (sandarac cypress). These observations
have led to competing hypotheses that S biosynthesis either was lost in many taxa, or developed
polyphyletically through convergent evolution. However, recent characterization of F5H in the
5
lycophyte Selaginella moellendorffii suggests that this enzyme evolved independently of F5H in
angiosperms, and supports the convergent evolution hypothesis (Weng and Chapple 2010).
In most cases, softwood lignin is comprised primarily of G-lignin with minor quantities
of H units (for example, 0.4% in Pinus radiata; Wagner et al. 2007) and lacks S units; whereas
hardwoods primarily contain varying ratios of G and S units (GS-lignin), with even lower
quantities of H units (Bonawitz and Chapple 2010). The G:S ratio in hardwood lignin can vary
from 1:2 to 4:1 (Sjostrom 1993). Lignin composition can vary between species or population, among
cell types, among cell wall layers, and in response to environmental stimuli (Bonawitz and Chapple
2010, Campbell and Sederoff 1996). For example, hardwoods contain higher proportions of S
units in fibers and higher proportions of G units in vessels (Weng and Chapple 2010, Zhou et al.
2011); aspen fibers have a greater proportion of S units in the secondary cell wall compared to
the middle lamella (Grunwald et al. 2002); and compression wood in gymnosperms, which is
produced in response to mechanical stress, is augmented in H units (Campbell and Sederoff
1996, Fukushima and Terashima 1991). In addition, various phenolic compounds other than the
three primary monolignols can be incorporated into lignin, subject to their ability to form free
radicals and participate in the coupling reactions. Some of the more common examples include
monolignols with γ -hydroxyl acetylations, γ -p-hydroxybenzoate substituents,
hydroxycinnamaldehydes, and reduced monomers such as dihydroconiferyl alcohol (Ralph et al.
2004).
Lignification generally occurs after polysaccharide deposition (Grunwald et al. 2002) in
terminally differentiated cells (Bonawitz and Chapple 2010). Several modes of monolignol
export have been proposed, including transport of corresponding glucosides, Golgi-mediated
vesicular transport, and export via ABC transporter proteins (Bonawitz and Chapple 2010).
However, the mechanism of monolignol transport to the cell wall remains largely unknown
(Vanholme et al. 2010). Still, lignification was shown to begin in the cell corners then extend
through the rest of the middle lamella and later to the secondary cell wall (Grunwald et al. 2002).
The G and H units are incorporated earlier than the S units in hardwoods, which may explain the
higher proportion of G units in the middle lamella (Grunwald et al. 2002).
During lignin polymerization, plant peroxidases cleave the O-H bonds of phenolic
hydroxyl groups in the monolignols or lignin polymer. This produces free radicals in which the
6
unpaired electron moves throughout the molecule, creating various resonance-stabilized free
radicals, of which RO-4, R5, and Rβ are the most important (Fig. 1.1b). The unpaired electrons
from these structures can combine to form new covalent bonds (Fig. 1.1c). Radicals R3 and R1
are less likely to participate in coupling due to steric hindrance from the surrounding molecular
groups. Because sinapyl alcohol has two methoxyl groups, its structure will not produce free
radicals of the R5 type, giving rise to fewer bond types than coupling reactions between guaiacyl
units (Ralph et al. 2004).
Since coupling at the β-position of monolignols is favoured (although more so for sinapyl
than guaiacyl alcohol), dimerization results from coupling of at least one of the monolignols at
its β-position. However, the key reactions during lignification of the secondary wall involve
coupling between a monolignol and the growing polymer (end-wise polymerization), between
lignin oligomers, or oligomers and the lignin polymer. End-wise polymerization of a monolignol
with an S unit in the polymer will be largely through β-O-4 bonding, while end-wise
polymerization with a G unit will be though either β-O-4 or β-5 bonding. For oligo-oligo or
oligo-polymer polymerization, the β-position is not free to participate in the coupling reaction
and resulting polymerizations often produce 5-5 bonds (between two G units) or 5-O-4 bonds
(between two G units or between one G and one S unit), which serve as branch points in the
lignin structure (Ralph et al. 2004). Because the 5-position is not available for coupling between
two S units, lignins that contain higher proportions of G units are more highly crosslinked, and
those with higher proportions of S units are more linear (Bonawitz and Chapple 2010). In G-
lignin, 5-5 coupling accounts for approximately 4% of the linkages (Vanholme et al. 2010).
7
A:
B:
C:
Figure 1.1. Polymerization of lignin. A: p-coumaryl, coniferyl, and sinapyl alcohols. B: Free
radicals produced from coniferyl alcohol. C: Major covalent bonds produced from free radical
coupling of G-lignin. Although there is no evidence of 5-5 and 5-O-4 bonds in lignin dimers,
these bond types are present in lignin polymers as a result of oligomer-oligomer couplings
(Ralph et al. 2004). Figures adapted from (Morreel et al. 2010) and (Ralph et al. 2004).
2
β α
1
γ
3 4
5
6
8
1.2 Wood-rot fungi
1.2.1 White-rot and brown-rot fungi
Wood-rot fungi are classified into one of three groups: white-rot, brown-rot, and soft-rot.
Most white-rot, including those of the genus Phanerochaete, and all brown rot fungi are of the
phylum Basidiomycota (Basidiomycetes). Few white-rots are Ascomycetes, and soft-rots can be
Ascomycetes or Deuteromycetes (Schmidt 2006). Brown-rot and soft-rot fungi selectively
degrade cellulose and hemicellulose, leaving the lignin component as a modified polymeric
residue (Yelle et al. 2008, Yelle et al. 2011). White-rot fungi are the only organisms known to
completely degrade all three components of lignocellulose: cellulose, hemicellulose, and lignin,
and leave the substrate bleached and stringy, which is the reason for their name (Hibbett and
Donoghue 2001, Martinez et al. 2004). Usually, white-rot fungi grow preferentially on hardwood
species, whereas brown-rot fungi grow preferentially on softwood. The ancestral state is believed
to be a white-rot with the ability to grow on both hardwoods and softwoods, whereas brown-rot
and softwood exclusivity have evolved repeatedly (Hibbett and Donoghue 2001). Still,
preference for hardwoods may limit the efficient use of enzymes from many white-rot fungi,
such as the model Phanerochaete chrysosporium, in applications for Canada's forest products
industries, where over 65% of the forests are composed of softwood species, such as pines,
spruces, and firs.
Phanerochaete carnosa is a white-rot that is found most often on softwood (Burdsall
1985). Enzymes from this fungus may therefore be more applicable to Canada's forest products
industries than those from hardwood-degrading fungi. Research of the genes and wood-
modifying enzymes of P. carnosa may therefore lead to better enzymes for industrial use,
particularly in Northern countries. More fundamentally, genomic and proteomic comparisons of
P. carnosa and P. chrysosporium might reveal evolutionary strategies that have enabled these
fungi to preferentially grow on softwood and hardwood, respectively.
1.2.2 Phanerochaete species as model organisms
As white-rot fungi, Phanerochaete produce sets of extracellular enzymes that can
completely degrade lignocellulose, the main component of wood and other plant cell walls.
9
Phanerochaete therefore have potential applications in the production of renewable chemicals
and liquid fuel from wood, which is among the largest biomass resources that could be used for
the production of such chemicals (Lin and Tanaka 2006). The oxidative enzymes involved in
wood degradation by Phanerochaete have also been shown to degrade a variety of persistent
environmental pollutants, including chlorinated aromatic compounds, munitions, pesticides, and
dyes (Cameron et al. 2000).
Phanerochaete chrysosporium is the most intensively studied white rot basidiomycete. It
emerged as a model wood-decay organism due to its frequent discovery in wood chip storage
piles in Europe and North America. While the species was isolated and used in a variety of
studies, some of the isolates were believed to be multiple species until 1974, when the
teleomorph (sexual reproductive stage) was identified. At that time, P. chrysosporium was
described as being distinguished from other Phanerochaete species by its rapid radial growth
rate of up to 42 mm/day and its high optimum temperature for growth, near 40°C (Burdsall and
Eslyn 1974). Since then, three wild-type strains have commonly been used: ME-466, BKM-F-
1767, and OGC101, which is a derivative of ME-446. These strains are heterokaryotic,
consisting of two or more genetically distinct nuclei (Gold and Alic 1993). To facilitate genetic
analyses by removing multiple alleles, the homokaryotic strain RP-78, in which all nuclei are
identical, was generated from strain BKM-F-1767 in 2000 (Stewart et al. 2000). The genome of
strain RP-78 was sequenced and became publicly available in 2004 (Martinez et al. 2004).
Other species currently being studied include Phanerochaete sordida, Phanerochaete
velutina, Phanerochaete flavido-alba, Phanerochaete crassa, Phanerochaete sp. HSD, and
Phanerochaete carnosa. Next to P. chrysosporium, P. sordida claims the highest number of
publications among the Phanerochaete species (Table 1.1). Like P. chrysosporium, this
saprophytic fungus is found mainly on hardwood (Burdsall 1985). It has a rapid growth rate over
a wide range of temperatures and in 1990, P. sordida strain HHB-8922-sp was found to have a
greater ability to mineralize the wood preservative pentachlorophenol compared to P.
chrysosporium (Lamar et al. 1990). P. carnosa was recently described as a softwood-degrading
white-rot fungus (Mahajan and Master 2010). Gene expression in this organism has been studied
through proteomic analysis (Mahajan and Master 2010), and in the current work, through
transcriptome analysis (chapter 3; MacDonald et al. 2011) and real-time RT-PCR (chapter 4;
10
MacDonald and Master 2012). Its genome has also been sequenced (chapter 2;
http://www.jgi.doe.gov/Pcarnosa).
Notwithstanding the advances made in the study of other Phanerochaete species, most of
the knowledge relating to gene regulation in this genus comes from research using P.
chrysosporium. While much of the literature review therefore is focused on this species, other
species are mentioned where contributions are available.
Table 1.1. Publications for Phanerochaete species.
Phanerochaete
species1
No. papers
published2 Main research topics
P. chrysosporium 3214 wood decay; decay of environmental pollutants; pulp bleaching
P. sordida 40 decay of environmental pollutants; pulp bleaching
P. velutina 33 nutrient transport in mycelial cord system
P. flavido-alba 13 detoxification of waste water from olive oil mills
P. crassa 6 pulp bleaching
P. sp. HSD 3 high production of lignin-degrading manganese peroxidase
P. carnosa 2 softwood decay
1Species from manuscript titles with publication dates in 2010-2011 from the Web of Knowledge
database. 2Papers with species name in the title, from Web of Knowledge database search for all available
years.
1.2.3 Enzymatic hydrolysis of cellulose and hemicellulose
Phanerochaete species are studied mainly for the enzymes that enable them to degrade
plant lignocellulose, a complex material that requires the activity of a variety of enzymes during
decay. Enzymes that hydrolyze the main polysaccharides in plant cell walls are classified as
carbohydrate-active enzymes (CAZymes), which includes several enzyme families, including
glycoside hydrolases, carbohydrates esterases, and polysaccharide lyases (Henrissat and Davies
1997; www.cazy.org).
11
Cellulose degradation is mediated by the concerted activity of at least three glycoside
hydrolase activities, namely: endoglucanases, cellobiohydrolases, and β-glucosidases.
Endoglucanases hydrolyze internal glycosidic linkages, while cellobiohydrolases release
cellobiose from either the reducing or non-reducing end of cellulose polymers. β-glucosidase
alleviates the inhibitory effect of cellobiose on endoglucanase activity by hydrolyzing the
substrate to glucose (Wood 1992, Henrissat et al. 1985).
Xylan, the main hemicellulose of hardwood, and galactoglucomannan, the main
hemicellulose of softwood, require several glycoside hydrolases as well as carbohydrate
esterases for complete depolymerization. The xylan backbone is hydrolyzed by fungal β-1,4-
endoxylanases; the released xylo-oligosaccharides are further degraded by β-1,4-xylosidases;
while arabinose, glucuronic acid, and acetyl groups are removed by α-arabinofuranosidases and
arabinoxylan arabinofuranohydrolases, α-glucuronidases, and acetyl xylan esterases, respectively
(van den Brink and de Vries 2011). The backbone of galactoglucomannan is hydrolyzed by β-
1,4-endomannases, and the oligosaccharides are further degraded from the ends by β-1,4-
mannosidase and β-1,4-glucanase. Side chain galactose and acetyl groups are removed by α-
galactosidases and acetyl esterases, respectively (Moreira and Filho 2008).
1.2.4 Lignin depolymerization by LiP and MnP
In P. chrysosporium, the lignin-degrading system includes the related oxidative enzymes,
lignin peroxidase (LiP) and manganese peroxidase (MnP) (Kersten and Cullen 2007). These
enzymes are members of the Class II peroxidases, which occur only in the Basidiomycetes. LiP
appears to have evolved only once in the order Polyporales, while MnP is present in at least four
orders of fungi, indicating that MnPs evolved first and prior to the splitting of these taxonomic
orders (Morgenstern et al. 2008).
LiP and MnP oxidize lignin structures to cation radicals, which then undergo non-
enzymatic reactions that result in lignin fragmentation (Eisenstadt and Bogolitsyn 2010). Both
are monomeric hemeproteins consisting of two domains with the heme embedded between them
(Wong 2009). The catalytic cycle involves the following steps (Fig. 1.2): In the first step, the
enzyme is subjected to two-electron oxidation by H2O2, which is supplied by fungal enzymes,
converting the peroxidase enzyme into the so-called Compound I. In Compound I, the iron is
12
oxidized to Fe (IV) and a free radical is stabilized by the tetrapyrrole ring of the heme prosthetic
group. In the second step, Compound I oxidizes a substrate molecule by one electron, yielding
Compound II. In Compound II, the iron remains in the Fe (IV) oxidation state, but there is no
longer a free radical on the tetrapyrrole ring. In step three, Compound II oxidizes a second
substrate molecule, reducing the iron in Compound II back to Fe (III), giving the resting state of
the enzyme (Eisenstadt and Bogolitsyn 2010). With excess H2O2 and the absence of reducing
substrate, the H2O2 can convert Compound II to Compound III, which is enzymatically inactive.
Additional reaction of Compound III with H2O2 can result in irreversible inactivation. However,
Compound III can be reverted to the resting state by oxidation with a cation radical, via the
displacement of superoxide from the active site (Timofeevski et al. 1998, Wong 2009, Barr and
Aust 1994).
Figure 1.2. Catalytic cycle of LiP and MnP showing oxidation of substrate (S). For MnP, the
substrate is Mn2+
. Adapted from (Wong 2009) with reference to (Barr and Aust 1994) and
(Timofeevski et al. 1998).
Step 1
Step 2
Step 3
13
The redox potential of LiP Compound I is approximately 1.2 V at optimum pH (3.0),
which enables it to directly oxidize a variety of phenolic and nonphenolic substrates (Kersten et
al. 1990). Phenolic substrates are oxidized more quickly but also result in a rapid decrease in
activity (Harvey and Palmer 1990). This decrease is likely due to the inability or inefficiency of
phenoxy radicals to revert LiP Compound III to the resting state, resulting in an accumulation of
inactive Compound III (Chung and Aust 1995). Protection of LiP from inactivation may be
provided by the aromatic compound veratryl alcohol and its cation radical, which act as ideal
substrates to convert Compound II and Compound III to the resting state, respectively (Wong
2009). Veratryl alcohol is a metabolite produced at the same time as LiP by P. chrysosporium,
and can also mediate the oxidation of additional substrates not normally oxidized by LiP (Wong
2009). In contrast with LiP, MnP oxidizes substrate molecules through a mediator, where Mn2+
is oxidized to Mn3+
, which in turn acts as a diffusible oxidizer of phenolic substrates (Wong
2009). The Mn2+
is obtained from the wood (Vicentim and Ferraz 2006), can be recycled after
oxidation of target molecules, and can also be substituted by other metal ions including Mg2+
,
Ca2+
, Cu2+
, Fe2+
, and Ni2+
, although these substitutions may result in lower activity (Urek and
Pazarlioglu 2004). Resultant Mn3+
is stabilized through chelation by α-hydroxy acids such as
oxalate and malonate (Wong 2009). These complexes have redox potentials of approximately 0.8
V at optimum pH (4.5) (Cui and Dolphin 1990), which is lower than that of LiP. The Mn3+
chelator complex is therefore not capable of oxidizing nonphenolic substrates, for which a
second mediator is required, such as lipids or thiols, including glutathione (Wong 2009). The
inactivation rate of MnP is approximately 1/10 that of LiP (Timofeevski et al. 1998, Wariishi and
Gold 1990), perhaps because Mn3+
produced by MnP can oxidise excess H2O2, as well as revert
Compounds III to the resting state (Timofeevski et al. 1998).
Clearly, to completely degrade lignocellulose, numerous diverse enzymes are required to
target the variety of chemical bonds in this complex substrate. Advances in molecular
technologies such as proteomics and transcriptomics have enabled the identification of these
enzymes or their transcripts, when produced by Phanerochaete under diverse cultivation
conditions. These abilities have contributed to our understanding of how genes that encode
lignocellulose-degrading activity are regulated in this genus.
1.3. Regulation of genes encoding ligninolytic activity
14
1.3.1 Gene expression in ligninolytic conditions
Pioneering studies realized that the major lignin-degrading components in P.
chrysosporium are lignin peroxidase (LiP), manganese peroxidase (MnP), and a H2O2-generating
system, which are induced during secondary metabolism in response to nutrient limitation, and
often promoted through oxygen purging and supplementation with veratryl alcohol (Kirk et al.
1984, Haemmerli et al. 1987, Leisola et al. 1987, Tien and Kirk 1983, Tien and Kirk 1984).
Biochemical analyses were later supported by molecular studies to show that under nitrogen
limitation, excess oxygen increases mnp transcript levels only in the presence of sufficient Mn2+
;
while even under Mn2+
deficiency, mnp transcript levels can be increased by higher
concentrations of H2O2 or various chemicals (peracetic acid, ethanol, sodium arsenite, 2,4-
dichlorophenol dissolved in N,N-dimethylformamide, and N,N-dimethylformamide; Li et al.
1995), or by heat shock (Brown et al. 1993).
In addition to the enzymes directly responsible for extracellular ligninolysis, various gene
products are upregulated in P. chrysosporium during ligninolytic conditions. In nitrogen-limited,
oxygen purged cultures, upregulated transcripts correspond to proteins related to nitrogen
starvation, including oligopeptide transporters (Wu and Zhang 2010, Vanden Wymelenberg et al.
2009); proteins related to stress response (Wu and Zhang 2010, Minami et al. 2009); signal
transduction (Wu and Zhang 2010, Minami et al. 2009, Minami et al. 2007), RNA processing
(Wu and Zhang 2010), post-translational modification (Wu and Zhang 2010, Vanden
Wymelenberg et al. 2009), and protein synthesis (Wu and Zhang 2010, Minami et al. 2007); as
well as proteases (Vanden Wymelenberg et al. 2009, Minami et al. 2007) and cytochrome P450s
(Vanden Wymelenberg et al. 2009, Minami et al. 2009). Membrane-associated proteins that are
upregulated in ligninolytic conditions have been identified by proteomic analysis of isolated
microsomal membrane fractions from P. chrysosporium RP-78 and quantitative real-time RT-
PCR of corresponding transcripts. Membrane-associated catalase, alcohol oxidase, two
transporters, and two cytochrome P450s are more abundant in ligninolytic compared to
nonligninolytic conditions (Shary et al. 2008). There are also a variety of transcripts with
unknown function that have been consistently identified in multiple studies of ligninolytic
conditions (Table 1.2).
15
Table 1.2. Transcriptomic and proteomic studies of Phanerochaete grown in ligninolytic conditions.
Sp
ecie
s an
d
stra
in
Ind
uct
ion
med
ium
Cu
ltu
re
con
dit
ion
s
Tim
e of
harv
est
Ref
eren
ce
Cu
ltiv
ati
on
Exp
ress
ion
an
aly
ses
Iden
tifi
ed
gen
es o
f
un
kn
ow
n
fun
ctio
n*
Cri
teri
a f
or
Over
exp
ress
ion
Ref
eren
ce
P.
chrysosporium
BKM-F-1767
nitrogen-
limited
medium
39°C
stationary
O2 flushing
Up to
144 h
metabolic
switch at 48,
56, and 64 h
Suppression
subtractive
hybridization
ND Upregulation of
transcripts
during
secondary
metabolism
(Wu and
Zhang 2010)
P.
chrysosporium
RP-78
nitrogen-
limited B3
medium;
carbon-
limited B3
medium
37°C
agitation
O2 flushing;
37°C
agitation
O2 flushing
5 days;
4 days
2 days in
replete B3
medium
microarray,
1D-GE and
LC-MS/MS
3779, 4201, 4736, 5517 >4-fold
transcript
accumulation in
N- or C-limited
medium
compared with
replete medium
(Vanden
Wymelenberg
et al. 2009)
P.
chrysosporium
RP-78
1% Basal
III; 1%
glucose, 400
M veratryl
alcohol, 10
mM atropine
37°C
stationary
O2 flushing
3 days 2 days (pre-
ligninolytic)
and 3 days
(ligninolytic)
without
atropine
LongSAGE
library
135, 451, 479, 592, 600, 606,
612, 930, 1224, 1257, 1403,
1597, 1823, 1903, 2311,
2874, 3069, 3238, 3434,
3657, 3713, 3784, 3806,
3862, 3914, 4565, 4599,
5430, 5584, 5685, 5697,
5783, 6094, 6107, 6170,
6662, 6669, 6854, 7056,
7193, 7370, 7403, 7423,
7826, 8348, 8363, 8427,
8666, 9086, 9262, 9594,
11068, 31868, 40438, 44155,
129135, 131939, 134667
transcripts with
similar
accumulation
patterns to
those encoding
ligninolytic
enzymes
(Minami et al.
2009)
16
P.
chrysosporium
CIRMBRFM41
Synthetic
medium
containing
glycerol
37°C
120 rpm
O2 flushing
4 days Synthetic
medium
containing
Pinus nigra
37°C
21 days,
stationary
2D-GE,
MALDI-
QTOF
8955 protein spots of
moderate
to high staining
intensity
(Ravalason et
al. 2008)
P.
chrysosporium
RP-78
Basal
medium,
0.4%
cellulose,
20 mM
ammonium
tartrate,
0.05%
Tween 20
37°C
150 rpm
66 h 1% glucose,
9 mM
ammonium
tartrate, 37°C,
200 rpm, 42 h
Membrane
enrichment,
LC-MS/MS
ND NA (Shary et al.
2008)
P.
chrysosporium
RP-78
Basal III
medium, 1%
glucose, 1.2
mM
ammonium
tartrate, 400
M veratryl
alcohol
37°C
stationary
O2 flushing
3 days 2 days (pre-
ligninolytic)
LongSAGE
library
600, 2527, 5118, 6153, 8427,
8666, 9269, 31868, 136628
>4-fold
transcript
accumulation in
ligninolytic
compared to
pre-ligninolytic
cultures
(Minami et al.
2007)
*Numbers correspond to protein IDs from the JGI P. chrysosporium genome portal (http://genome.jgi-psf.org/ Phchr1/Phchr1.home.html). Protein IDs
shown in bold were identified in multiple studies of P. chrysosporium cultivated in ligninolytic conditions; underlined IDs were also identified in
wood cultivations (see Table 1.5).
17
1.3.2 Role of calmodulin / cyclic AMP
The expression of ligninolytic enzymes in P. chrysosporium is regulated in part through
the secondary messenger systems of Ca2+
/calmodulin and cyclic adenosine monophosphate
(cyclic AMP, cAMP), which respond to nitrogen depletion. These interrelated messenger
systems participate in pathways that convert extracellular signals to cellular responses in a
variety of eukaryotic processes. In each case, extracellular factors interact with cell membrane
receptors to activate adenylate cyclase, which leads to increased production of cAMP or
increased Ca2+
concentrations inside the cell (Sharma and Kalra 1994). Ca2+
can bind to
calmodulin to regulate various target proteins, including the calmodulin-dependent forms of
adenylate cyclase (Means 2000).
In P. chrysosporium ME-446, there is an increase in both adenylate cyclase activity and
intracellular cAMP concentrations in response to nitrogen exhaustion (MacDonald et al. 1985).
A sharp rise in intracellular cAMP under low nitrogen conditions in P. chrysosporium BKM-F-
1767 precedes the accumulation of LiP and MnP transcripts (Boominathan and Reddy 1992).
MnP activity has also been found to increase in P. chrysosporium (strain not published) when
cAMP is added to the medium (Singh et al. 2011). Addition of the cAMP pathway inhibitors
atropine, theophylline, or histamine reduces the appearance of LiP and MnP transcripts in P.
chrysosporium BKM-F-1767. Atropine is an inhibitor of adenylate cyclase, theophylline inhibits
both adenylate cyclase and cAMP-dependent phosphodiesterase, and histamine results in the
degradation of cAMP. LiP is more sensitive to these inhibitors than MnP, and various LiP
isozymes have differing responses, suggesting that MnP and LiP, and the various isozymes, are
differentially regulated by cAMP (Boominathan and Reddy 1992).
To help deconstruct the cAMP pathway leading to the production of ligninolytic
enzymes, cDNA libraries were created from P. chrysosporium RP-78 exposed to atropine, the
adenylate cyclase inhibitor (Minami et al. 2009). Cultures were grown under low nitrogen
conditions with atropine added after two days of incubation. Long serial analysis of gene
expression (LongSAGE) libraries were created from RNA isolated at day 3, and compared to
libraries from control cultures at day 2 (pre-ligninolytic) and day 3 (ligninolytic). Among the
18
genes that showed similar expression patterns to those encoding ligninolytic enzymes were
calmodulin (CaM), and calcium- and CaM-responsive adenylate cyclase (Minami et al. 2009).
A relationship between ligninolytic enzyme production and CaM was solidified in P.
chrysosporium RP-78 using the CaM antagonist W-7, which binds calcium-loaded calmodulin to
block its messenger function. When W-7 was added to 2 day old cultures, there was a significant
decrease in the transcript abundance of 9 out of 10 lip and 3 out of 5 mnp genes at day 3
compared to control cultures. These expression profiles were similar to those of cultures with
added atropine. It was hypothesized that atropine inhibits CaM signaling, thereby inhibiting
cAMP signaling, or vice versa, to affect LiP and MnP production (Sakamoto et al. 2010).
To clarify the pathway between cAMP and CaM in P. chrysosporium RP-78, W-7 was
used in combination with exogenous cAMP and the xanthine derivative 3-isobutyl-1-
methylxanthine (IBMX), which inhibits the phosphodiesterase that catalyzes cAMP
decomposition in the cell. With added cAMP and IBMX, the abundance of transcripts encoding
CaM, seven LiP isozymes, and all MnP isozymes, increased significantly compared to control
cultures. Addition of W-7 along with cAMP and IBMX decreased the transcript abundances of
LiP and MnP without affecting intracellular cAMP concentrations. This suggests that cAMP
signaling induces the transcription of CaM, which then increases the transcription of lip and mnp
genes (Sakamoto et al. 2012).
1.3.3 Reactive oxygen species
While the production of LiP and MnP in P. chrysosporium responds to the starvation-
induced cAMP pathway described above, other distinct systems also play a role in the expression
of these enzymes. Higher oxygen concentrations result in greater amounts of some LiP isozymes
and the lip transcript lip-H2 in P. chrysosporium BKM-F-1767, without affecting intracellular
levels of cAMP (Belinky et al. 2003). This high oxygen concentration also leads to increased
formation of reactive oxygen species (ROS), including the highly reactive hydroxyl radical
(OH·). In situ production of OH· through the addition of Fenton reagents also leads to increased
abundance of lip-H2; while the OH· scavenger dimethyl sulfoxide (DMSO) inhibits this
transcript (Belinky et al. 2003). These results suggest that OH· acts as a second messenger to
increase the production of LiP in response to oxygen supplementation.
19
An increase in ROS in the form of superoxide (O2-) can also occur in Mn2+
-deficient P.
chrysosporium BKM-F-1767; and this metal deficiency also leads to an increase in lip-H2
transcripts. Mn2+
is a cofactor for the antioxidant enzyme superoxide dismutase (MnSOD),
which serves to transform O2- and protect the cell from oxidative stress. This enzyme has
significantly reduced activity (but similar transcript levels) under Mn2+
-deficient conditions and
the absence of this activity may explain the higher O2- concentrations. As with cultures exposed
to high oxygen levels, the presence of the OH· scavenger DMSO decreases the abundance of lip-
H2 transcripts in Mn2+
-deficient P. chrysosporium (Belinky et al. 2006). These results suggest
that OH· acts as second messengers to increase the production of LiP in response to either
oxygen supplementation or Mn2+
deficiency. However, the relationship between MnSOD or O2-
and OH· during regulation under Mn2+
deficiency remains unclear.
1.3.4 Promoter elements
While Mn2+
can suppress the expression of LiP in P. chrysosporium, it can enhance the
expression of MnP. In nitrogen-limited cultures of P. chrysosporium OGC101 (a derivative of
ME-446), high oxygen concentration leads to greater amounts of mnp transcript in the presence
of Mn2+
, whereas mnp transcripts are not identified under Mn2+
deficiency, regardless of oxygen
concentration (Li et al. 1995). A Mn2+
-responsive element was found in the P. chrysosporium
OGC101 mnp1 promoter by examining the effects of deletion, replacement, and translocation
mutations on promoter-directed expression of a reporter gene. The isolated promoter drove
expression only under Mn2+
-sufficient, nitrogen-limiting conditions; while replacement of a 48-
bp promoter fragment, or deletion of 33-bp at the fragment's 3' end, resulted in expression both
in the absence and presence of exogenous Mn2+
. By contrast, translocation of the 48 bp fragment
or deletion of 24 bp at its 5' end resulted in reporter expression patterns similar to those with the
wild-type promoter. These findings indicate that negative control is exerted within the 33 bp
region, and that control is released upon Mn2+
supplementation (Ma et al. 2004). The 33 bp
sequence contains two identical repeating sequences (GCGTTGGG) that conform to a binding
site for the AP-2 transcription factor (Godfrey et al. 1990), suggesting that AP-2 may play a role
in Mn2+
induction of mnp1 (Ma et al. 2004). Putative AP-2 binding sites are present in mnp-1
and multiple lip genes of P. chrysosporium (Dhawale 1993).
20
Promoter sequences from the mnp1 and mnp2 genes of P. chrysosporium OGC101 also
contain consensus sequences for metal response elements (MREs) similar to those found in
mammalian
metallothionein genes (Godfrey et al. 1990, Mayfield et al. 1994). The mnp1 gene
contains six of these elements, but mutations of two pairs of these sequences do not affect
reporter gene expression in response to Mn2+
supplementation. These MREs are therefore
unlikely to be involved in Mn2+
-dependent
regulation of mnp1 transcription (Ma et al. 2004).
Another metal responsive sequence, ACE, is present in the gene promoters for laccase
(lcs) and 2 MnPs (mnp1 and mnp2) in the white-rot basidiomycete Ceriporiopsis subvermispora.
The mnp1 sequence strictly conforms to the ACE consensus sequence of the yeast
Saccharomyces cerevisiae (HTHNNGCTGD), which is known to bind to the copper-responsive
transcription factor ACE1; The other elements are more similar to the copper-signaling element
(CuSE) of Schizosaccharomyces pombe. In C. subvermispora, copper increases transcript levels
of lcs, mnp1, and mnp2, and ACE elements from lcs and mnp2 bind to C. subvermispora ACE1
in vitro (Alvarez et al. 2009). A gene encoding ACE1 has been identified in P. chrysosporium
(Polanco et al. 2006), where it activates transcription of a multicopper oxidase-encoding gene,
mco1 (Canessa et al. 2008). However, ACE sequences have not been identified in P.
chrysosporium lip or mnp genes, and addition of copper sulfate to medium actually decreases
LiP activity in P. chrysosporium (Gassara et al. 2011).
Figure 1.3. Summary of pathways affecting LiP and MnP expression.
21
1.3.5 Transcript splicing
In addition to regulation of gene transcription, transcript splicing may play a role in
regulating the expression of ligninolytic enzymes in P. chrysosporium. RNA was isolated from
P. chrysosporium BKM-F-1767 after 0 or 20 days of growth in a wood-containing soil system,
or after 7 days of growth in liquid culture. RT-PCR targeted portions of four lip transcripts (lipA,
lipB, lipG, and lipJ) including introns 3–5, and found differential splicing by intron retention
(Table 1.3). As in-frame stop codons in transcripts with retained introns would prevent synthesis
of an active enzyme, the physiological significance of these splice variants is unknown
(Macarena et al. 2005). However, they may contribute to post-transcriptional gene regulation
through nonsense-mediated decay (Lareau et al. 2004). Similar incomplete transcripts are found
for P. chrysosporium mnp4 and multicopper oxidase (mco) genes (Macarena et al. 2005,
Larrondo et al. 2004) as well as in other organisms such as for sea bass interleukin-1 (Buonocore
et al. 2003).
Table 1.3. Splicing of lip transcripts in P. chrysosporium under various culture conditions.
transcript culture condition
wood and soil, 0 days wood and soil, 20 days liquid, 7 days
lipA mature mature
intron 5 retained
introns 3-5 retained
mature
lipB mature mature
introns 3-5 retained
mature
intron 4 retained
lipG mature mature introns 3-5 retained
lipJ intron 5 retained
introns 3-5 retained
introns 3-5 retained intron 4 retained
introns 4-5 retained
Table adapted from Macarena et al (2005).
Transcript splicing may also be involved in the post-transcriptional regulation of
cellulases. In P. chrysosporium ME-446, two genes that encode cellobiohydrolases (cbhI.1 and
cbhI.2) each contain two introns in the coding region. Splice variants that retain the 3' intron
22
were identified using RT-PCR, where the 3' PCR primers annealed within the 3' intron and the 5'
primers annealed to the exon sequences that span the 5' intron. The occurrence of splice variants
was substrate-specific, where P. chrysosporium grown for 2-5 days on amorphous cellulose
(carboxymethyl cellulose) or cellobiose produced only mature transcripts, while P.
chrysosporium grown for 2-5 days on microcrystalline cellulose (Avicel) or 4 days on ball-
milled straw produced both types of transcripts (Table 1.4). Since retention of the 3' introns
would alter the amino acid sequences of cbhI.1 and cbhI.2 within the cellulose-binding domains,
it was suggested that differential splicing in this case could be a mechanism used to alter the
substrate specificities of these cellulases (Birch et al. 1995).
Table 1.4. Splicing of cel transcripts in P. chrysosporium ME-446 under various culture
conditions.
transcript
culture condition
microcrystalline
cellulose
amorphous
cellulose
ball-milled
straw cellobiose
cbhI.1 mature
3' intron retained mature
mature
3' intron retained mature
cbhI.2 mature
3' intron retained mature
mature
3' intron retained mature
Table adapted from (Birch et al. 1995).
1.4. Gene expression during growth on wood
As white-rot basidiomycetes, Phanerochaete species are critical to the cycling of carbon
sequestered as woody biomass, and are predicted to encode many enzymes that can be harnessed
to promote the conversion of lignocellulosic biomass to sugars for fermentation to fuels and
chemicals. Enabled by advances in transcriptomic and proteomic technologies, recent studies of
gene expression in Phanerochaete include more examples using wood preparations, rather than
purified model substrates (Table 1.5). For instance, P. chrysosporium BKM-F-1767 grown on
red oak produces high numbers of transcripts encoding 78 proteins including polysaccharide
23
hydrolases, lignin-degrading enzymes, enzymes involved in peroxide generation, enzymes
involved in oxidative stress, proteases, as well as 25 proteins with unknown function (Sato et al.
2009). Proteases are also produced during nitrogen-limiting ligninolytic conditions. It has been
proposed that because nitrogen is the most limiting nutrient during growth on wood, proteases
generated in response to nitrogen limitation function to acquire nitrogen from proteins that are
present in the wood under natural conditions (Sato et al. 2007). Compared with growth in
medium containing glucose, P. chrysosporium RP-78 grown on aspen shows an over 4-fold
increase in 31 transcripts or peptides corresponding to glycoside hydrolases, oxidoreductases,
and 3 proteins of unknown function (Vanden Wymelenberg et al. 2010). P. chrysosporium
CIRMBRFM41, a peroxidase hypersecretory mutant strain, produces peptides corresponding to
glycoside hydrolases, copper radical oxidase, and four proteins of unknown function during
growth on black pine, which are not observed under ligninolytic (carbon-limited) conditions
(Ravalason et al. 2008). In contrast, expression patterns are very similar for P. chrysosporium
BKM-F-1767 grown on red oak or cellulose, although the intensity of some protein bands are
different, including higher abundance of xylanases in wood-grown cultures (Sato et al. 2007).
Transcripts encoding LiP and MnP are differentially regulated in aspen cultivations compared
with soil or defined media, with different isozymes prevailing under different conditions (Janse
et al. 1998). The current work on the softwood degrader P. carnosa reveals that transcript
classifications with significantly higher abundance during growth on wood are oxidoreductases,
peroxidases, monooxygenases, hydrolases, and glycosyl hydrolases (chapter 3; MacDonald et al.
2011). Similar to P. chrysosporium, P. carnosa produces comparable sets of secreted glycoside
hydrolases and oxidative enzymes when grown on white spruce or on cellulose. In this proteomic
study, P. carnosa was distinguished by the production of mannan-degrading enzymes and
oxidative enzymes that were not identified in proteomic analysis of P. chrysosporium; and 1229
peptides unique to P. carnosa grown on spruce could not be annotated (Mahajan and Master
2010).
Wood substrate preferences are known to exist among certain fungi, with most white-rot
species typically associated with hardwoods (angiosperms). A few studies have therefore
compared gene expression patterns of Phanerochaete during growth on different wood species.
P. chrysosporium RP-78 grown on bigtooth aspen, white pine, or glucose produced ten proteins
exclusively during growth on aspen, and 46 proteins exclusively during growth on pine. Putative
24
cytochrome P450s and an aryl alcohol dehydrogenase also accumulated during growth on pine
relative to aspen, although this difference was not considered to be significant (Vanden
Wymelenberg et al. 2011). In the current work, P. carnosa transcripts encoding cellulases and
hemicellulases were found to be more abundant during growth on pine compared to fir, spruce,
or maple; however, a gene set enrichment analysis indicated that the overall distributions of these
transcripts is similar in softwood and hardwood cultivations (chapter 3; MacDonald et al. 2011).
In addition, quantitative real-time RT-PCR (chapter 4) found that a transcript encoding
mannanase was significantly more abundant than one encoding xylanase during growth on the
same four species of wood, but that their levels were more similar during growth on maple. This
observation is consistent with an overall adaptation of P. carnosa to hemicelluloses that
predominate in softwoods, with some expression response to the higher xylan content in the
maple cultivations. Substrate-dependent differences were found for P. carnosa peroxidases,
where a lip transcript was significantly more abundant during growth on maple compared to the
three softwoods, while a mnp transcript was significantly more abundant during growth on
spruce compared to maple (chapter 4; MacDonald and Master 2012). In fact, the main
differences in expression between P. chrysosporium and P. carnosa during growth on wood
appear to involve the lignin-degrading enzymes: Transcripts encoding enzymes involved in
lignin degradation (peroxidases and H2O2-generating enzymes) are the most abundant gene
products isolated from P. carnosa grown on wood substrates (chapter 3; MacDonald et al. 2011),
while carbohydrate-active enzymes are more abundant in P. chrysosporium (Sato et al. 2009,
Vanden Wymelenberg et al. 2010).
Compared with simpler media, studies of gene expression and regulation during growth
on wood enables further understanding of lignocellulose bioconversion by Phanerochaete
species. These experiments show that regulation of gene sets under model conditions do not
always mimic the natural substrate; that different responses are likely elicited during growth on
different types of wood; and finally, they highlight additional proteins involved in metabolism of
wood components other than cellulose, hemicellulose, and lignin.
25
Table 1.5. Transcriptomic and proteomic studies of Phanerochaete grown on wood. S
pec
ies
an
d s
train
Ind
uct
ion
med
ium
Cu
ltu
re c
on
dit
ion
s
Tim
e of
harv
est
Ref
eren
ce
Cu
ltiv
ati
on
Exp
ress
ion
an
aly
ses
Iden
tifi
ed g
enes
of
un
kn
ow
n f
un
ctio
n*
Cri
teri
a f
or
Over
exp
ress
ion
Ref
eren
ce
P.
chrysosporium
RP-78
Highley‟s basal salt
medium, 0.5% ball-
milled Populus or
Pinus strobus
37°C
150 rpm
5 days Highley‟s
basal salt
medium,
0.5%
glucose
Microarray
s, LC-
MS/MS
3328, 131440 transcripts
with >2-fold
accumulation
in aspen or
pine compared
to glucose,
and detectable
proteins
(Vanden
Wymelenberg
et al. 2011)
P.
chrysosporium
RP-78
Highley‟s basal salt
medium, 0.5% ball-
milled Populus
37°C
150 rpm
5 days Highley‟s
basal salt,
with 0.5%
glucose
Microarray
s, 1D-GE
and LC-
MS/MS
2925, 131440,
138739
>4-fold
transcript
accumulation
in aspen-
versus
glucose-grown
cultures
(Vanden
Wymelenberg
et al. 2010)
P.
chrysosporium
BKM-F-1767
2 % Quercus rubra, 2
mM ammonium
tartrate,
37°C
stationary
O2
flushing
6 days ND 454 pyro-
sequencing
of cDNA
600, 612, 1270,
2925, 3559,
3593, 4690,
6153
Genes with 50
or greater
transcript tags
(Sato et al.
2009)
P.
chrysosporium
CIRMBRFM4
1
Synthetic medium,
25% Pinus nigra chips
37°C
stationary
21 days Synthetic
ligninolytic
medium,
120 rpm,
O2 flushing,
4 days
2D-GE,
MALDI-
QTOF
4028, 6079,
138739, 139777
protein spots
of moderate
to high
staining
intensity
identified on
softwood
(Ravalason et
al. 2008)
26
P.
chrysosporium
BKM-F-1767
50% Quercus rubra
sawdust, 1% millet,
0.5% wheat bran in
distilled water;
1% water-extracted
Quercus rubra in Basal
III medium
39°C
stationary;
37°C
stationary
O2
flushing
Up to
30 days
Basal III
medium, 1%
glucose or
cellulose
2D-GE
and
LC-
MS/MS
983, 29397 extra-cellular
proteins
from solid
red oak
cultivations
(Sato et al.
2007)
P.
chrysosporium
BKM-F-1767
50% Quercus rubra
chips, 1% millet, 0.5%
wheat bran in distilled
water;
1% water-extracted,
ground Quercus rubra
in Basal III medium
37°C
stationary;
37°C
stationary
O2
flushing
3
weeks;
6 days
- mass spec ND extracellular
protein gel
spots from
growth on
solid wood
substrate
(Abbas et al.
2005)
P.
chrysosporium
strain 20741
50% Quercus rubra
chips, 1% millet, 0.5%
wheat bran in distilled
water;
1% water-extracted,
ground Quercus rubra
in Basal III medium
39°C
stationary;
37°C
stationary
O2
flushing
various
time
periods
1% glucose
or cellulose
in basal III
medium
cDNA
library
sequencing
(13 unknown
ESTs,
protein IDs
not provided)
most abundant
transcripts
(Kim et al.
2010)
P. carnosa
HHB-10118-
sp
40 % ground Abies
balsamea, Pinus
contorta, Picea glauca,
or Acer saccharum in
B3 buffer
27°C
stationary
6-9
days
liquid
nutrient
medium
(YMPG)
mRNA-
Seq
256531(612,
68%),
257139(930,
44%),
249130(1903,
71%)
4 times
increase in
transcript
abundance
during growth
on wood
(chapter 3;
MacDonald et
al. 2011)
P. carnosa
HHB-10118-
sp
50% Picea glauca in
B3 medium
27°C
stationary
12
weeks
1% cellulose
in B3
medium,
4 weeks
1D-GE
and LC-
MS/MS
ND (Mahajan and
Master 2010)
27
Continue from Table 1.5 *Numbers correspond to protein IDs from the JGI P. chrysosporium genome
portal (http://genome.jgi-psf.org/Phchr1/Phchr1.home.html) or the P. carnosa genome portal
(http://www.jgi.doe.gov/Pcarnosa) with corresponding P. chrysosporium IDs and percent identities in
brackets. Protein IDs shown in bold were identified in multiple studies of Phanerochaete cultivated on
wood; underlined IDs were also identified in plant polysaccharide or ligninolytic cultivations (see Table
1.2).
In Phanerochaete, genes encoding lignin-modifying enzymes are known to be regulated
by nutrient limitation, oxygen, and metal ions. Often, the individual genes have been shown to
respond differently and independently to various conditions including the type of wood substrate.
The response of these genes to a variety of factors, working though multiple distinct pathways,
highlights the fact that any conclusions relating gene regulation in this genus to natural
conditions should be based on studies using multiple substrates. It also suggests that the various
lignin-modifying enzymes may have distinct roles in lignin degradation.
1.5 Justification and objectives of current research
The model white-rot fungus Phanerochaete chrysosporium has been intensively studied,
yet like most white-rot, its preference for growth on hardwood limits its potential use in
Canada‟s forest products industries, where most of the raw material comes from softwood.
Conversely, Phanerochaete carnosa has been isolated primarily from softwood (Burdsall 1985;
and see Appendix 2), and so enzymes from this fungus may be more applicable to Canada's
forest products industries. However, little is known about the biology of this organism. By
identifying genetic adaptations that promote softwood utilization by P. carnosa, new bioprocess
requirements for softwood fibre bioconversion may be revealed.
In an attempt to uncover such adaptations, the current work first identified and analyzed
genes and transcripts that encode lignocellulose-degrading activities in P. carnosa, using genome
and transcriptome sequencing. The hypotheses of the research were:
(1) Comparing the genome sequences of P. carnosa and the related hardwood-degrading
Phanerochaete chrysosporium will reveal differences that may contribute to differential substrate
28
preferences. This hypothesis was tested by sequencing the P. carnosa genome and comparing it
with that of P. chrysosporium.
(2) The expression profile of P. carnosa genes that encode lignocellulose-active enzymes will
depend on the source and composition of the lignocellulose substrate. This was tested using
transcriptome sequencing to detect the expression levels of all P. carnosa genes during growth
on four types of wood compared to a control substrate.
(3) Since the composition of lignocellulose substrates changes during decay, the level of
expression of genes that encode lignocellulose-active enzymes will change over the course of
lignocellulose degradation. This was tested using quantitative real-time RT-PCR to follow the
temporal expression of specific genes related to wood degradation during growth of P. carnosa
on four wood types.
Corresponding analyses lead to the discovery that P. carnosa differs from P.
chrysosporium in the number and expression levels of genes that encode lignin peroxidase (LiP)
and manganese peroxidase (MnP), two enzymes that modify lignin present in wood fiber. P.
chrysosporium has more genes for LiP and these are typically more highly expressed than its
genes for MnP. In contrast, P. carnosa has more genes for MnP with higher expression levels
than LiP. This distinction may allow P. carnosa to readily degrade the type of lignin found in
softwood.
Therefore, the last hypothesis was:
(4) Given the differences in lignin composition of wood fibre from hardwood and softwood
trees, lignin-degrading enzymes encoded by P. carnosa will be more effective at degrading
lignin from softwood trees than P. chrysosporium. This was tested by exposing hardwoods and
softwoods to MnP and LiP and determining the extent of lignin modification, and confirmed that
MnP is more effective at modifying softwood lignin.
Together, these results indicate that high expression of MnP contributes to effective
utilization of softwood by P. carnosa. This research has the potential to benefit the Canadian
forest products industry through enhanced delignification of softwood in the production of paper
and liquid biofuel, and lignin modification for the production of aromatic chemicals.
29
Chapter 2 Comparative genomics of P. carnosa and P. chrysosporium to
elucidate the genetic basis of the distinct wood types they colonize
Parts of this chapter have been submitted for publication in:
Suzuki H, MacDonald J, Khajamohiddin S, Salamov A, Hori C, Aerts A, Henrissat B,
Wiebenga A, vanKuyk PA, Barry K, Lindquist E, LaButti K, Lapidus A, Lucas S, Coutinho P,
Gong Y, Samejima M, Mahadevan R, Abou-Zaid M, de Vries RP, Igarashi K, Yadav JS,
Grigoriev IV, Master E. Comparative genomics of the white-rot fungi, Phanerochaete carnosa
and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize.
Submitted.
The P. carnosa genome was sequenced in collaboration with the Joint Genome Institute (JGI).
Two P. carnosa transcript samples were also sequenced using the Sanger and 454 EST methods
and were used as part of the automated genome annotation. J. MacDonald grew and harvested
fungal cultures; isolated high-quality, high-quantity genomic DNA and RNA; confirmed that the
P. carnosa isolate is homokaryotic (haploid); completed the manual annotation of genes that
encode enzymes involved in lignin degradation; and studied peroxidase evolution through
phylogenetics and intron distribution patterns. Genome sequencing, manual annotation of genes
that encode polyssaccharide-degradading enzymes and cytochrome P450s, and work relating to
UPLC analysis were completed by co-authors.
30
2.1. Introduction
Lignocellulose from wood is among the largest biomass resource that could be used for
the production of liquid fuel and other renewable chemicals (Lin and Tanaka 2006). The major
components of lignocellulose (cellulose, hemicellulose, and lignin) can be separated and
depolymerized by enzymes from the white-rot fungi, the only known organisms that can
effectively degrade all three components (Kirk and Farrell 1987).
Many of the white-rot fungi that have been most extensively studied to date were isolated
primarily from hardwood (angiosperm) trees (Nobles 1958). However, softwood (gymnosperm)
trees are among the most recalcitrant lignocellulosic feedstocks (Zhu and Pan 2010), and are also
the predominant form of land plant biomass in the Northern hemisphere (Galbe and Zacchi
2002). The recalcitrance of softwood lignocellulose to bioprocess technologies has been
attributed to its higher lignin content, smaller pore size, and fewer hemicellulose-derived acetyl
groups (Palonen et al. 2004). Accordingly, Phanerochaete carnosa, a white-rot fungus that has
been found growing almost exclusively on softwood (Burdsall 1985), might encode enzymes that
could be developed to reduce the recalcitrance of softwood resources.
Key requirements for the biotransformation of particular biomass resources could be
elucidated through comparative analysis of closely related lignocellulose-degrading fungi having
different substrate preferences. For instance, genomic comparison of P. chrysosporium and the
softwood-degrading, model brown-rot fungus, Postia placenta, revealed that brown-rot is
characterized by the contraction of multiple gene families, including cellobiohydrolases and
cellulose-binding domains (Martinez et al. 2009). Moreover, comparative analysis of Aspergillus
genomes identified correlations between genome content, plant polysaccharide degradation, and
respective biotope (Coutinho et al. 2009). Given the apparent differences in substrate preference
of P. carnosa and P. chrysosporium, and their phylogenetic similarity based on internal
transcribed spacer (ITS) region sequences (de Koker et al. 2003), it is anticipated that
comparative analysis of P. carnosa and P. chrysosporium genomes could reveal enzymes and
metabolic pathways that are key to efficient biotransformation of recalcitrant softwood
feedstocks. Accordingly, the present study reports the first analysis of the P. carnosa draft
genome, and compares P. carnosa and P. chrysosporium in terms of genome composition and
organization, as well as growth on model and woody substrates. Comparative genome analysis
31
revealed expansion of genes encoding MnPs and P450s in P. carnosa compared to P.
chrysosporium, which may facilitate utilization of softwood by P. carnosa.
2.2. Materials and Methods
2.2.1 Nucleic acid isolation and sequencing
Phanerochaete carnosa strain HHB-10118-sp was obtained from the U.S. Department of
Agriculture (USDA) Forest Products Laboratory (Madison, WI). The strain was grown on liquid
YMPG or solid wood medium in 1000 mL Erlenmeyer flasks under stationary conditions at 27
°C for 31 days. Liquid cultivations included 500 mL of YMPG medium consisting of 2 g yeast
extract, 10 g malt extract, 2 g peptone, 10 g glucose, 2 g KH2PO4, 1 g MgSO4·7H2O, 1 g
asparagine per 1 L in H2O. Wood cultivations were prepared by using a blender to grind balsam
fir (Abies balsamea), lodgepole pine (Pinus contorta), or white spruce (Picea glauca), and 60 g
of each type of ground wood were combined with 200-250 mL B3 buffer medium (2 g KH2PO4,
0.5 g MgSO4·7H2O, 0.1 g CaCl2·2H2O, 0.73 g 2,2-dimethylsuccinic acid, 0.5 mg thiamine-HCl,
0.2 g ammonium tartrate, and 10 mL mineral solution per 1 L in H2O, pH to 4.5) (Kenealy and
Dietrich 2004). Mineral solution contained 1.5 g nitrilotriacetate, 0.5 g MnSO4, 1 g NaCl, 100
mg FeSO4-7H2O, 100 mg CoSO4, 100 mg ZnSO4, 10 mg CuSO4-5H2O, 10 mg AlK(SO4)2, 10
mg H3BO3, and 10 mg NaMoO4 per 1 L H2O. Thiamine-HCl, ammonium tartrate, and 2,2-
dimethylsuccinic acid were added as filter-sterilized solutions. All other media were steam
sterilized for 20 to 30 min. Flasks were inoculated with 3 mL of blended P. carnosa liquid
YMPG culture. To harvest, fungal mats were removed from the top of the cultures and any
excess wood pieces were removed by hand. Mycelia were squeezed through Miracloth to remove
excess liquid, then flash-frozen in liquid nitrogen and stored at -80°C.
Genomic DNA was extracted from P. carnosa grown on liquid YMPG medium using a
protocol adapted from (Raeder and Broda 1985). Total RNA from P. carnosa grown on YMPG
medium was extracted using the TRIzol Plus RNA Purification kit (Invitrogen). Total RNA from
P. carnosa grown on solid wood medium was extracted using the RNeasy Plant Mini Kit
(Qiagen Inc., Mississauga, ON, Canada) according to the manufacturer's protocol for plant
tissues and filamentous fungi, and including the optional on-column DNase digestion. In both
cases, samples were further purified by precipitation with lithium chloride.
32
The P. carnosa genome was sequenced by the JGI using a combination of Sanger, 454,
and Illumina sequencing platforms, and assembled using Newbler (Sanger and 454) and Velvet
(Illumina). cDNA libraries were sequenced by Sanger and 454 methods. The genome was
annotated using the JGI annotation pipeline, which takes multiple inputs (scaffolds, ESTs, and
known genes) and runs several analytical tools for gene prediction and annotation.
2.2.2 Microscopy
P. carnosa mycelia grown in liquid YMPG were transferred to a glass slide, covered, and
stained with 10 mg/mL Congo Red dye before viewing under a light microscope at 160 x.
2.2.3 Single copy gene sequencing
PCR was performed using AccuPrime Pfx DNA polymerase and Reaction Mix
(Invitrogen) with 160 ng of genomic DNA and 12.5 pmol of each primer in a 25 µL reaction
volume. Primers for amplification of cdh (5'-TCKGARGCHGGVAAGAARGT-3' and 5'-
GGVCCRATVCCGCTYTGGAA-3') were designed based on conserved sequences from six
Basidiomycete fungi, and the PCR cycle was run as follows: 95°C for 9 min, 30 cycles of (95°C
for 1 min, 50°C for 2 min, 72°C for 2 min), and 72°C for 15 min. Primers for amplification of
fet3/ftr1 (5'-TGGACGATCTGGAACTTGTG-3' and 5'-TCTCACGGAAGACGATGAAG-3')
were based on the corresponding P. chrysosporium sequence, and the PCR cycle was run as
follows: 95°C for 9 min, 30 cycles of (95°C for 1 min, 65°C for 2 min, 72°C for 3 min), and
72°C for 15 min. Amplified sequences were cloned into the pCR2.1-TOPO plasmid (Invitrogen)
and transformed colonies were sequenced to enable differentiation between any alleles.
2.2.4 Prediction of FOLymes and oxidoreductases
The blastp algorithm available through the JGI Fungal Genomics Program website
(http://genome.jgi-psf.org/programs/fungi/index.jsf) was used with default settings to search
Agaricomycotina gene catalogue proteins against reference proteins. Hits were then blasted
against the National Center for Biotechnology Information database (NCBI;
http://blast.ncbi.nlm.nih.gov/Blast.cgi) with default settings, and aligned to the reference protein
sequences using the tool at the Genestream Bioinformatics Resource server
33
(http://xylian.igh.cnrs.fr/bin/align-guess.cgi). Sequences were annotated to the reference protein
when the bests hits to NCBI represented sequences of interest and the alignment showed at least
30% amino acid identity to the reference protein. Reference proteins correspond to the following
Genbank accession numbers: LO1 (laccase) LAC2_PLEOS, LO2 (peroxidases) LIG8_PHACH,
LO3 (cellobiose dehydrogenase) CDH_PHACH, LDA1 (aryl alcohol oxidase) AAC72747,
LDA2 (vanillyl-alcohol oxidase) VAOX_PENSI, LDA3 (glyoxal oxidase) AAA33747, LDA4
(pyranose oxidase) P2OX_PHLGI, LDA5 (galactose oxidase) XP_959153, LDA6 (glucose
oxidase) GOX_ASPNG and XP_002910108, LDA7 (benzoquinone reductase) AAD21025,
LDA8 (alcohol oxidase) AAB57849, methanol oxidase ALOX_PICAN, Quinone reductase
AF465406.
2.2.5 Phylogenetics
Gene models predicted to encode manganese peroxidase (MnP) and lignin peroxidase
(LiP) were aligned using ClustalW within Biology Workbench 3.2 (http://workbench.sdsc.edu)
using the following parameters: gap open penalty = 15, gap extension penalty = 0.2, and delay
divergent sequences = 30%. Bayesian trees were constructed using MrBayes 3.1 (Huelsenbeck et
al. 2001, Ronquist and Huelsenbeck 2003) assuming the general time-reversible model for DNA
sequence evolution, with gamma-distributed rate variation across sites. Phylogenetic trees were
sampled every 100 generations until the average standard deviation of split frequencies was
below 0.01, which occurred at 2,160,000 generations. The first 25% of trees were discarded as
burn-in, and the remaining trees were used to calculate a 50% majority rule consensus tree rooted
with a cytochrome c peroxidase (CCP) from Saccharomyces cerevisiae. CCP belongs to the class
I peroxidases, while MnP and LiP belong to class II (Morgenstern et al. 2008, Welinder 1992).
Alignments to determine percent identity of peroxidase upstream sequences were
performed by ClustalW within Biology Workbench 3.2 (http://workbench.sdsc.edu) using the
following parameters: gap open penalty = 15, gap extension penalty = 0, delay divergent
sequences = 30%.
2.2.6 Prediction of polysaccharide-degrading activity and P450s
34
Genes encoding enzymes predicted to be involved in polysaccharide degradation were
manually searched in the P. carnosa assembly database using TBLASTN, with query sequences
obtained from the Phanerochaete chrysosporium genome database (http://genome.jgi.doe.gov/
Phchr1/Phchr1.home.html). Genes encoding putative cytochrome P450s were identified by
searching the P. carnosa JGI database for the term „P450‟. These sequences were searched with
BLAST for the presence of the conserved P450 signature domains, namely the oxygen-binding
motif „EXXR‟ and the heme-binding motif „CXG‟. Sequences with both of these domains were
grouped into families, subfamilies, and clans based on existing nomenclature criteria for amino
acid identity or based on phylogenetic alignment with P450s from P. chrysosporium
(Doddapaneni et al. 2005).
2.2.7 Wood extractive analysis
P. carnosa and P. chrysosporium were cultivated in triplicate on heartwood and sapwood
from sugar maple (Acer saccharum), yellow birch (Betula alleghaniensis), trembling aspen
(Populus tremuloides), red spruce (Picea rubens), white spruce (Picea glauca), balsam fir (Abies
balsamea), and red pine (Pinus resinosa). Four grams of wood powder that passed through a 2
mm sieve but was retained by a 0.425 mm sieve were placed on top of 5 g vermiculite powder in
a glass Petri dish measuring 9 cm in diameter with 20 mL of H2O and autoclaved. Plates were
inoculated with YMPG-agar plugs and incubated at 27˚C. Wood extractives were isolated from
test plates or non-treated wood samples using an accelerated solvent extraction method
(DIONEX, application note 335) and analyzed using ultra performance liquid chromatography
(UPLC) with an autoscan photodiode array spectrophotometer detector fixed at 280 nm and 350
nm to monitor the eluting peaks. Resolved peaks were scanned by the photodiode array detector
from 240 to 460 nm. Total phenolic concentration was determined by Folin-Ciocalteau
colorimetry (Waterhouse 2002).
2.3 Results and Discussion
2.3.1 Confirming homokaryosis
Basidiomycetous fungi can exist as homokaryons, with one haploid genome, or as
heterokaryons, with more than one haploid genome segregated in multiple nuclei within each cell
35
(reviewed in Schmidt 2006). DNA from homokaryons (as opposed to heterokaryons) is easier to
sequence and annotate because the genome size is smaller and it does not contain several alleles
for the same gene. Prior to genome sequencing, evidence was acquired suggesting that the
Phanerochaete carnosa strain HHB-10118-sp is homokaryotic, through microscopy and single-
copy gene sequencing.
Observation of P. carnosa mycelium through a light microscope (160x magnification)
showed no evidence of clamp connections - structures produced by heterokaryons during cell
division (Schmidt 2006). The absence of clamp connections suggested that the culture is
homokaryotic (Fig. 2.1).
Figure 2.1. Absence of clamp connections suggests homokaryosis. A. Representative light
microscope image of P. carnosa mycelia. Arrows point to cell borders, which lack clamp
connections. B. Clamp connection of a related Basidiomycete fungus. Source: the American
Phytopathological Society, http://www.apsnet.org/education/IllustratedGlossary
36
Single-copy genes should be present as single sequences in homokaryons, and as multiple
sequences representing different alleles in heterokaryons. In P. chrysosporium, cellobiose
dehydrogenase (cdh) is a single-copy gene with distinct allelic sequences (Li et al. 1997). To
determine whether P. carnosa strain HHB-10118-sp is homokaryotic, a 924 bp cdh fragment was
amplified from P. carnosa genomic DNA and eight clones were sequenced. No mismatches
between these sequences were observed, suggesting that this strain is in fact homokaryotic. The
corresponding 907 bp cdh fragment in P. chrysosporium has 30 mismatches between the two
alleles.
Multicopper ferroxidase (fet3) and iron permease (ftr1) are also present as single-copy
genes in P. chrysosporium, flanking a 0.8 kb intergenic region (Larrondo et al. 2007). PCR was
used to amplify from P. carnosa a 1230 bp fragment comprising part of the fet3 gene, part of the
ftr1 gene, and the intergenic region between them. The intergenic region in particular should
vary between alleles of a heterokaryon; however, the eight sequenced clones contained no
mismatches. These results further suggest that the P. carnosa strain is homokaryotic.
2.3.2 Prediction of FOLymes and oxidoreductases
The Foly database classifies enzymes with potential involvement in the degradation of
lignin and related aromatic compounds (Levasseur et al. 2008). Enzymes that may act directly on
lignin (the lignin oxidases, LO) include peroxidases (FOLy LO2), laccases and related
multicopper oxidases (FOLy LO1), and cellobiose dehydrogenases (FOLy LO3).
The most striking difference in lignin-degrading activities encoded by P. carnosa and P.
chrysosporium was the distribution of predicted manganese peroxidases (MnP) and lignin
peroxidases (LiP) (Table 2.1). The P. carnosa genome encodes eleven Class II peroxidases:
seven MnPs (Pcarn256980, 144982, 256984, 256991, 256997, 94399, 262882) and four LiPs
(Pcarn212237, 263501, 213241, 152156). By comparison, P. chrysoporium has five mnp genes
and ten lips, suggesting that the two species may rely more heavily on different types of
peroxidases for lignin decay. Six of the seven P. carnosa mnp genes are physically clustered on
scaffold 5 (except Pcarn262882), and three of the four lips are closely linked on scaffold 10
(except Pcarn212237).
37
In addition to Class II peroxidases, the P. carnosa genome contains multicopper oxidases
(MCO), cellobiose dehydrogenase, and related genes. As in the case of P. chrysosporium, in P.
carnosa there appear to be no laccases sensu stricto. Among nine clear MCO-encoding genes are
a conventional ferroxidase (fet3; Pcarn141262), and seven genes with strong similarity (>65% aa
ID) to P. chrysosporium mco4 (Pchr10581): these include Pcarn261553, 261563, 149761,
100787, 100639, 149824, 186926, and all seven of them are linked on scaffold 8. Two additional
genes, Pcarn261609 and 60261, are more closely related to P. chrysosporium mco3 and mco2,
respectively. While only two of these MCO-encoding genes, Pcarn141262 (fet3) and
Pcarn100639 (mco4), appear to be upregulated during growth on wood substrate (chapter 3;
MacDonald et al. 2011), recent work with a Phanerochaete flavido-alba MCO shows that some
members of the ferroxidase/laccase group may in fact have laccase activities (Rodriguez-Rincon
et al. 2010). A P. carnosa cellobiose dehydrogenase (cdh: Pcarn259608) and ortholog to the
related cir1 (Pcarn161126) are also present in the genome and were both upregulated during
growth on wood substrate (chapter 3; MacDonald et al. 2011).
Various enzymes are proposed to supply the H2O2 required for oxidase activity, the most
well established of which is glyoxal oxidase (GLOX, FOLy LDA3), where the glyoxal substrate
can be derived from fragmented lignin (Kersten 1990). The P. carnosa genome contains one glox
gene (Pcarn258261) and five related copper radical oxidases (cro: Pcarn123913, 259359,
143144, 263533, 263528), compared to one glox and six related cro in P. chrysosporium.
Pcarn123913, 259359, and 143144 are most closely related to cro1, cro2, and cro6 of P.
chrysosporium (Pchr259359, Pchr123913, Pchr258261), respectively. Pcarn263533 and 263528
are equally related to cro3, cro4, and cro5, and these contain repeated WSC domains of unknown
function. These two WSC-containing cros are found within the lip physical gene cluster on
scaffold 10. One of these, Pcarn263528, and the glox gene Pcarn258261, were upregulated
during growth on wood substrate (chapter 3; MacDonald et al. 2011).
38
Table 2.1. Summary of oxidoreductases potentially involved in lignocellulose degradation by
P. carnosa (Pcar) and P. chrysosporium (Pchr).
Putative Function EC
Class
# Pcar Pcar IDs #Pchr Pchr IDs Ref.
Gene
Peroxide generation
Methanol oxidasea
1.1.3.13 4 252324,
121157,
126707,
213078
3 126879,
5574, 6010
ALOX_
PICAN
Aryl alcohol oxidasea
1.1.3.7 4 260543,
100299,
132559,
147295
3 37188,
135972,
6199
AAC72
747
Glucose oxidasea
1.1.3.4 0 / 1 - / 179599 0 / 1 - / 6270 GOX_A
SPNG /
XP_002
910108
Pyranose-2-oxidase 1.1.3.10 0 - 1 137275
P2OX_
PHLGI
Glyoxal oxidase - 1 258261 1 11088 AAA33
747
Copper radical oxidase - 5 123913,
259359,
143144,
263533,
263528
6 259359,
123913,
258261,
8882,
121730,
121818
Iron reduction and homeostasis
Quinone reductasea
1.6.5.5 3 254412,
114036,
141788
4 121028,
129887,
10307,
139901
AF4654
06
Glycoprotein iron
reductase
- 3 249086,
169427,
258034
2 AB236889
AB236890
Cellobiose
dehydrogenase
1.1.99.1
8
2 259608,
161126 2 11098, 147 CDH_P
HACH
39
Iron ferroxidase 1.16.3.1 1 141262
1 26890
Lignin modification
Lignin peroxidase 1.11.1.1
3
4 263501,
213241,
212237,
152156
10 10957,
121822,
131738,
6811,
11110,
122202,
8895,
121806,
131707,
131709
LIG8_P
HACH
Mn peroxidase 1.11.1.1
6
7 262882,
256980,
94399,
256984,
256997,
256991,
144982
5 140708,
3589, 878,
8191, 4636
LIG8_P
HACH
Chloroperoxidaseb
1.11.1.1
0
3 263009,
249438,
254678
1 1710
Laccase 1.10.3.2 0 - 0 -
abest hit and ≥30% amino acid identity with reference gene;
bcontains chloroperoxidase Interpro domain.
2.3.3 Peroxidase evolution
A phylogenetic tree was made to infer the relationships between Class II peroxidases of
P. carnosa and P. chrysosporium. Tree topology indicated gene expansion after P.
chrysosporium and P. carnosa speciation, and suggests that the common ancestor of P. carnosa
and P. chrysosporium may have had three mnp genes (Fig. 2.2). It appears that P. carnosa
retained three ancestral mnps and expanded one of them by four copies, to make five in a
phylogenetic cluster: Pcarn256980, 256984, 256991, 256997, and 94399. These five mnps are
included in the physical mnp gene cluster on scaffold 5, and also share 52 to 80 percent identity
in the 150 bp upstream of the start site, while this identity ranged from 38 to 80 percent for all P.
40
carnosa mnps. However, members of all three of the more divergent P. carnosa phylogenetic
mnp clusters had high transcript levels when grown on various wood substrates (chapter 3;
MacDonald et al. 2011). By contrast, P. chrysosporium appears to have lost two of the three
ancestral genes, including the one expanded by P. carnosa, and expanded the remaining gene by
four copies. The tree also suggests that the common ancestor of P. carnosa and P. chrysosporium
had at least three lip genes (Fig. 2.3). Only one of these appears to have been retained by P.
carnosa, and expanded by three copies for a total of four lip genes, which share 39 to 60 percent
identity in the 150 bp upstream of the start site. In contrast, P. chrysosporium retained many
ancestral lips and expanded one of them by five copies for a total of ten lip genes.
An analysis of intron distribution shows the existence of up to seven conserved intron
positions in the coding regions of P. carnosa and P. chrysosporium mnp genes, and up to ten
conserved intron positions in the coding regions of the lips. Most of these genes have lost one or
two introns, suggesting a role for retrotransposition in gene expansion. If the phylogenetic tree
topology is correct, it suggests that loss of specific introns sometimes occurred coincidentally.
Exceptions include P. carnosa lip genes Pcarn263501 and 213241, which phylogenetically are
most closely related to each other, and are both missing the seventh intron only; P.
chrysosporium lip genes A, B, E, G, H, and I, which are also phylogenetically clustered, and are
all missing the seventh and eighth introns only; and P. chrysosporium mnp genes 1 and 4, which
are both missing the third intron only.
41
Species Protein
ID
Position Introns Alternative
Name*
P. carnosa 144982 5:3175629-3177912 1-2-3-4-5-6-7 1138
P. carnosa 256991 5:3189583-3192656 1- 3-4-5-6-7 31
P. carnosa 256980 5:3167371-3169157 1- 3-4-5-6-7 383+789
P. carnosa 94399 5:3208808-3210366 1-2-3-4-5-6-7 1168
P. carnosa 256997 5:3195944-3197614 1-2-3-4-5-6-7 1579
P. carnosa 256984 5:3180144-3181864 1-2-3-4-5-6-7 697
P. carnosa 262882 10:495184-496977 1-2- 4-5-6-7 45
P. chrysosporium 878 1:2814195-2815673 1- 3-4-5-6-7 mnp3
P. chrysosporium 140708 15:846535-848049 1-2- 4-5-6-7 mnp1
P. chrysosporium 8191 15:853637-855322 1-2- 4-5-6-7 mnp4
P. chrysosporium 3589 5:505970-507645 1-2-3-4-5-6-7 mnp2
P. chrysosporium 4636 7:1395073-1396542 1-2-3- 5-6-7 mnp5
Figure 2.2. Phylogeny, genome position, and intron distribution of genes encoding manganese
peroxidases of P. carnosa and P. chrysosporium. * P. carnosa from Chapter 3 (MacDonald et al.
2011); P. chrysosporium from (Vanden Wymelenberg et al. 2006a).
42
Species Protein ID Position Introns Alternative
Name*
P. carnosa 263501 10:1969940-1971733 1-2-3-4-5-6- 8-9-10 9
P. carnosa 213241 10:1976572-1979063 1-2-3-4-5-6- 8-9-10 489
P. carnosa 152156 10:2018444-2020054 1-2-3-4-5-6-7-8-9-10 8106
P. carnosa 212237 9:404873-406916 2-3-4-5-6-7-8-9-10 9982+9983
P. chrysosporium 10957 19:373851-375408 1-2-3-4-5-6- 9-10 lipA
P. chrysosporium 131707 19:451627-454927 1-2-3-4-5-6- 9-10 lipI
P. chrysosporium 121822 19:376752-378294 1-2-3-4-5-6- 9-10 lipB
P. chrysosporium 11110 19:358710-360433 1-2-3-4-5-6- 9-10 lipE
P. chrysosporium 8895 19:448641-450192 1-2-3-4-5-6- 9-10 lipG
P. chrysosporium 121806 19:441862-443404 1-2-3-4-5-6- 9-10 lipH
P. chrysosporium 131738 19:393154-394751 1-2-3-4-5-6-7- 9-10 lipC
P. chrysosporium 122202 9:1444920-1446516 1-2-3-4-5-6- 8-9-10 lipF
P. chrysosporium 131709 19:439914-441504 1-2-3-4-5-6-7-8- 10 lipJ
P. chrysosporium 6811 11:1416506-1418221 2-3- 5-6-7-8-9-10 lipD
Figure 2.3. Phylogeny, genome position, and intron distribution of genes encoding lignin
peroxidases of P. carnosa and P. chrysosporium. * P. carnosa from Chapter 3 (MacDonald et al.
2011); P. chrysosporium from (Vanden Wymelenberg et al. 2006a).
2.3.4 Prediction of polysaccharide-degrading activities and P450s
The JGI annotation pipeline predicted 13,937 genes for P. carnosa. Overall, the
distribution of CAZymes in P. carnosa is similar to the average number found in other fungi.
However, P. carnosa possesses one of the largest P450 contingents (244 P450s) among the
sequenced and annotated wood-rotting basidiomycetes, much larger than that of P.
chrysosporium (149 P450s) and somewhat larger than that of the brown rot fungus P. placenta
(236 P450s). In comparison to the hardwood-degrading white rot species P. chrysosporium, this
softwood-degrading species showed large expansions of P450s across several clans (CYP52,
CYP53, CYP64, CYP67, CYP503, CYP534 and CYP547), where CYP64 showed the largest
expansion in P. carnosa (114 P450s) as compared to P. chrysosporium (61 P450s). Family and
sub-family comparison showed a slight expansion in number of families (2 families) and sub-
43
families (1 subfamily) in P. carnosa. It was recently reported that some of the P450 genes in P.
chrysosporium and P. placenta were upregulated in pine culture compared to aspen culture
(Vanden Wymelenberg et al. 2011). These observations support the involvement of P450s in
softwood degradation with respect to removal of lignin and extractives, although completeness
of lignin degradation is substantially different in P. placenta compared to white rot fungi.
2.3.5. Wood extractive analysis
The phenolic component of extractives in sapwood and heartwood samples cultivated
with P. carnosa and P. chrysosporium was analyzed by UPLC before and after fungal
cultivation. The concentration of phenolics in sapwood samples decreased by 30 to 60 %,
depending on the wood species, and did not differ between samples cultivated with P. carnosa
and P. chrysosporium. By contrast, the concentrations of phenolics in heartwood samples were
more variable after fungal cultivation. In particular, the transformation of phenolics present in
heartwood from white spruce and balsam fir was higher for P. carnosa compared to P.
chrysosporium, which is consistent with growth of P. carnosa on softwood species. Neither P.
carnosa nor P. chrysosporium appeared to transform heartwood phenolics that were present in
aspen and red pine, even though P. carnosa grew on both of these heartwood preparations, and
P. chrysosporium grew on aspen heartwood. Notably, sterile controls of aspen and red pine
contained comparatively low phenolic content, which might have facilitated the colonization of
these fungi.
2.4. Conclusions
Whole genome sequencing of P. carnosa revealed that this white rot fungus encodes a
similar complement of carbohydrate-active enzymes as P. chrysosporium. In contrast, the
distribution of MnP and LiP oxidoreductases in P. carnosa and P. chrysosporium differs, where
P. carnosa encodes more MnPs than LiPs and the reverse is true for P. chrysosporium. These
differences could affect the decomposition of softwood and hardwood lignins by the two species.
The P. carnosa genome also represents the largest expansion of P450 monooxygenase genes that
has been reported to date. Given that P. carnosa removes a higher proportion of phenolic
extractives in heartwood samples of softwood than does P. chrysosporium, this P450 expansion
may also contribute to improved softwood degradation through removal of extractives from
44
coniferous heartwood. In support of these hypotheses, similar trends are seen with the white-rot
fungus Ceriporiopsis subvermispora; this species also encodes more MnPs than LiPs and has an
expansion of genes encoding P450 monooxygenases relative to P. chrysosporium (Fernandez-
Fueyo et al. 2012). C. subvermispora has been isolated roughly equally from hardwoods and
softwoods (Center for Forest Mycology Research, Forest Products Laboratory, Madison, WI -
http://www.fpl.fs.fed.us/search/mycology_request.php); and has been shown to consume loblolly
pine, a softwood, with similar efficiency as birch or aspen, but at a faster rate than P.
chrysosporium, which acts more efficiently on the hardwoods (Blanchette et al. 1992, Otjen and
Blanchette 1987). Overall, complete genome sequencing of P. carnosa and comparative analysis
with P. chrysosporium suggested a role for P450s and lignin-degrading peroxidases in softwood
colonization, while less divergence was found in the CAZymes of the two species.
45
Chapter 3 Transcriptomic responses of P. carnosa during growth on
coniferous and deciduous wood
Parts of this chapter are published in:
MacDonald J, Doering M, Canam T, Gong Y, Guttman DS, Campbell MM, Master ER (2011)
Transcriptomic responses of the softwood-degrading white-rot fungus Phanerochaete carnosa
during growth on coniferous and deciduous wood. Applied and Environmental Microbiology
77(10):3211-3218.
J. MacDonald grew and harvested fungal cultures; isolated high-quality RNA for mRNA-Seq;
confirmed mRNA-Seq patterns of six transcripts using RT-qPCR; annotated genes involved in
lignin degradation; made a phylogenetic tree of peroxidases; and wrote much of the text.
Automated transcript annotation, gene set enrichment analyses, and CAZyme annotations were
performed by co-authors.
46
3.1. Introduction
While the majority of white-rot fungi characterized to date effectively degrade hardwood,
Phanerochaete carnosa is a white-rot fungus that has been found growing almost exclusively on
softwood (Burdsall 1985). Previous analyses of proteins secreted by P. carnosa grown on spruce
and cellulose identified peptides corresponding to enzymes involved in lignocellulose
degradation, including cellulases, xylanases, glyoxal oxidases (GLOX), and peroxidases
(Mahajan and Master 2010). Notably, many of the peptide sequences recovered in the proteomic
analysis of P. carnosa matched conserved regions of multigene families, so the contributions of
specific genes could not always be determined (Mahajan and Master 2010). The emergence of
high-throughput methods for transcriptome analysis (Wang et al. 2009) opens the door for in-
depth exploration of the contributions of specific genes to degradation of softwoods by P.
carnosa.
The current study reports the first transcriptome analysis of the softwood-degrading
white-rot fungus P. carnosa. This study also represents the first application of next-generation
RNA-sequencing technologies (mRNA-Seq) to directly compare the transcriptomes of a wood-
degrading basidiomycete grown on multiple wood samples, including balsam fir, lodgepole pine,
white spruce, and sugar maple. By analyzing P. carnosa gene expression following growth on
softwood (fir, pine, and spruce) and hardwood (maple) substrates and by comparing patterns of
gene expression to previous analyses of the model Phanerochaete chrysosporium, we aimed to
characterize the effect of lignocellulose composition on gene expression in P. carnosa and to
predict key activities that could reduce the recalcitrance of softwood to bioprocess technologies.
3.2. Materials and Methods
3.2.1 Fungal strain and culture conditions
P. carnosa strain HHB-10118-sp was grown on solid or liquid medium (see section
2.2.1). Wood cultivations were prepared by using a blender to grind balsam fir (Abies balsamea),
lodgepole pine (Pinus contorta), white spruce (Picea glauca), or sugar maple (Acer saccharum)
and then sifting air-dried samples through 3.35 mm2 and 1.5 mm
2-pore-size sieves. Fiber that
passed through the 3.35 mm2 sieve but was retained by the 1.5 mm
2 sieve was recovered, and 4 g
47
samples were transferred to 500 mL beakers containing 10 mL of B3 buffer. Liquid cultivations
contained 14 ml YMPG in 500-ml beakers.
Each culture medium was inoculated with an 11-mm circular agar plug taken from the
growing edge of P. carnosa cultivated on solid YMPG (with agar). Cultivations were incubated
under stationary conditions at 27°C until the diameter of the mycelial mat reached 4 cm (6 to 9
days), at which point the central 28 mm of growth was harvested. Cultivation of P. carnosa on
fir, pine, and spruce for 6 to 9 days was previously correlated with detectable biotransformation
of each lignocellulosic substrate (Mahajan 2011). Since cultivations were initiated using YMPG
agar plugs, the transcriptomes of P. carnosa grown on fir, pine, spruce, and maple were
compared to the transcriptome of P. carnosa grown on YMPG liquid medium. After cultivation,
excess liquid was removed using Miracloth, and mycelia were flash frozen in liquid nitrogen and
then stored at −80°C.
3.2.2 RNA extraction and sequencing
Total RNA was isolated from frozen samples using the RNeasy Plant Mini Kit (Qiagen
Inc., Mississauga, ON, Canada) according to the manufacturer's protocol for plant tissues and
filamentous fungi and including the optional on-column DNase digestion. Total RNA was sent to
the Centre for the Analysis of Genome Evolution and Function (CAGEF, Toronto, ON, Canada)
for sample preparation and sequencing, where cDNA was synthesized and run in independent
lanes, and paired-end sequences of 38 bp were obtained using the Illumina Genome Analyzer IIx
(see Appendix 3).
Paired reads were converted to fastq format and gene models were then predicted using
the Maker genome annotation pipeline (Cantarel et al. 2008), whereby initial predictions were
based on version 1.0 of the P. carnosa genome using Augustus gene prediction (Stanke et al.
2006), and then improved by integrating initial models with mRNA-Seq tag contigs using
Maker. The BLAST algorithm was used to functionally annotate resulting gene models based on
their similarity to sequences of open reading frames predicted from the P. chrysosporium
genome version 2.0 (Vanden Wymelenberg et al. 2006a). Orthologs with reciprocal best hits
were identified, and gene models predicted to encode proteins of interest to this study were re-
annotated manually. Transcript abundance was calculated based on the number of mRNA-Seq
48
reads mapping to a given gene model, and normalized to reads per million per kb of predicted
gene model to correct for variations in total number of reads per sample and for variations in
sizes of individual genes.
3.2.3 Gene set enrichment analysis
Individual genes were placed into GO Slim categories based on their automated
annotations using the map2slim.pl tool available from the Gene Ontology Consortium
(http://search.cpan.org/~cmungall/go-perl/scripts/map2slim). Enzyme categories predicted to
participate in lignocellulose transformation were added to the generic GO Slim for molecular
function defined by the Gene Ontology Consortium. Each gene product was assigned to a single
GO Slim category, and categories with fewer than 15 gene products were merged with
corresponding parent categories. To identify GO Slim categories that were significantly enriched
on wood substrates compared to YMPG, an enrichment analysis was performed using Gene Set
Enrichment Analysis 2.0 (Subramanian et al. 2005). Results were considered significant if the p-
value was less than 0.05 and the false detection rate was less than 10% (Subramanian et al.
2005).
3.2.4 Manual gene annotation
Gene annotation for this transcriptomics project was completed prior to the full genome
annotation (chapter 2). Gene models predicted to encode LiPs and MnPs were aligned to each
other and to corresponding gene models from P. chrysosporium to ensure that only full-length
gene models were reported. In some cases, RT-PCR and RACE data were incorporated into the
models. In cases where the models appeared to be partial sequences, their locations in the
genome were determined and partial models were combined (e.g., transcripts 383 plus 781 and
9982 plus 9923; see Appendix 4).
3.2.5 RT-qPCR
Reverse transcription was performed using RevertAID H Minus Moloney murine
leukemia virus (M-MuLV) reverse transcriptase (Fermentas Canada Inc., Burlington, ON,
Canada), T25VN primer (with 25 thymidine nucleotides, followed by an adenosine, cytosine, or
49
guanosine [represented by “V”], and then any of the 4 nucleotides [represented by “N”]), and 30
ng total RNA in a 50-μl reaction volume. The resulting cDNA was diluted with 150 μl water, and
2 μl of each diluted sample was transferred to a reaction tube containing SYBR green JumpStart
Taq ReadyMix (Sigma-Aldrich Canada Ltd., Oakville, ON, Canada) and 1 μM gene-specific
primers (Table 3.1) in a 25-μl volume. The reaction products were quantified based on plasmid
standard curves using the DNA Engine Opticon 2 detection system (Bio-Rad Laboratories
Canada Ltd., Mississauga, ON, Canada).
Table 3.1. Primers used for RT-qPCR.
Gene IDa
Predicted activity left primer 5'→3' right primer 5'→3'
1130 chitin synthase TTATCAAGCCGGAAATCGTC GAGGTTGTGGATGGTCGAGT
405 mannanase CATTAGCTCGGGACTCACG GGATGATAGGGTACACCGGA
1498 acetyl xylan
esterase
GGGCCAGCTCATTCTCACT GGTCGTCCACTGCTTGATCT
1122 cellulose binding CCTGACTACTGGGCGACTGA GAGCCGCCAATGTTAACCT
1006 xylanase CCGACGGAACATTCACTGTG CGCGATCTGGGGGTAGGAC
9 lignin peroxidase ACATCGGTCTCGACGAAGTC TCTGGTCGACAGTGTGGAAC
aGene IDs correspond to those in the transcriptome publication (MacDonald et al. 2011).
3.3. Results
Of the 10,257 gene models with associated transcript reads, 533 were at least 4 times
more abundant in P. carnosa grown on at least one wood substrate than in that grown on YMPG,
162 were at least 4 times more abundant during growth on all wood media than on YMPG, and
115 were at least 4 times less abundant during growth on all wood media than on YMPG.
3.3.1 Validation of mRNA-Seq patterns
Real-time RT-qPCR was used to test the biological reproducibility of the RNA-Seq data
for six transcript sequences in four replicate cultivations of P. carnosa grown on YMPG and
50
ground fir (Fig. 3.1). These included five transcript sequences that were found by mRNA-Seq to
be between 1.7 and 200 times more abundant in P. carnosa during growth on fir than during
growth on YMPG and that are predicted to encode a mannanase (transcript 405 / JGI Protein ID
248589), acetyl xylan esterase (transcript 1498 / JGI Protein ID 248451), cellulose-binding
protein (transcript 1122), xylanase (transcript 1006 / JGI Protein ID 262694), and lignin
peroxidase (transcript 9 / JGI Protein ID 263501). A transcript predicted to encode chitin
synthase (transcript 1130 / JGI Protein ID 257626), which was found in similar amounts during
growth on all tested substrates, was also quantified by RT-qPCR. Transcript sequences predicted
by mRNA-Seq analyses to be more abundant in P. carnosa during growth on fir than during
growth on YMPG were also significantly more abundant in replicate cultivations analyzed by
RT-qPCR (Fig. 3.1). This analysis suggests that transcript counts at least 1.7 times higher in
wood cultivations than in liquid cultures represent biologically relevant differences in transcript
abundance.
Figure 3.1. Biological reproducibility of the transcript abundances determined by mRNA-Seq.
Transcript abundance in P. carnosa during growth on fir (dark-gray bars) and YMPG (light-gray
bars) was determined by RT-qPCR. Transcript ID numbers are indicated. chs, chitin synthase;
man, mannanase; axe, acetyl xylan esterase; cel, cellulose binding; xyl, xylanase; lip, lignin
peroxidase. The numbers on the bars are the ratios of transcript abundances from mRNA-Seq
analysis of cultivations grown on fir and YMPG medium; single asterisks indicate significance...
51
Continue from Figure 3.1 ...at P < 0.05, double asterisks significance at P < 0.005 (n = 4). The
error bars indicate the range of the data set.
3.3.2 Differentially regulated transcripts
To identify gene classifications that had higher transcript abundance in P. carnosa grown
on all wood substrates compared to YMPG, individual gene models were placed into GO Slim
categories and transcript abundance patterns were evaluated. Fifty-five percent of gene
annotations fitted into specific GO Slim categories, and transcript sequences that clustered in GO
Slim categories predicted to encode lignocellulose-degrading activity, including oxidoreductase
activity, peroxidase activity, monooxygenase activity, hydrolase activity, and glycosyl hydrolase
activity, were significantly enriched in P. carnosa grown on each of the wood substrates
compared to YMPG. By contrast, transcripts predicted to encode structural proteins had lower
abundance in P. carnosa grown on each wood compared to YMPG.
To predict specific catalytic activities that had the greatest difference in transcript
abundance in P. carnosa grown on wood compared to YMPG, the 30 transcripts that were at
least 100 times more abundant during growth on wood substrates (average values) than during
growth on YMPG were evaluated in more detail (Table 3.2). Sixteen of these sequences (53%)
were predicted to encode proteins involved in plant cell wall degradation, including 6 MnPs, 5
cellulases, 2 hemicellulases, a LiP, glyoxal oxidase, and a P450 monooxygenase. The three most
highly abundant transcripts in wood-grown cultivations compared to YMPG-grown cultivations
were predicted to encode MnP activity.
52
Table 3.2: The 30 most abundant transcripts from P. carnosa during growth on wood relative to
growth on YMPG.
No. reads / No. reads from YMPG
Gene ID Annotation Fir Pine Spruce Maple Average
45 manganese peroxidase 5793 3169 4360 2402 3931
31+169 manganese peroxidase 3303 2062 1136 1734 2059
383+781 manganese peroxidase 1492 1017 202 370 770
23 serine-threonine rich 765 699 600 719 696
970 phosphatidylethanolamine
binding
1468 331 207 290 574
119 non-ribosomal protein
synthetase
549 407 455 416 457
42 glyoxal oxidase 657 246 360 372 409
9 lignin peroxidase 201 92 64 949 326
1006 xylanase GH10 69 904 86 228 322
1168 manganese peroxidase 653 236 108 254 313
1138 manganese peroxidase 588 185 97 182 263
1039 cellulose binding GH61 40 744 114 88 247
1512 cellulose binding iron
reductase
22 809 90 50 243
1428 NADPH dehydrogenase 284 247 171 249 238
314 aspartic peptidase 416 218 119 169 230
9500 dioxygenase 495 38 223 43 200
697 manganese peroxidase 431 105 88 119 185
88 O-methyltransferase 96 119 158 278 163
254 xylanase GH10 31 333 119 119 151
2506 aminotransferase 449 11 32 25 129
361 cellobiohydrolase GH6 21 345 89 58 128
664 endoglucanase GH5 10 333 116 40 125
144 cellobiohydrolase GH7 46 12 185 249 123
732 P450 monooxygenase 98 113 167 110 122
2246 cellulose-growth specific 12 179 170 121 121
6787 dioxygenase 274 29 124 33 115
3683 unknown function 115 124 74 128 110
26 serine-threonine rich 169 79 69 124 110
53
130 S53 protease 84 124 111 118 109
323 cellobiohydrolase GH7 11 324 61 32 107
Table 3.3: The 30 most abundant transcripts from P. carnosa during growth on wood (absolute
values).
No. reads per million
Gene ID Annotation Fir Pine Spruce Maple Average
31+169 manganese peroxidase 44453 27746 15287 23332 27704
45 manganese peroxidase 23657 12944 17805 9810 16054
42 glyoxal oxidase 19893 7434 10885 11268 12370
23 serine-threonine rich 9345 8540 7332 8780 8499
323 cellobiohydrolase GH7 568 16271 3061 1618 5380
608 hydroxyacid dehydrogenase 3350 5367 4360 5113 4548
383+781 manganese peroxidase 7941 5412 1075 1968 4099
200 unknown function 2592 1121 4973 6841 3882
26 serine-threonine rich 5634 2647 2304 4124 3677
192 alcohol oxidase 2684 4360 2817 3281 3285
643 unknown function 3281 1552 2817 5078 3182
1138 manganese peroxidase 6937 2180 1144 2150 3103
25 translation elongation factor 2304 3350 3517 3083 3063
1039 cellulose binding GH61 481 8903 1361 1053 2949
839 peroxisomal catalase 6383 1278 1596 2469 2932
2273 unknown function 2353 1201 3350 4330 2808
153 thioredoxin 8780 617 820 771 2747
119 unknown function 3259 2419 2702 2469 2712
182 transcription factor 1734 2778 2304 3717 2633
106 unknown function 2574 2150 2798 2702 2556
477 opsin family protein 5634 861 1176 2180 2463
765 Major Facilitator Family
transporter
3350 2091 2288 1618 2337
361 cellobiohydrolase GH6 347 5713 1468 962 2123
164 chitinase-like 1978 1795 2062 2557 2098
500 opsin family protein 3566 1038 1128 2402 2034
54
88 O-methyltransferase 1201 1479 1965 3468 2028
1168 manganese peroxidase 4153 1499 685 1618 1989
71 Ure2p 1872 2896 2106 1060 1983
664 endoglucanase GH5 155 5221 1820 626 1956
130 S53 protease 1499 2226 1978 2106 1952
3.3.3 Lignin degradation
Fungal degradation of lignin is promoted by the activities of four oxidative enzymes: LiP,
MnP, versatile peroxidase (VP), and laccase. Similar to P. chrysosporium (Martinez et al. 2004),
genes encoding LiP and MnP, but not VP and laccase, were detected in the P. carnosa genome
sequence. LiP and MnP are hemoproteins that require H2O2 to oxidize aromatic substrates and
Mn2+
, respectively. In the case of MnP, Mn3+
is then stabilized by organic acids such as oxalate,
forming chelates that oxidize phenolic lignin structures (Hammel and Cullen 2008).
Transcript sequences from each of the seven P. carnosa mnp genes were 27 to 5,800
times more abundant in P. carnosa cultivations grown on each wood substrate than in YMPG
cultivations (Fig. 3.2). The relative abundances of transcript sequences in P. carnosa grown on
wood substrates compared to those grown on YMPG were highest for three mnp transcripts (45,
31, and 383 plus 781 / JGI Protein IDs 262882, 256991, and 256980) (Table 3.2). While
transcripts predicted to encode carbohydrate-active enzymes were generally most abundant in
pine cultivations and least abundant in fir cultivations compared to those in other wood
substrates, transcripts predicted to encode MnPs were most abundant in fir cultivations and
lowest in spruce cultivations, except transcript 45, which was lowest in maple cultivations (Fig.
3.2).
Of the three lip sequences, transcript 9 (JGI Protein ID 263501) was between 64 and 950
times more abundant in wood cultivations than in YMPG cultivations, with the greatest
abundance in the maple cultivation. Similarly, lip transcript 8106 (JGI Protein ID 152156) was
most abundant in P. carnosa grown on maple, where it was 3.5 times more abundant than in
YMPG cultivations; however, this transcript was less abundant in the other wood cultivations
than on YMPG. The lip transcript 489 (JGI Protein ID 213241) was 2.6 to 18 times more
55
abundant in P. carnosa grown on fir, pine, and maple than on that grown on YMPG, with the
greatest abundance during growth on fir. Transcript 9982 plus 992 (JGI Protein ID 212237),
which is predicted to encode a LiP-like protein, was 4.5 times more abundant in P. carnosa
grown on fir and was less abundant in the other wood cultures than on YMPG.
Several enzymes have been proposed to provide the H2O2 required for LiP and MnP
activity, including GLOX, GLOX-related copper radical oxidases (CRO), and alcohol oxidase
(AOX) (Li 2003, Vanden Wymelenberg et al. 2006b). Transcript 42, corresponding to a
candidate glox, was the third most abundant transcript in P. carnosa grown on wood substrates in
absolute terms (Table 3.3), and it was 250 to 660 times more abundant in wood cultivations than
on YMPG. Two related sequences that were also predicted to encode CRO enzymes (transcripts
7402 and 8976 plus 10028) were less than 1.9 times more abundant in P. carnosa grown on
wood. Four predicted aox genes were up to 91 times more abundant during growth on wood
(transcripts 192, 4441, 297, and 2539), while six others were generally less abundant during
growth on wood (transcripts 3984, 1191, 3317, 4757, 8833, and 4443).
4.3.4 Carbohydrate-active enzymes (CAZymes)
Among CAZymes, the relative abundance of transcripts predicted to encode cellulase
activity was higher than that of transcripts predicted to encode hemicellulase activity. Although
close analysis of transcript abundances summarized in Fig. 3.2 reveals higher abundance in pine
cultivations of transcripts encoding cellulases, main-chain hemicellulases, and hemicellulose-
specific carbohydrate esterases, a Gene Set Enrichment Analysis indicated that the overall
distribution of transcripts predicted to encode CAZymes involved in cellulose and hemicellulose
hydrolysis was similar between softwood and hardwood cultivations.
56
Figure 3.2. Heat maps and abundances for selected transcripts expressed by P. carnosa during
growth on wood and YMPG substrates. CBM, carbohydrate-binding module; CE, carbohydrate
esterase; CRO, copper radical oxidase; CYP, cytochrome P450 monooxygenase; GH, glycosyl
hydrolase; GMCO, GMC oxidoreductase.
57
3.4. Discussion
Transcripts encoding enzymes involved in lignin degradation (peroxidases and H2O2-
generating enzymes) were the most abundant gene products isolated from P. carnosa grown on
wood substrates, both in absolute terms and in comparison to growth on YMPG (Table 3.2;
Table 3.3). In contrast, of the 80 most abundant transcripts expressed by P. chrysosporium grown
on red oak, 22 corresponded to GHs or carbohydrate-binding modules (CBMs), and only 4 were
predicted to encode lignin-degrading enzymes (Sato et al. 2009).
The ratio of lip to mnp genes and transcripts also appears to differ between P. carnosa
and P. chrysosporium. The draft sequence of the P. carnosa genome predicts seven genes that
encode MnP and only three genes that encode LiP; the abundance of transcripts corresponding to
individual mnp genes was also generally higher than the number corresponding to individual lip
genes in P. carnosa grown on wood substrates. In contrast, the P. chrysosporium genome
predicts five mnp and 10 lip genes (Martinez et al. 2004), and transcripts from individual lip
genes appear to be more numerous than mnp transcripts in P. chrysosporium grown on wood and
under low-nitrogen (ligninolytic) conditions (Vanden Wymelenberg et al. 2009, Sato et al. 2009,
Doddapaneni and Yadav 2005). Similar to P. carnosa, Ceriporiopsis subvermispora, which
appears equally capable of growth on softwood and hardwood (Blanchette et al. 1992, Otjen and
Blanchette 1987) produces more mnp and fewer lip transcripts than P. chrysosporium during
growth on big-tooth aspen compared to glucose medium (Fernandez-Fueyo et al. 2012).
Differences in modes of lignin degradation catalyzed by MnP and LiP could affect the
efficiency of lignocellulose degradation by P. carnosa and P. chrysosporium. LiPs can directly
oxidize a variety of aromatic substrates, whereas MnPs mediate lignin degradation through
chelates of oxidized Mn3+
ions. Compared to LiP, the Mn3+
chelates have weaker oxidizing
power and mainly act on phenolic structures. However, chelates of Mn3+
ions are likely more
able to diffuse through plant cell walls than the larger lignin peroxidases (Hammel and Cullen
2008). This property could facilitate the degradation of guaiacyl (G) lignin in softwood, which
can form more dense structures than guaiacyl-syringyl (GS) lignin (Cathala et al. 2000), perhaps
due to its higher fraction of condensed biphenyl 5-5 bonds (Sjostrom 1993; see section 1.1.3). In
fact, differences between G and GS lignins have been shown to affect the rate of degradation by
58
P. chrysosporium, which depolymerizes natural and synthetic G lignins more slowly than natural
and synthetic GS lignins (Faix et al. 1985, Otjen et al. 1988).
This analysis of P. carnosa transcriptomes revealed a consistent genetic response to
growth on both softwood and hardwood substrates whereby enzymes involved in lignin
degradation were the most highly expressed, followed by cellulase and then hemicellulase
activities. This expression pattern is consistent with analyses of wood fiber isolated from P.
carnosa cultivations, which predominantly reveal loss of lignin (Mahajan 2011).
59
Chapter 4 Time-dependent profiles of transcripts encoding lignocellulose-
modifying enzymes of P. carnosa grown on multiple wood substrates
Parts of this chapter are published in:
MacDonald J, Master ER. Time-dependent profiles of transcripts encoding lignocellulose-
modifying enzymes of the white rot fungus Phanerochaete carnosa grown on multiple wood
substrates. Applied and Environmental Microbiology 78(5), 1596-1600.
60
4.1 Introduction
The transcriptomic study of P. carnosa described in chapter 3 revealed greater abundance
of transcripts predicted to encode lignocellulose-modifying enzymes during growth on multiple
wood substrates compared to nutrient liquid medium (MacDonald et al. 2011). Compared with
the model white-rot fungus Phanerochaete chrysosporium, which has largely been isolated from
hardwood, P. carnosa produced a greater proportion of transcripts encoding proteins involved in
lignin degradation, particularly manganese peroxidase (MnP) (chapter 3; MacDonald et al.
2011). Moreover, the abundance of transcripts encoding lignin-degrading activity were much
higher than those encoding carbohydrate-active enzymes, which was consistent with the selective
lignin decay elicited by P. carnosa grown on softwood (Mahajan 2011), but opposite to previous
transcriptomic analyses of Phanerochaete chrysosporium grown on hardwood (Sato et al. 2009,
Vanden Wymelenberg et al. 2010). The relative expression of genes encoding lignin-degrading
and carbohydrate-active enzymes by P. carnosa may contribute to the ability of this white-rot
fungus to attack softwood. However, the transcriptomic analysis of P. carnosa evaluated a single
time point and it is known that enzyme and transcript production in white-rot fungi can vary over
time (Bogan et al. 1996, Suzuki et al. 2009, Vallim et al. 1998).
Therefore, to gain a greater understanding of wood decay by P. carnosa, quantitative
real-time reverse transcriptase PCR (RT-qPCR) was used to evaluate temporal changes in the
abundance of nine transcripts predicted to encode a range of lignocellulose-modifying enzymes.
Notably, transcript profiles were consistent with a sequential mode of decay where lignin was
decayed to some extent before cellulose and hemicellulose, and transcripts encoding MnP and
LiP featured significant substrate-dependent response. Based on the amounts of transcripts
produced, P. carnosa appears to primarily employ MnP activity for lignin decay, particularly
during growth on softwood. This prediction is consistent with the observation that the P. carnosa
genome encodes seven predicted MnPs and only three or four predicted LiPs
(http://www.jgi.doe.gov/Pcarnosa). The current study also revealed that the overall levels of
transcripts encoding hemicellulose-modifying enzymes were consistent with the typical
composition of softwood hemicelluloses. Finally, an analysis of three internal standards for RT-
qPCR revealed that transcript patterns obtained using absolute quantification were consistent
with those normalized to transcripts encoding chitin synthase.
61
4.2. Materials and Methods
4.2.1 Fungal cultures
P. carnosa strain HHB-10118-sp was grown on 4 g of ground and sifted wood samples
prepared from the softwood species balsam fir (Abies balsamea), lodgepole pine (Pinus
contorta), or white spruce (Picea glauca), or the hardwood species sugar maple (Acer
saccharum), each with B3 buffer as previously described (section 3.2.1). Cultures were
inoculated with 11 mm circular plugs from the growing edge of P. carnosa on solid nutrient
medium, and then incubated at 27°C under stationary conditions. The central 28 mm of fungal
growth was harvested from triplicate cultivations at predefined growth points (GP): four days
(GP1), 4 cm colony diameter (GP2), and 6 cm colony diameter (GP3).
4.2.2 RT-qPCR
RNA isolation and RT-qPCR were performed as described in section 3.2.5 with the gene-
specific primers shown in Table 4.1. Cycles were run as follows: 1 cycle of (94ºC for 2 min), 40
cycles of (94ºC for 30 s, 65ºC for 30 s, 72ºC for 30s, plate read), with the exception of lip-
263501, lip-213241, and ge-247750, which used an annealing temperature of 63ºC. Plasmid
standards were constructed using primers that amplified the qPCR fragments and flanking cDNA
sequence (Table 4.2). Graphical representations of the data and associated statistical analyses
were generated using GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA).
62
Table 4.1. Primers for RT-qPCR.
Protein
IDa
Predicted activity left primer 5'→3' right primer 5'→3'
248451 acetyl xylan esterase GGGCCAGCTCATTCTCACT GGTCGTCCACTGCTTGATCT
249164 actin TCAATGCACCAGCGTTCTAC CGAGGTCGATACGGAGGATA
264060 cellobiohydrolase GAATCGACGCCGTCAACTCG CGAGGACCATACCGGTGTTG
257626 chitin synthase TTATCAAGCCGGAAATCGTC GAGGTTGTGGATGGTCGAGT
261268 GAPDH TCCAAGTACACCGTCATCTCC GGAAAGCAAGACCAGTCAGC
247750 glucuronoyl esterase CTTCCGTACGACCACCACTC GAAGAGGGTTGGGTTGAGGT
263501 lignin peroxidase ACATCGGTCTCGACGAAGTC TCTGGTCGACAGTGTGGAAC
213241 lignin peroxidase ATGTCGGCCTTGATGAGATT GGACAAGACCATCAGGAGCA
262882 manganese
peroxidase
GAACAAGACCATTGCTGCCA GAAGGGAGCGGCATCAATG
256991 manganese
peroxidase
GAACCACACTATTCCCGCCG GCGAGCAGGGCGATGACT
248589 mannanase CATTAGCTCGGGACTCACG GGATGATAGGGTACACCGGA
262694 xylanase CCGACGGAACATTCACTGTG CGCGATCTGGGGGTAGGAC
aProtein IDs from the JGI genome portal (http://www.jgi.doe.gov/Pcarnosa).
63
Table 4.2. Primers used to generate plasmid standards.
Protein
IDa
Predicted activity left primer 5'→3'b
right primer 5'→3'
248451 acetyl xylan esterase CAGCAACTTCGGTACCAACC AACGTCGAGTTCGAGTAGCC
249164 actin GGTTCCGGCATGTGCAAG CCACCGATCCAGACGGAGTA
264060 cellobiohydrolase ATGAGCAGCGAAACCGAGTAC AGAAGACGACCTGTGCGTTC
257626 chitin synthase ATCTCACACCACATGGCAAA CCCCAAGAGAAGTCATCGAA
261268 GAPDH CCAAGGACGGCAAGCTCT TTAGAGGGCACCGTCGACCT
247750 glucuronoyl esterase CATCATCGACGTGCTCGAGGTCA (3'RACE)
263501 lignin peroxidase (5' RACE) GTCTCGACGAAGAACTG
213241 lignin peroxidase (5' RACE) ACGAAGGACTGCCACTC
262882 manganese
peroxidase
GACGGCTCCATGCTCCTGTTCCCc
(3' RACE)
256991 manganese
peroxidase
(5' RACE) GGGATVACKCNGAGCAGTCG
248589 mannanase ATGTTGAAAGTAGGCTTCCTCG TCAGCCACGAGCCTTGAGT
262694 xylanase ATGGTCAAGCTCTCCGCCTC TCATGCGCTGAGAGCTGCAG
aProtein IDs from the JGI genome portal (http://www.jgi.doe.gov/Pcarnosa).
bWhere indicated, 5' or 3'
RACE was performed using the SMART RACE cDNA Amplification Kit (Clontech Laboratories Inc.,
Mountain View, CA, USA). cFrom (Macarena et al. 2005).
4.2.3 FT-IR
Softwood samples from these time-course cultivations have previously been analyzed by
Fourier transform infrared spectroscopy (FT-IR), which indicated that degradation of lignin and
certain hemicelluloses occurred before cellulose modification, consistent with a sequential decay
pattern (Mahajan 2011). Here, FT-IR analysis of maple samples was performed to complete the
comparison between transcription and wood degradation. Fiber samples were prepared and
analyzed as previously reported (Mahajan 2011). Absorbance was measured by a TENSOR 27
FT-IR Spectrometer (Bruker Optics Ltd., Milton, Ontario, Canada) from 4000 to 400 cm-1
with a
resolution of 4 cm-1
, and the spectra represented the average of 32 scans. Principal component
64
analysis of FT-IR spectra was performed using PLS Toolbox v. 5.8.2 (Eigenvector Research Inc.,
Wenatchee, WA, USA) with MATLAB v. 7.8.0 (The MathWorks Inc., Natick, MA, USA).
4.3. Results
4.3.1 Fungal cultures
Replicate P. carnosa cultures grown on wood media were harvested at three growth
points (GP) (Fig. 4.1). GP1 was harvested after 4 days of incubation, while GP2 (4 cm) was
harvested after 6-21 days, and GP3 (6 cm) after 19-35 days of incubation. Wood species did not
significantly affect the incubation time required to reach each GP (1-way ANOVA; p > 0.1).
GP 1 GP 2 GP 30
10
20
30
40
Growth Point
Da
ys
Figure 4.1. Harvest times for P. carnosa cultivations grown on fir (black), pine (light grey),
spruce (dark grey), and maple (white). Error bars represent standard deviation, n=3. Reported in
part in (Mahajan 2011). Wood species did not significantly affect the incubation time required to
reach each GP (1-way ANOVA; p > 0.1).
65
4.3.2 Pattern of transcript abundance for internal standards
Three transcript sequences were tested as internal reference genes for RT-qPCR.
Transcripts for actin and gapdh have traditionally been used as standards in studies of P.
chrysosporium (Shary et al. 2008, Doddapaneni and Yadav 2004, Suzuki et al. 2010). However,
previous transcriptomic analysis of P. carnosa suggests that the abundance of these transcripts
varies during the growth of this organism on different substrates, and that the level of transcripts
encoding a chitin synthase (Chs) is more stable (Fig. 4.2a; MacDonald et al. 2011). We therefore
used RT-qPCR to amplify P. carnosa transcripts encoding actin (Protein ID: Pcarn249164),
GAPDH (Protein ID: Pcarn261268) and Chs (Protein ID: Pcarn257626) in all of our time-course
samples, where Protein IDs correspond to specific sequences encoded by the P. carnosa genome
(available at http://www.jgi.doe.gov/Pcarnosa). Consistent with previous transcriptomic
analyses, the standard deviation of transcript abundance for each gene product in all RNA
preparations indicated that the abundance of chs transcripts was less variable than those encoding
GAPDH or actin (Fig. 4.2b).
66
Figure 4.2. Abundance of transcripts encoding chitin synthase (Chs) is less variable than
abundance of transcripts encoding actin or GAPDH in P. carnosa. (a) Heat map representation
of P. carnosa transcript abundance during growth on nutrient medium (YMPG), fir, pine, spruce,
and maple from mRNA-Seq analysis (n=1) (MacDonald et al. 2011). Protein IDs are from the
JGI genome portal (http://www.jgi.doe.gov/Pcarnosa). (b) RT-qPCR amplification of transcripts
from P. carnosa grown on fir, pine, spruce, and maple over 3 time points plotted as the percent
of the average value for each transcript sequence (n=36). Standard deviations for transcripts
encoding Chs, actin and GAPDH were 33, 43 and 48, respectively.
67
RT-qPCR was used to quantify transcripts encoding 2 MnPs (Protein IDs: Pcarn256991
and 262882, Lignin Oxidases family LO2 (Levasseur et al. 2008)), 2 LiPs (Protein IDs:
Pcarn263501 and 213241, family LO2), a mannanase (Man; Protein ID: Pcarn248589, Glycoside
Hydrolase family GH5 (Cantarel et al. 2009)), xylanase (Xyl; Protein ID: Pcarn262694, family
GH10), cellobiohydrolase (Cbh; Protein ID: Pcarn264060, family GH7), acetylxylan esterase
(AXE; Protein ID: Pcarn248451, Carbohydrate Esterase family CE1 (Cantarel et al. 2009)), and
glucuronoyl esterase (GE; Protein ID: Pcarn247750, family CE15; see Appendix 5) at three
growth points (GP) during cultivation on fir, pine, spruce and maple substrates. For each enzyme
activity, the specific sequences chosen were among those previously found to have the greatest
transcript abundance during growth on wood substrates (MacDonald et al. 2011).
Using absolute quantification, the abundance of all targeted gene transcripts except for
axe-248451 changed significantly over time (p <0.05; 2-way ANOVA; Table 4.3). By contrast,
the source of wood fiber did not significantly affect transcript abundances (p >0.05; 2-way
ANOVA). Analyses that used chs-257626 levels as an internal reference did not significantly
differ from absolute quantifications, whereas analyses that used gapdh-261268 or actin-249164
omitted time as a significant factor for two and five of the eight target transcripts that showed
significance under absolute quantification, respectively (Table 4.3). As is often noted, it is
important to test several gene transcripts as internal references to correctly interpret the
abundance of queried transcripts by RT-qPCR. In this study, transcript patterns obtained using
absolute quantification were consistent with those normalized to transcripts encoding chitin
synthase (Table 4.3).
68
Table 4.3. Two-way ANOVA to determine the effects of time (growth point) and wood substrate
on the abundance of each target transcript in P. carnosa. p-values are shown for absolute
transcript abundances (no reference gene), and transcript abundances normalized using reference
genes (chs, gapdh, and actin).
p-value for Timea
p-value for Substrateb
Target
Genec
Reference Gene Reference Gene
None /chs /gapdh /actin None /chs /gapdh /actin
mnp-
256991 0.0001d
0.0001 0.0011 0.0198 0.0869 0.0862 0.5712 0.4424
mnp-
262882 <0.0001 <0.0001 0.0029 0.0008 0.2617 0.2594 0.2966 0.1134
lip-263501 0.0251 0.0252 0.1332 0.2758 0.0797 0.0800 0.1951 0.3114
lip-213241 0.0445 0.0463 0.0702 0.0291 0.8516 0.8373 0.8278 0.6076
man-
248589 0.0119 0.0120 0.0065 0.2418 0.1939 0.1944 0.2070 0.4782
xyl-
262694 0.0026 0.0025 0.0018 0.2022 0.6209 0.6098 0.9318 0.4926
cbh-
264060 0.0005 0.0005 0.0003 0.2467 0.2163 0.2153 0.1453 0.4329
axe-
248451 0.0885 0.0888 0.0143 0.1628 0.2295 0.2306 0.3021 0.5275
ge-
247750 0.0005 0.0005 0.0007 0.2439 0.2445 0.2428 0.2664 0.4227
aNull hypothesis: the values of the means from each of the three time points (GPs), without considering
the wood substrates, are the same. bNull hypothesis: the values of the means from each of the four wood
substrates, without considering the GP, are the same. cNumbers correspond to protein IDs used by the JGI
genome portal (http://www.jgi.doe.gov/Pcarnosa). dSignificance values with p<0.05 are indicated in
bold.
69
4.3.3 Abundance of transcripts encoding lignin-degrading activity
Manganese peroxidase (MnP) and lignin peroxidase (LiP) are oxidative enzymes that
promote the degradation of lignin. In the previous transcriptome study of P. carnosa, two mnp
sequences, mnp-256991 and mnp-262882, were the most highly abundant transcripts in wood
cultivations, both in absolute terms and compared to cultures grown on liquid nutrient medium
(YMPG) (chapter 3; MacDonald et al. 2011). Specifically, after an incubation period equivalent
to GP2 in the current study, transcripts encoding mnp-256991 and mnp-262882 were on average
2,100 and 3,900 times more abundant in the wood cultures, respectively. The abundance of lip
transcripts was considerably lower, with the most highly abundant sequences, lip-263501 and
lip-213241, being on average 330 and 8.0 times more abundant during growth on wood
compared to YMPG, respectively (MacDonald et al. 2011). In the current study, the average
abundance of transcript mnp-256991 during growth on all wood samples increased from
approximately 21,000 copies at GP1 to 380,000 copies at GP2, and decreased to 97,000 at GP3
(Fig. 4.3). The average abundance of mnp-256991 was significantly higher than the abundance of
each of the other target transcripts at GP2 except for mnp-262882 (Table 4.4). For mnp-262882,
the average transcript abundance increased from approximately 6,600 copies at GP1 to 270,000
copies at GP2, and decreased to 89,000 at GP3 (Fig. 4.3). Both transcripts had higher GP2
abundance during growth on spruce and mnp-262882 had lower GP2 abundance during growth
on maple (Fig. 4.3). The difference in mnp-262882 abundance between growth on spruce and
maple at GP2 was considered to be significant by Bonferroni's multiple comparison post-test
following 2-way ANOVA (p<0.05). Bonferroni's post-test is a conservative estimate of
significance because it reduces the chance of obtaining a higher number of false positives as the
number of comparisons is increased. The test is adjusted by dividing the p-value by the number
of comparisons, thereby maintaining a low false discovery rate (Shaffer 1995).
The general pattern of lip-263501 transcript abundance was similar to the mnp's, with
average transcript abundance increasing from approximately 830 copies at GP1 to 34,000 copies
at GP2, and decreasing to 270 at GP3 (Fig. 4.3). Further, the abundance of each lip was
significantly lower than that of each mnp transcript at GP2 and GP3 (Table 4.4). Notably
however, the abundance of lip-263501 at GP2 was significantly higher in P. carnosa during
growth on maple compared to each of the three softwoods (p<0.01). The average transcript
70
abundance of lip-213241 at GP1, GP2, and GP3 was 740, 2,300, and 2,000 copies, respectively.
And although the abundance of this transcript was also highest at GP2 during growth on maple,
this trend was not deemed statistically significant.
4.3.4 Abundance of transcripts encoding carbohydrate-active
enzymes
Mannanases and xylanases hydrolyze glycosidic bonds that link backbone sugars of the
most abundant hemicelluloses in higher plants. In contrast to mnp and lip transcript abundances,
which in most cases peaked at GP2, both man-248589 and xyl-262694 retained higher relative
abundance through GP2 and GP3. The average abundance of man-248589 increased from
approximately 120,000 copies at GP1 to 210,000 copies at GP2 and 200,000 at GP3. The
average abundance of man-248589 was significantly higher than the abundance of all other
target transcripts at GP3, and was also higher than all other target transcripts except for cbh-
264060 at GP1 (Table 4.4). For xyl-262694, the average transcript abundance increased from
approximately 7,200 copies at GP1 to 150,000 copies at GP2 and 110,000 at GP3 (Fig. 4.3).
Although the abundance of man-248589 and xyl-262694 at GP2 was lowest in P. carnosa grown
on maple, this trend was not statistically significant by Bonferroni's post-test.
Acetylxylan esterase and glucuronoyl esterase catalyze the hydrolysis of acetyl groups
from acetylated hemicelluloses, and ester linkages between hydroxyl groups of lignin and
glucuronic acid residues of glucuronoxylans, respectively. Similar to man-248589 and xyl-
262694, higher relative abundance of axe-248451 and ge-247750 occurred at GP2 and GP3. The
average abundance of transcript axe-248451 increased from approximately 26,000 copies at GP1
to 86,000 copies at GP2 and decreased to 45,000 at GP3. For ge-247750, the average transcript
abundance increased from 3,900 copies at GP1 to 12,000 copies at GP2 and 15,000 at GP3.
Although the abundance of axe-248451 and ge-247750 at GP2 was lowest during growth on
maple, this trend was not statistically significant.
Cellobiohydrolases degrade cellulose by releasing cellobiose from either the reducing or
non-reducing end of cellulose molecules. Previous transcriptomic analyses of P. carnosa
revealed that during growth on wood substrates, the cbh-264060 gene (predicted to encode a
GH7 cellobiohydrolase), gave rise to more transcripts than other cellulase-encoding genes;
71
moreover, cbh-264060 represented the fifth most abundant transcript sequence during growth on
wood (MacDonald et al. 2011). In the current study, the average abundance of transcript cbh-
264060 increased from approximately 42,000 copies at GP1 to 120,000 copies at GP2 and
130,000 copies at GP3. Similar to the other CAZymes, the abundance of cbh-264060 at GP2 was
lowest during growth on maple, although again, this trend was not statistically significant.
A:
Figure 4.3, continued on next page...
72
B:
Figure 4.3. Time-dependent abundance of transcript sequences in triplicate cultivations of P.
carnosa grown on fir (black), pine (light grey), spruce (dark grey), and maple (white). Absolute
transcript abundances are indicated. A) Transcripts encoding manganese peroxidases mnp-
256991 and mnp-262882, and lignin peroxidases lip-263501 and lip-213241. B) Transcripts
encoding mannanase man-248589, xylanase xyl-262694, axetyl xylan esterase axe-248451,
glucuronoyl esterase ge-247750, and cellobiohydrolase cbh-264060. Numbers correspond to JGI
protein IDs available at http://www.jgi.doe.gov/Pcarnosa.
73
Table 4.4. Bonferroni's multiple comparison post-test of transcript abundance at each growth
point (GP) following repeated measures ANOVA. p-values are indicated as follows: ns, >0.05; *,
0.01 to 0.05; **, 0.001 to 0.01; ***, <0.001. Arrows indicate whether the abundance of the
transcript listed in the column heading is higher (↑) or lower (↓) than transcripts having
significantly different abundances.
GP 1
MnP-
256991
MnP-
262882
LiP-
263501
LiP-
213241
Man-
248589
Xyl-
262694
Axe-
248451
GE-
247750
Cbh-
264060
↓ ↓ ↓ ↓ ↑ ↓ ↓ ↓ ↓
MnP-
256991
- ns ns ns ** ns ns ns ns
MnP-
262882
ns - ns ns *** ns ns ns ns
LiP-
263501
ns ns - ns *** ns ns ns ns
LiP-
213241
ns ns ns - *** ns ns ns ns
Man-
248589
** *** *** *** - *** * *** ns
Xyl-
262694
ns ns ns ns *** - ns ns ns
Axe-
248451
ns ns ns ns * ns - ns ns
GE-
247750
ns ns ns ns *** ns ns - ns
Cbh-
264060
ns ns ns ns ns ns ns ns -
GP 2
MnP-
256991
MnP-
262882
LiP-
263501
LiP-
213241
Man-
248589
Xyl-
262694
Axe-
248451
GE-
247750
Cbh-
264060
↑ ↑ ↓ ↓ ↑↓ ↓ ↓ ↓ ↓
MnP-
256991
- ns *** *** *
(↓)
*** *** *** ***
MnP-
262882
ns - *** *** ns ns * *** ns
LiP- *** *** - ns * ns ns ns ns
74
263501 (↑)
LiP-
213241
*** *** ns - **
(↑)
ns ns ns ns
Man-
248589
* ns * ** - ns ns ** ns
Xyl-
262694
*** ns ns ns ns - ns ns ns
Axe-
248451
*** * ns ns ns ns - ns ns
GE-
247750
*** *** ns ns **
(↑)
ns ns - ns
Cbh-
264060
*** ns ns ns ns ns ns ns -
GP 3
MnP-
256991
MnP-
262882
LiP-
263501
LiP-
213241
Man-
248589
Xyl-
262694
Axe-
248451
GE-
247750
Cbh-
264060
↑↓ ↑↓ ↓ ↓ ↑ ↑↓ ↓ ↓ ↑↓
MnP-
256991
- ns *** *** *** ns ns ** ns
MnP-
262882
ns - ** ** *** ns ns * ns
LiP-
263501
***
(↑)
**
(↑)
- ns *** ***
(↑)
ns ns ***
(↑)
LiP-
213241
***
(↑)
**
(↑)
ns - *** ***
(↑)
ns ns ***
(↑)
Man-
248589
***
(↓)
***
(↓)
*** *** - **
(↓)
*** *** *
(↓)
Xyl-
262694
ns ns *** *** ** - ns *** ns
Axe-
248451
ns ns ns ns *** ns - ns **
(↑)
GE-
247750
**
(↑)
*
(↑)
ns ns *** ***
(↑)
ns - ***
(↑)
Cbh-
264060
ns ns *** *** * ns ** *** -
75
4.3.5 FT-IR
FT-IR analysis of the maple wood substrates confirmed that lignin degradation most
clearly distinguished untreated and fungal treated wood fiber (Table 4.5), as was the case for the
other wood substrates used in this study (Mahajan 2011).
Table 4.5. Assignment of FT-IR peaks that correspond to wood polysaccharides and lignin and
were decreased in maple cultivation collected at GP3.
Peaks assigned in the literature Peaks decreased at GP3
Wavenumber (cm-1
) Peak description Wavenumber (cm-1
)
1595 GS lignin aromatic skeletal vibrations
(Hergert 1971)
1593
1511-1505 1511, aromatic skeletal vibrations (Faix
and Beinhoff 1988); 1505, GS lignin
aromatic skeletal vibrations (Hergert 1971)
1508
1470-1460 GS lignin asymmetric C-H deformations
(Hergert 1971)
1465
1230-1223 1230, guaiacyl ring breathing with C-O
stretching (Hergert 1971); 1226-1223,
common to lignin and cellulose (Hobro et
al. 2010)
1228
1130-1125 1130, C-H in-plane deformation in GS
lignin (Hergert 1971); 1130, C-O-C
stretching in glycosidic rings (Kacurakova
et al. 2002); 1128-1125, lignin S-ring (Faix
et al. 1992)
1129
1092-1085 1092, glucomannan (Kacurakova et al.
2000); 1085, G and GS lignin C-O
deformation, secondary alcohol and
aliphatic ether (Hergert 1971)
1091
1049-1041 1049-1045, xylooligosaccharides
(Kacurakova et al. 1998); 1048, C-O
stretch in cellulose and hemicelluloses
(Levasseur et al. 2008, Pandey and Pitman
2003); 1047, pectin (Kacurakova et al.
2000); 1043, arabinogalactan (Kacurakova
et al. 2000); 1041, xyloglucan (Kacurakova
et al. 2000)
1044
76
4.4. Discussion
With the exception of axe-248451, time of incubation on all wood substrates significantly
influenced the abundance of the target transcripts, where the abundance of the two mnps and lip-
263501 peaked at GP2, and the abundance of transcripts encoding CAZymes was highest at GP2
and GP3. The higher abundance of transcripts encoding MnPs than CAZymes at GP2, and
prolonged abundance of transcripts encoding CAZymes through to GP3, is consistent with a
sequential mode of decay where lignin is degraded to some extent before the carbohydrate
components (Blanchette et al. 1985). In fact, FT-IR analysis of the wood substrates used in this
study confirmed that lignin degradation most clearly distinguished untreated and fungal treated
wood fiber. Although lowest at GP1, higher amounts of man-248589 compared to other target
transcripts at this growth point might be due to greater basal expression of this gene.
While transcript abundances changed over time, the source of wood fiber did not
significantly affect patterns of transcript abundance, as determined by 2-way ANOVA. However,
at GP2 the Bonferroni post-test indicated significantly lower levels of mnp-262882 during
growth on maple compared to spruce (p<0.05), but significantly higher levels of lip-263501
during growth on maple compared to each of the softwoods (p<0.01). It is therefore possible that
MnP is particularly important for guaiacyl (G) lignin degradation, or that efficient degradation of
guaiacyl-syringyl (GS) lignin in hardwoods requires LiP activity. Notably, eucalyptus wood
treated with MnP from Ceriporiopsis subvermispora shows a greater percent reduction in G
compared to S lignin units (Cunha et al. 2010); whereas P. chrysosporium, which produces more
lip than mnp transcripts under ligninolytic conditions (Vanden Wymelenberg et al. 2009, Sato et
al. 2009, Doddapaneni et al. 2005), depolymerizes natural and synthetic GS lignins more quickly
than natural and synthetic G lignins (Faix et al. 1985, Otjen et al. 1988). In addition to the
relative abundance of mnp and lip transcripts quantified in the current analysis, the apparent
importance of MnP activity for lignocellulose conversion by P. carnosa is further illustrated by
the number of genomic copies of mnp and lip encoded by this organism (seven and four,
respectively; http://www.jgi.doe.gov/Pcarnosa), and the relative transcript abundance of all
eleven lignin-modifying peroxidases at GP 2 (MacDonald et al. 2011).
The abundance of transcripts encoding main chain hemicellulases was consistent with P.
carnosa adaptation to hemicelluloses that predominate in softwood fiber. Glucomannans are the
77
main hemicellulose of softwood, where they are 2 to 4 times more abundant than xylan; by
contrast, xylans are 3 to 15 times more abundant than glucomannans in hardwoods (Sjostrom
1993). The abundance of man-248589 in P. carnosa was significantly higher than the abundance
of xyl-262694 at GP3. The relative abundance of mannanase- and xylanase-encoding transcripts
in P. carnosa differs from other white-rot fungi. For instance, a transcriptome study of P.
chrysosporium grown on red oak (hardwood) identified expressed sequence tags corresponding
to three xylanases and no mannanases (Sato et al. 2009). A separate transcriptome of P.
chrysosporium grown on aspen (hardwood) revealed transcripts encoding two xylanases and one
mannanase with over 4-fold accumulation compared to growth on glucose; of these, the
transcripts encoding each of the xylanases were more abundant than that encoding the
mannanase (Vanden Wymelenberg et al. 2010). However, the P. carnosa genome contains at
least two mannanase- and four xylanase-encoding genes (http://www.jgi.doe.gov/Pcarnosa), and
only one of each was analyzed in the current study.
Softwood galactoglucomannans and hardwood xylans can be partially acetylated; xylans
from hardwoods and softwoods are also substituted by glucuronic acid. Given the partial
substitution of the backbone sugars, the levels of transcripts encoding acetylxylan esterases and
glucuronoyl esterases were expected to be lower than those encoding the main-chain
hemicellulases. Indeed, at GP2 and GP3, the levels of axe-24845 and ge-247750 transcripts were
lower than those encoding mannanase and xylanase activities. Notably, transcripts encoding
AXE-24845 were 3.0 to 7.2 times more abundant than those encoding GE-247750 and acetyl
groups are typically more abundant than glucuronic acid in hemicelluloses of both hardwoods
and softwoods (Sjostrom 1993). Hardwood xylan comprises 15-30% of hardwood xylem, and the
ratio of acetyl groups and glucuronic acid to xylose is approximately 7:10 and 1:10, respectively.
In contrast, softwood xylan comprises 7-10% of softwood xylem, is not acetylated, and the ratio
of glucuronic acid to xylose is approximately 1:5. Softwood xylem also contains 15-23%
glucomannan, which contains approximately one acetyl group to every three or four backbone
sugars (Sjostrom 1993).
The abundance of transcripts encoding a predicted GH7 cellobiohydrolase (cbh-264060)
was similar to those of the hemicellulose-modifying enzymes, where transcript abundance was
higher at both GP2 and GP3 compared to GP1. Time-course measurements of cbh transcripts
during fungal growth on lignocellulosic substrates have been reported previously. For example,
78
competitive RT-PCR was used to measure the abundance of five cbh transcript sequences
produced by P. chrysosporium grown on aspen (Vallim et al. 1998). In that case, the levels of all
five cbh transcripts peaked after four weeks of cultivation, dropped at week six, and increased
again at week eight (Vallim et al. 1998).
In summary, the ratios of average transcript abundance for all wood substrates at GP2
compared to GP3 were: mnp-256991 (3.9), mnp-262882 (3.0), lip-263501 (130), lip-213241
(1.2), man-248589 (1.1), xyl-262694 (1.4), cbh-264060 (0.9), axe-248451 (1.9), ge-247750 (0.8).
This result, coupled to compositional analysis of residual wood fiber, suggests that P. carnosa
employs a sequential mode of lignocellulose decay. Moreover, since lip-213241 was most
abundant during growth on maple, while during growth on fir, pine, and spruce, mnp transcripts
were more abundant than lip-213241, it is possible that MnP and LiP activities are particularly
important for G lignin degradation and GS lignin degradation, respectively. Overall, P. carnosa
also produced higher levels of the mannanase transcript than the xylanase transcript, suggesting a
possible adaptation to the hemicellulose content of softwood. Future studies will compare the
abilities of MnP and LiP to degrade lignin from hardwoods and softwoods, and evaluate the
substrate specificity and specific activity of mannanases from P. carnosa.
79
Chapter 5 Comparative analysis of lignin peroxidase and manganese
peroxidase activity on coniferous and deciduous wood
ToF-SIMS was performed by Robyn Goacher. All other components of this chapter are the work
of J. MacDonald.
80
5.1. Introduction
The ratio of lip to mnp genes and transcripts appears to differ between P. carnosa and P.
chrysosporium. The P. carnosa genome contains seven mnp genes and only three lips; the
number of transcripts corresponding to individual mnp genes is also generally higher than the
number corresponding to individual lip genes in P. carnosa grown on wood substrates, as
determined by mRNA-Seq transcriptome sequencing and time-course RT-qPCR. By contrast, the
P. chrysosporium genome predicts five mnp and ten lip genes (Martinez et al. 2004), and
transcripts from individual lip genes appear to be more numerous than mnp transcripts in P.
chrysosporium grown on wood and under low nitrogen (ligninolytic) conditions (Vanden
Wymelenberg et al. 2009, Sato et al. 2009, Doddapaneni and Yadav 2005).
Differences in modes of lignin degradation catalyzed by MnP and LiP could affect the
efficiency of lignocellulose degradation by P. carnosa and P. chrysosporium. LiPs can directly
oxidize a variety of aromatic substrates, whereas MnPs mediate lignin degradation through
chelates of oxidized Mn3+
ions. Compared to LiP, the Mn3+
chelates have weaker oxidizing
power and are therefore only able to act on phenolic structures. However, chelates of Mn3+
ions
are likely more able to diffuse through plant cell walls than the larger lignin peroxidases
(Hammel and Cullen 2008). This property could facilitate the degradation of guaiacyl (G) lignin
in softwood, which can form more dense structures than guaiacyl-syringyl (GS) lignin (Cathala
et al. 2000), perhaps due its comparatively higher fraction of condensed biphenyl 5-5 bonds
(Sjostrom 1993). In fact, differences between G and GS lignin have been shown to affect the rate
of degradation by P. chrysosporium, which depolymerizes natural and synthetic G lignins more
slowly than natural and synthetic GS lignins (Faix et al. 1985, Otjen et al. 1988).
In the present study, MnP and LiP were each exposed to various soft- and hardwoods,
and lignin modification was assessed by characterizing residual wood samples using time-of
flight secondary ion mass spectrometry (ToF-SIMS). Exposure to MnP resulted in greater
modification of lignin in softwood compared to hardwood, while exposure to LiP resulted in
intermediate levels of lignin modification for both types of wood. MnP also resulted in more
modification of G compared to S lignin units in hardwood, whereas LiP modified both G and S
units equivalently.
81
5.2. Materials and Methods
5.2.1 Reaction conditions
MnP and LiP were each exposed to three softwood and three hardwood species. The
softwoods balsam fir (Abies balsamea), lodgepole pine (Pinus contorta), and white spruce (Picea
glauca) represent three taxonomic subfamilies of commercial importance in the Northern
hemisphere. These are also the softwood species that were used as substrate for mRNA-Seq
transcriptome sequencing and time-course RT-qPCR. Sugar maple (Acer saccharum), yellow
birch (Betula alleghaniensis), and trembling aspen (Populus tremuloides) are hardwoods in
various distantly related taxonomic orders (Soltis et al. 1999), and sugar maple was also used in
mRNA-Seq transcriptome sequencing and time-course RT-qPCR experiments.
Air-dried wood chips were ground in a Model 4 Wiley Mill (Thomas Scientific,
Swedesboro, NJ, USA), followed by a Wiley Mini-Mill (Thomas Scientific). Resultant wood
powder that could pass through a Testing Sieve (VWR International, Radnor, PA, USA) with 53
µm mesh-size was used for the experiments. Approximately 4 mg of each powdered wood
sample was extracted for 72 h at 37ºC and 180 rpm with 1 mL of solution consisting of 50 mM
malonate buffer (pH 4.5), 2 mM MnCl2, and 0.5% Tween 80, in order to remove soluble wood
components. MnP digests were prepared similarly to Hofrichter et al (2001), with each reaction
containing 4 mg of extracted wood powder and 1 mL of solution containing 50 mM sodium
malonate buffer (pH 4.5), 2 mM MnCl2 (a source of Mn2+
), 0.5% Tween 80 (a source of
unsaturated fatty acids, which can act as secondary redox messengers), 10 mM glucose (substrate
for glucose oxidase), 0.1 U glucose oxidase from Aspergillus niger (to produce the H2O2 needed
for peroxidase activity; Sigma-Aldrich Co., St. Louis, MO, USA), and 2 U MnP from
Nematoloma frowardii (Jena Bioscience GmbH, Jena, Germany). LiP digests were prepared
using 4 mg of extracted wood powder and 1 mL of solution containing 50 mM sodium malonate
buffer (pH 3.0), 2 mM veratryl alcohol (to prevent enzyme inactivation), 10 mM glucose, 0.1 U
glucose oxidase from Aspergillus niger, and 2 U LiP from P. chrysosporium (Sigma-Aldrich
Co.). One unit of glucose oxidase oxidizes 1.0 μmole of β-D-glucose to D-gluconolactone and
H2O2 per min at pH 5.1 and 35 °C; while 1 U MnP oxidizes 1 μmol Mn2+ per minute to Mn3+ at
pH 4.5 and 25 °C; and 1 U LiP oxidizes 1 μmol 3.4-dimethoxybenzyl alcohol per minute at pH
82
3.0 and 30 °C. Reactions for each wood species included controls lacking peroxidase (MnP or
LiP), lacking both peroxidase and glucose oxidase, lacking wood, or lacking all components
except for the peroxidase enzyme. For each of the two experiments (reactions with MnP or LiP),
there were three controls lacking the peroxidase, and six each of the other controls (one each
containing each type of wood). Reactions were incubated vertically in 10 mL screw-cap test
tubes for 72 h at 37ºC and 180 rpm. The tubes were opened once every 24 h to allow air
exchange. The 72 h samples were centrifuged for 1 min at 10,000 rpm to separate the wood from
the liquid.
5.2.2 Sequence alignment of commercial MnP and LiP
Commercial preparations of MnP and LiP were subjected to in-solution trypsin digestion
and liquid chromatography tandem mass spectrometry (LC-MS/MS) at the Advanced Protein
Technology Centre (Toronto, ON, Canada). The most abundant protein hits were aligned with
the predicted MnP and LiP sequences from P. carnosa using the CLUSTALW tool available
through Biology Workbench 3.2 (http://workbench.sdsc.edu/).
5.2.3 UV analysis
UV analysis was used to detect solubilized lignin products in the reaction liquid. Protein
was removed from reactions containing MnP by passing 500 l samples through a Nanosep 10K
ultrafiltration column (Pall Corporation, Port Washington, NY, USA). Absorbance of the starting
liquid and flowthrough was measured from 230 to 350 nm using an Infinite M200 microplate
reader (Tecan Group Ltd., Mannedorf, Switzerland) and quartz plate (Hellma GmbH & Co.,
Mullheim, Germany).
5.2.4 ToF-SIMS
ToF-SIMS was used to detect lignin modification on the surface of wood exposed to MnP
or LiP. Pelleted wood was washed three times with 1.5 mL distilled water and air dried.
Approximately 0.5 to 1.0 mg of dried wood powder was densely spread onto double-sided tape
and placed on a glass slide for surface analysis by ToF-SIMS. For each sample, seven to nine
positive ion spectra were obtained using a ToF-SIMS IV (IonTof GmbH, Munster, Germany).
83
Spectra were acquired using 50 keV Bi32+
primary ions operated in a high-current bunched mode
with a 0.3 pA pulsed current. Primary ions were rastered in random pattern over an area of at
least 500 x 500 μm2 covered by 128 x128 pixels. The acquisition time was 45 s. Low energy
electron flooding provided charge compensation. Mass resolution was variable due to
topography, and data was binned by nominal mass for calculations.
5.3. Results
5.3.1 Commercial MnP and LiP alignments
The most abundant protein from the commercial MnP preparation (from N. frowardii)
matched best to MnP3 from Phlebia sp. strain MG-60 (Accession # 169643677). N. frowardii is
believed to be of the Phlebia genus, which forms a phylogenetic sister group with the
Phanerochaete (Hilden et al. 2008). The most abundant protein from the commercial LiP
preparation (from P. chrysosporium) matched best to P. chrysosporium LiPH2 (Accession #
126282). Percent identities of Phlebia MnP3 and MnPs from P. carnosa ranged from 69% to
74%; likewise, percent identities of P. chrysosporium LiPH2 and LiPs from P. carnosa ranged
from 52% to 73% (Table 5.1). Corresponding protein alignments are presented in Appendix 6.
84
Table 5.1. Percent identities of Phlebia MnP3 and P. chrysosporium LiPH2 with corresponding
sequences from P. carnosa.
P. carnosa MnP*
% ID with
Phlebia
MnP 3
P. carnosa LiP*
% ID with
P. chrysosporium
LiPH2
MnP-256991_31 74 LiP-263501_9 73
MnP-262882_45 74 LiP-213241_489 69
MnP-256980_383 74 LiP-212237_8106 69
MnP-144982_1138 71 LiP-152156_9982 52
MnP-94399_1168 69
MnP-256997_1579 72
MnP-256984_697 74
*Number indicates the JGI protein ID followed by the transcript ID from Chapter 3. P. carnosa sequences
are ordered from high to low expression (top to bottom) based on the transcriptome analysis in Chapter 3.
5.3.2 UV analysis
UV analysis has been used previously to identify lignin degradation products released
into the soluble portion of reactions with MnP and eucalyptus wood (Cunha et al. 2010). In the
current study, absorbance values for the test samples (Fig. 5.1b, red) were higher than those for
the controls lacking MnP or both MnP and glucose oxidase (orange), and higher than the controls
with MnP only (black). These results were similar to the analysis of Cunha et al (Fig. 5.1a)
(Cunha et al. 2010). However, there was little separation between the values for test samples
(red) and the control reactions that contained all reaction components except wood (blue).
Notably, this particular control was not included in the analysis of Cunha et al (2010). It is
therefore probable that much of the absorbance difference between the experimental and control
reactions (other than the no-wood control) in both experiments result from modification of non-
wood reaction components, most likely linoleic acid and Tween 80. These substances are sources
of unsaturated fatty acids that can be oxidized by MnP (Kapich et al. 1999). Furthermore, such
lipid peroxidation of linoleic acid has been shown to increase UV absorbance readings from 200
85
to 300 nm, with peaks around 220-230 and 280 nm (Baron et al. 1997). While Cunha et al
included other controls that were said to have similar absorbance to “active MnP w/o linoleic
acid”, such as controls lacking Mn2+
or the H2O2 generating system composed of glucose/glucose
oxidase, they did not include control reactions without wood (Cunha et al. 2010).
It is now clear that simple UV measurements are unsuitable for detecting lignin
degradation products in reactions that include MnP and unsaturated fatty acids. Therefore, an
alternative method of detection is being developed using size exclusion chromatography (SEC),
which is anticipated to resolve differences between oxidized fatty acids and products of lignin
degradation.
Figure 5.1. UV analysis of MnP reactions. A: MnP with eucalyptus, from (Cunha et al. 2010).
Reproduced with permission from Elsevier Inc., license number 2916251402633. B: MnP with
wood types indicated. WGM, complete reaction with wood, glucose oxidase, and MnP; WG-,
control lacking MnP; W--, control lacking both glucose oxidase and MnP; MnP1-3, control
including MnP and water only.
5.3.3 ToF-SIMS surface analysis
While UV analysis of reaction supernatant failed to identify lignin degradation in wood
exposed to MnP, surface analysis of the wood itself has proven more useful. Wood surface
analysis was performed using ToF-SIMS, which has been shown to be useful for relative
230
240
250
260
270
280
290
300
310
320
330
340
350
0.0
0.5
1.0
1.5fir W GM
pine W GM
spruce W GM
maple W GM
birch W GM
aspen W GM
fir W G-
pine W G-
maple W G-
birch W G-
aspen W G-
fir W --
pine W --
spruce W --
maple W --
birch W --
aspen W --
-GM1
spruce W G-
-GM2
-GM3
MnP1
MnP2
MnP3
(B)
Wavelength (nm)
Ab
so
rb
en
ce
un
its
86
quantification of changes in wood chemistry (Goacher et al. 2012, Zhou et al. 2011). A lignin
modification metric (LMM) was calculated to determine modification of lignin on the surface of
wood samples exposed to MnP or LiP, as was previously done for wood exposed to laccase
(Goacher et al. 2012). The metric itself represents the amount of unmodified lignin, and is
calculated as the ratio of (G+S)/Ar, where G is the combined intensity of peaks corresponding to
intact methoxylated G-lignin (peaks at m/z 137 and 151), S is the combined intensity of peaks
corresponding to intact methoxylated S-lignin (peaks at m/z 167 and 181), and Ar is the
combined intensity of peaks for nonfunctionalized aromatic rings (peaks at m/z 77 and 91) (Fig.
5.2). Thus, a decrease in LMM is consistent with oxidative cleavage of methoxy moieties on the
lignin aromatic rings (Goacher et al. 2012). Figure 5.3 shows that the LMM decreased in
reactions containing peroxidase relative to controls, indicating modification of wood lignins by
both MnP and LiP. The plot shows good reproducibility with respect to patterns of the two
replicate MnP experiments, suggesting that the single experiment with the more expensive LiP
should be representative of LiP activity. Finally, the small standard deviation associated with
technical replicates, which accounts for both the instrumental variability as well as variations in
the wood substrates, further demonstrates measurement reproducibility.
Figure 5.2. Structures of ion peaks detected by ToF-SIMS that were used to calculate the lignin
modification metric (LMM).
87
A)
B)
Figure 5.3. Lignin modification metric (LMM) calculated for (A) duplicate reactions containing
MnP or (B) single reactions containing LiP. Bars correspond to controls lacking peroxidase (dark
grey), controls lacking both peroxidase and glucose oxidase (light grey), and reactions containing
all enzymes (black bars). G, intact methoxylated G-lignin (peaks at m/z 137 and 151); S, intact
methoxylated S-lignin (peaks at m/z 167 and 181); Ar, nonfunctionalized aromatic rings (peaks
at m/z 77 and 91). Error bars represent standard deviation of technical replicates, n=7 to 9, where
n refers to the number of analyzed positions on the same wood surface.
█ w/o peroxidase
█ w/o pero xidase & glucose oxidase
█ full reaction
88
To reveal differences in the LMM determined for softwood and hardwood samples
treated with MnP or LiP, the percent lignin modification was calculated according to the
following equation:
(LMMC--LMMP)/LMMC*100%
where LMMP is the lignin modification metric for reactions containing peroxidase, and LMMC
represents the corresponding control lacking peroxidase and glucose oxidase. Data represented in
Fig. 5.3 were used in these calculations.
Compared with control reactions, the average percent lignin modification for all softwood
samples exposed to MnP and all hardwood samples exposed to MnP was 28% and 18%,
respectively (see Appendix 7). This difference was significant by Bonferroni's post-test
following 2-way ANOVA (p < 0.001). By contrast, the average percent lignin modification of
softwood and hardwood samples by LiP, was 21% and 22%, respectively, which did not
significantly differ (p > 0.05). Overall, lignin modification of softwood samples exposed to MnP
was also significantly higher than corresponding samples exposed to LiP (28% vs. 21%, p <
0.05). In fact, the lowest percent modification value for softwood exposed to MnP was greater
than the highest value for softwood exposed to LiP (Appendix 7). However, direct comparisons
between MnP and LiP may be less dependable due to differences in reaction conditions and
possible small differences in enzyme loading.
In previous studies, Mn3+
has been shown to oxidize G-lignins more quickly than S-
lignins (Hammel et al. 1989), and eucalyptus wood treated with MnP shows a greater percent
reduction in G compared to S lignin units (Cunha et al. 2010). To determine the roles of G and S
units in lignin modification metric calculated for the current reactions, the modification of G and
S lignin were calculated as follows:
G-lignin modification metric (GMM) = G/Ar
S-lignin modification metric (SMM) = S/Ar
The percent G and S lignin modifications were then calculated as follows:
% GMM = (GMMC-GMMP)/GMMC*100%
89
% SMM = (SMMC--SMMP)/SMMC*100%.
where GMMP and SMMP are G-lignin and S-lignin modification metrics for reactions containing
peroxidase, and GMMC and SMMC represent corresponding controls that lack peroxidase and
glucose oxidase. These calculations were performed for reactions containing hardwood samples
only, as softwood lignin consists mainly of G lignin. Similar to previous findings, exposure to
MnP resulted in significantly more modification of G-lignin compared to S-lignin (21% vs 12%,
p < 0.05), indicating that MnP selectively degrades G-lignin (Fig. 5.4). By contrast exposure to
LiP resulted in similar modification of G and S lignins (22% vs 23%, p > 0.05).
Figure 5.4. Percent modification of G-lignin and S-lignin subunits in hardwood species exposed
to MnP and LiP. For reactions with MnP, samples from two replicate experiments are indicated
by numbers.
90
5.4. Discussion
Exposure to MnP resulted in greater modification of G-lignin compared to S-lignin in
sugar maple, trembling aspen, and yellow birch, which is consistent with previous analyses of
Mn3+
exposed to synthetic lignins (Hammel et al. 1989) and of MnP exposed to eucalyptus wood
(Cunha et al. 2010). However, this is the first study to compare the activities of MnP and LiP on
multiple softwood and hardwood species. The current results show that greater modification of
G-lignin by MnP is correlated to greater modification of lignin in intact softwood compared to
hardwood; and that LiP does not exhibit the same trends.
Comparatively high MnP activity on G-lignin compared to S-lignin might result from the
higher proportion of phenolic residues in G-lignin (Sjostrom 1993). Because it has a lower
oxidizing power compared with LiP, the Mn3+
-chelate that mediates MnP activity can only
directly oxidize phenolic substrates (Wong 2009), which are more numerous in G-lignin
(Sjostrom 1993). While indirect oxidation through unsaturated fatty acids can act on
nonphenolics, this mechanism may work more slowly (Kapich et al. 1999). One study has also
shown that synthetic, nonphenolic G-lignin models are more easily oxidized than corresponding
S-lignin models, based on reaction rates with Mn3+
and ionization potentials from charge-transfer
data (Hammel et al. 1989). These results were deemed surprising given the anticipated influence
of the additional methoxyl group on the ionization potential of S-lignin. However, the
consistency of the current study with Hammel et al (1989) suggests that the efficiency of MnP-
mediated activity might be higher on G-lignin than S-lignin units.
An advantage of MnP compared to LiP for G-lignin transformation might be the
relatively small size of oxidized mediators. Because G-lignin lacks a methoxy group at the 5-
position, it can form more highly crosslinked structures than S lignin (section 1.1.3). MnP acts
through small Mn3+
-chelator complexes, where the chelator is normally malonate (used in this
study) or oxalate. In contrast, LiP oxidizes lignin either directly or through a mediator, typically
veratryl alcohol. Mn3+
-malonate and Mn3+
oxalate complexes are similar to veratryl alcohol in
molecular weight (157 Da, 143 Da, and 169 Da, respectively). However, the density of Mn2+
-
oxalate and veratryl alcohol is 2.45 and 1.16, respectively (data from Alfa Aesar,
http://www.alfa.com), giving corresponding molecular volumes of 58 m3/mol and 146 m
3/mol. It
is possible then, that the smaller volume complexes produced by MnP are more able to contact
91
and oxidize the highly-crosslinked G units in softwood lignin. In addition, MnP is approximately
ten times more resistant than LiP to phenol-induced enzyme inhibition (Timofeevski et al. 1998,
Wariishi and Gold 1990, Harvey and Palmer 1990; and see section 1.2.4), and this resistance
could also contribute to enhanced MnP activity on G-lignin.
While resistance to product inhibition and involvement of small oxidized mediators are
expected to enhance MnP activity on softwood lignin, the lower redox potential of MnP
compared to LiP remains the most likely explanation for comparatively low MnP activity on
hardwood lignin. Alternatively, MnP might be susceptible to reaction products generated upon
oxidation of S-lignin units. Availability of an ample supply of MnP will be important to
distinguishing these possibilities. Still, the results presented here support the hypothesis that MnP
and LiP have differing abilities to degrade lignin in deciduous and coniferous trees, and are
consistent with the relative abundance of MnP and LiP encoding genes in P. carnosa and P.
chrysosporium, as well as the primary isolation of these fungi from conifers and hardwoods,
respectively.
In collaboration with Natural Resources Canada (NRCan, Great Lakes Forestry Centre),
the results of ToF-SIMS will be confirmed by analyzing the liquid fraction of reaction mixtures
by high performance size-exclusion chromatography followed by mass spectrometry. Solubilized
lignin products detected in reaction supernatants will be correlated to the percent lignin loss on
the wood surface of softwood and hardwood samples exposed to MnP and LiP. It is anticipated
that reactions with greater modification of lignin at the wood surface will also have a greater
amount of solubilized lignin compounds in the reaction liquid.
92
6. Conclusions and Future Directions
In an attempt to uncover the genetic adaptations that promote softwood utilization by P.
carnosa, the genes and transcripts that encode its lignocellulose-degrading activities were first
studied through genome and transcriptome sequencing. These exploratory analyses led to the
identification of differences between P. carnosa and its relative P. chrysosporium, which may
help to explain the primary occurrence of the two species on different types of wood. In contrast
to P. chrysosporium, P. carnosa has more genes that encode the lignin-degrading enzyme MnP,
and fewer that encode LiP, and many of these mnp transcripts are more highly expressed than
either lips or CAZymes. Subsequently, RT-qPCR was used to follow the levels of transcripts
encoding select MnP, LiP, and CAZymes during growth on four types of wood, and confirmed
high levels of mnp across three time points. Of additional interest was that a lip transcript was
significantly more abundant during growth on maple (hardwood) compared to fir, pine, or spruce
(softwood). This result, as well as the prominence of mnp in the softwood-degrading P. carnosa
and of lip in the hardwood-degrading P. chrysosporium, suggested that MnP might play a more
important role in the degradation of lignin from softwood compared to hardwood. To test this
hypothesis, various softwoods and hardwoods were exposed to MnP and LiP and the extents of
lignin modification on the wood surface were analyzed using ToF-SIMS. These analyses support
the idea that MnP is more effective at modifying lignin from softwood compared to hardwood;
that MnP is more effective than LiP at modifying lignin from softwood; and that differences
between G-lignin and S-lignin contribute to these differences.
Overall, results support the following hypotheses that were the basis for this research:
(1) Comparing the genome sequences of P. carnosa and the related hardwood-degrading
Phanerochaete chrysosporium will reveal differences that may contribute to differential substrate
preferences.
Yes: Genome comparison revealed different ratios of genes encoding MnP and LiP, as well as an
expansion of genes encoding P450s in P. carnosa;
93
(2) The expression profile of P. carnosa genes that encode lignocellulose-active enzymes will
depend on the source and composition of the lignocellulose substrate.
Yes: Transcriptome sequencing revealed greater abundance during growth on maple compared to
softwood of transcripts encoding two LiPs, including the one with the highest overall transcript
level (lip-263501). Significantly higher levels of lip-263501 during growth on maple compared
to softwoods were confirmed using RT-qPCR.
(3) Since the composition of lignocellulose substrates change during decay, the level of
expression of genes that encode lignocellulose-active enzymes will change over the course of
lignocellulose degradation.
Yes: Real-time RT-qPCR showed higher abundance of transcripts encoding P. carnosa lignin-
modifying activity (MnP and LiP) at earlier growth points, and higher abundance of transcripts
encoding cellulases and hemicellulases at later stages of decay.
(4) Given the differences in lignin composition of wood fiber from hardwood and softwood
trees, lignin-degrading enzymes encoded by P. carnosa will be more effective at degrading
lignin from softwood trees than P. chrysosporium.
Yes: Wood treated with MnP and LiP revealed greater modification of softwood and G-lignin
units by MnP.
(5) P. carnosa will grow better on softwood than on hardwood under laboratory conditions.
Yes: Greater growth was observed on softwood when water was used to moisten the wood.
Recommendations for further research include:
a) Characterization of highly expressed P. carnosa genes of unknown function; particularly those
matching protein IDs 256531, 257139, and 249130, whose corresponding genes in P.
chrysosporium (protein IDs 612, 930, and 1903) were also upregulated under ligninolytic
conditions. This could be done using RNA interference (RNAi), a sequence-specific knockdown
method that has been used successfully in P. chrysosporium (Matityahu et al. 2008), followed by
transcript analysis to determine possible effects on gene regulation. Moreover, either RNAi or
94
heterologous expression could be combined with compositional and structural analysis of wood
substrates after biological treatment to determine effects on lignocellulose degradation.
b) Further characterization of P. carnosa P450 enzymes, particularly those from the greatly
expanded CYP64 clan.
c) Further characterization of P. carnosa gene ID 265212 / transcript ID 970, which was the fifth
most abundant transcript during growth on wood relative to YMPG and was annotated as a
phosphatidylethanolamine binding protein. Phosphatidylethanolamine is a lipid found in cell
membranes, and this binding protein could be involved in transport of lignocellulose degradation
products into the cell.
d) Quantification of mnp and lip transcripts from both P. carnosa and P. chrysosporium grown
under identical conditions on a variety of hardwoods and softwoods to confirm differential
substrate-dependent expression in P. carnosa and determine patterns in P. chrysosporium.
e) While the Mn3+
chelator complex that mediates MnP activity is not capable of oxidizing
nonphenolic substrates, this can be accomplished through second mediators including lipids
(Wong 2009). Transcripts involved in lipid synthesis were more abundant in Ceriporiopsis
subvermispora grown on medium containing aspen wood compared to glucose (Fernandez-
Fueyo et al. 2012). Similar results were not seen in the transcriptome analysis of P. carnosa, but
it is possible that they would appear at other time points. Therefore, qRT-PCR could be done to
determine the abundance of such transcripts over a time course.
f) Analysis of solubilized lignin and carbohydrate degradation products in P. carnosa
cultivations over time, to support sequential decay of wood components, and comparisson to P.
chrysosporium grown under the same conditions.
g) Repetition of the lignin modification assay with varying enzyme-to-wood ratios in order to
determine how much LiP can compensate for MnP to achieve the same level of softwood lignin
modification; and with various LiP:MnP ratios to look for synergistic effects. Ideally, such
assays would use enzymes produced by heterologous expression and purified, as the current
commercial preparations may contain interfering proteins.
95
h) Repetition of the lignin modification assay with larger wood fragments over time, and
analyzing cross-sections by ToF-SIMS to determine whether MnP activity is better able to
penetrate the samples compared with LiP activity.
i) The experiment in the thesis used wood to answer the more basic and application-driven
question of whether LiP and MnP have differing abilities to modify lignin from hardwood and
softwood. However, using isolated and synthetic lignins will allow future researchers to
determine why these differences occur.
96
7. Engineering Relevance
Softwood is among the largest sources of biomass that could be used to produce
renewable liquid fuel, biopolymers, or chemicals in Canada. It is also the primary resource used
in Canada's pulp and paper industry. Each of these applications require that lignin be separated
from other wood components; however, current chemical and physical methods of
delignification are energy-intensive and can produce substances that inhibit carbohydrate
hydrolysis and fermentation in subsequent steps (Hamelinck et al. 2005). In contrast, biopulping
uses whole micro-organisms or their isolated enzymes to remove most of the wood‟s lignin prior
to downstream processing. Potential benefits include reduced use of bleaching chemicals and an
increase in the strength of the pulp fibres used in paper manufacturing (Kirk et al. 1993). Such
biodelignification could be improved by using organisms or enzymes that are tailored to the type
of wood that is being processed.
The current study suggests that the sequential degradation exhibited by P. carnosa, along
with its ability to grow on a variety of industrially relevant softwoods, could make it an attractive
biopulping organism. It indicates that MnP would be most useful for enzymatic delignification of
softwood, whereas LiP may be more effective at modifying lignin from hardwood feedstocks.
Softwood lignin may also be more amenable to degradation by non-biological, MnP-mimicking
technologies, such as Mn3+
from Mn(III) acetate (Hammel et al. 1989), or other transition metal
salts (Werhan et al. 2011). Where multiple modifications of lignocellulose are required, this
research suggests that they be done sequentially, with lignin being modified before the
carbohydrate components. Finally, the genomic and transcriptomic analyses of P. carnosa have
generated a library of enzyme candidates that could be relevant to softwood bioprocessing. In
particular, given their expansion in the P. carnosa genome, P450 monooxygenases from this
white-rot might be developed for detoxification of wood extractives.
97
8. References
Abbas A, Koc H, Liu F, Tien M (2005) Fungal degradation of wood: initial proteomic analysis of
extracellular proteins of Phanerochaete chrysosporium grown on oak substrate. Curr Genet 47: 49-56
Alvarez JM, Canessa P, Mancilla RA, Polanco R, Santibanez PA, Vicuna R (2009) Expression of genes
encoding laccase and manganese-dependent peroxidase in the fungus Ceriporiopsis subvermispora is
mediated by an ACE1-like copper-fist transcription factor. Fungal Genet Biol 104-111
Baron CP, Bro R, Skibsted LH, Andersen HJ (1997) Direct measurement of lipid peroxidation in oil-in-
water emulsions using multiwavelength derivative UV-spectroscopy. J Agric Food Chem 45: 1741-1745
Barr DP and Aust SD (1994) Conversion of lignin peroxidase compound III to active enzyme by cation
radicals. Arch Biochem Biophys 312: 511-515
Belinky PA, Flikshtein N, Dosoretz CG (2006) Induction of lignin peroxidase via reactive oxygen species
in manganese-deficient cultures of Phanerochaete chrysosporium. Enzyme Microb Tech 39: 222-228
Belinky PA, Flikshtein N, Lechenko S, Gepstein S, Dosoretz CG (2003) Reactive oxygen species and
induction of lignin peroxidase in Phanerochaete chrysosporium. Appl Environ Microbiol 69: 6500-6506
Birch PRJ, Sims PFG, Broda P (1995) Substrate-dependent differential splicing of introns in the regions
encoding the cellulose-binding domains of 2 exocellobiohydrolases-I-like genes in Phanerochaete
chrysosporium. Appl Environ Microbiol 61: 3741-3744
Blanchette RA, Bumes TA, Eerdmans MM, Akhtar M (1992) Evaluating isolates of Phanerochaete
chrysosporium and Ceriporiopsis subvermispora for use in biological pulping processes. Holzforschung
46: 109-115
Blanchette RA, Otjen L, Effland MJ, Eslyn WE (1985) Changes in structural and chemical-components
of wood delignified by fungi. Wood Sci Technol 19:35-46
Bogan BW, Schoenike B, Lamar RT, Cullen D (1996) Expression of lip genes during growth in soil and
oxidation of anthracene by Phanerochaete chrysosporium. Appl Environ Microbiol 62: 3697-3703
Bonawitz ND and Chapple C (2010) The genetics of lignin biosynthesis: connecting genotype to
phenotype. Annu Rev Genet 44: 337-363
Boominathan K, Reddy CA (1992) cAMP-mediated differential regulation of lignin peroxidase and
manganese-dependent peroxidase production in the white-rot Basidiomycete Phanerochaete
chrysosporium. P Natl Acad Sci USA 89: 5586-5590
Brown JA, Li D, Alic M, Gold MH (1993) Heat shock induction of manganese peroxidase gene
transcription in Phanerochaete chrysosporium. Appl Environ Microbiol 59: 4295-4299
Buonocore F, Prugnoli D, Falasca C, Secombes CJ, Scapigliati G (2003) Peculiar gene organisation and
incomplete splicing of sea bass (Dicentrarchus labrax L.) interleukin-1 beta. Cytokine 21: 257-264
98
Burdsall HH (1985) A contribution to the taxonomy of the genus Phanerochaete. Mycologia Memoirs 10:
1-165
Burdsall HH, Eslyn W (1974) A new Phanerochaete with a Chrysosporium imperfect state. Mycotaxon
1: 123-133
Cameron MD, Timofeevski S, Aust SD (2000) Enzymology of Phanerochaete chrysosporium with
respect to the degradation of recalcitrant compounds and xenobiotics. Appl Microbiol Biotechnol 54: 751-
758
Campbell MM, Sederoff RR (1996) Variation in lignin content and composition. Plant Physiol 110: 3-13
Canessa P, Alvarez JM, Polanco R, Bull P, Vicuna R (2008) The copper-dependent ACE1 transcription
factor activates the transcription of the mco1 gene from the basidiomycete Phanerochaete chrysosporium.
Microbiol -SGM 154: 491-499
Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B (2009) The Carbohydrate-
Active EnZymes database (CAZy): an expert resource for Glycogenomics. Nucleic Acids Res 37: D233-
D238
Cantarel BL, Korf I, Robb SC, Parra G, Ross E, Moore B, Holt C, Alvarado AS, Yandell M (2008)
MAKER: An easy-to-use annotation pipeline designed for emerging model organism genomes. Genome
Res 18: 188-196
Cathala B, Lee LT, Aguie-Beghin V, Douillard R, Monties B (2000) Organization behavior of guaiacyl
and guaiacyl/syringyl dehydrogenation polymers (lignin model compounds) at the air/water interface.
Langmuir 16: 10444-10448
Chung N, Aust SD (1995) Inactivation of lignin peroxidase by hydrogen peroxide during the oxidation of
phenols. Arch Biochem Biophys 316: 851-855
Coutinho PM, Andersen MR, Kolenova K, vanKuyk PA, Benoit I, Gruben BS, Trejo-Aguilar B, Visser
H, van Solingen P, Pakula T, Seiboth B, Battaglia E, Aguilar-Osorio G, de Jong JF, Ohm RA, Aguilar M,
Henrissat B, Nielsen J, Stalbrand H, de Vries RP (2009) Post-genomic insights into the plant
polysaccharide degradation potential of Aspergillus nidulans and comparison to Aspergillus niger and
Aspergillus oryzae. Fungal Genet Biol 46: S161-S169
Cui F, Dolphin D (1990) The role of manganese in model systems related to lignin biodegradation.
Holzforschung 44: 279-283
Cunha GGS, Masarin F, Norambuena M, Freer J, Ferraz A (2010) Linoleic acid peroxidation and lignin
degradation by enzymes produced by Ceriporiopsis subvermispora grown on wood or in submerged
liquid cultures. Enzyme Microb Technol 46: 262-267
de Koker TH, Nakasone KK, Haarhof J, Burdsall HH, Janse BJH (2003) Phylogenetic relationships of the
genus Phanerochaete inferred from the internal transcribed spacer region. Mycol Res 107: 1032-1040
Dhawale SS (1993) Is an activator protein-2-like transcription factor involved in regulating gene
expression during nitrogen limitation in fungi. Appl Environ Microbiol 59: 2335-2338
Doddapaneni H, Chakraborty R, Yadav JS (2005) Genome-wide structural and evolutionary analysis of
the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium:
Evidence for gene duplications and extensive gene clustering. BMC Genomics 6: 92
99
Doddapaneni H, Yadav JS (2005) Microarray-based global differential expression profiling of P450
monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus
Phanerochaete chrysosporium. Mol Genet Genomics 274: 454-466
Doddapaneni H, Yadav J (2004) Differential regulation and xenobiotic induction of tandem P450
monooxygenase genes pc-1 (CYP63A1) and pc-2 (CYP63A2) in the white-rot fungus Phanerochaete
chrysosporium. Appl Microbiol Biotechnol 65: 559-565
Eisenstadt MA, Bogolitsyn KG (2010) Peroxidase oxidation of lignin and its model compounds. Russ J
Bioorg Chem 36: 802-815
Espineira JM, Novo-Uzal E, Gomez-Ros LV, Carrion JS, Merino F, Ros-Barcelo A, Pomar F (2011)
Distribution of lignin monomers and the evolution of lignification among lower plants. Plant Biol 13: 59-
68.
Faix O, Bremer J, Meier D, Fortmann I, Scheijen MA, Boon JJ (1992) Characterization of tobacco lignin
by analytical pyrolysis and Fourier transform-infrared spectroscopy. J Anal Appl Pyrolysis 22: 239-259
Faix O, Beinhoff O (1988) FTIR spectra of milled wood lignins and lignin polymer models (DHPs) with
enhanced resolution obtained by deconvolution. J Wood Chem Technol 8: 505-522
Faix O, Mozuch MD, Kirk TK (1985) Degradation of gymnosperm (guaiacyl) vs angiosperm (syringyl
guaiacyl) lignins by Phanerochaete chrysosporium. Holzforschung 39: 203-208
Fernandez-Fueyo E, Ruiz-Duenas FJ, Ferreira P, Floudas D, Hibbett DS, Canessa P, Larrondo LF, James
TY, Seelenfreund D, Lobos S, Polanco R, Tello M, Honda Y, Watanabe T, Watanabe T, San RJ, Kubicek
CP, Schmoll M, Gaskell J, Hammel KE, St John FJ, Vanden Wymenlenberg A, Sabat G, Splinter
BonDurant S, Syed K, Yadav JS, Doddapaneni H, Subramanian V, Lavin JL, Oguiza JA, Perez G,
Pisabarro AG, Ramirez L, Santoyo F, Master E, Coutinho PM, Henrissat B, Lombard V, Magnuson JK,
Kues U, Hori C, Igarashi K, Samejima M, Held BW, Barry KW, LaButti KM, Lapidus A, Lindquist EA,
Lucas SM, Riley R, Salamov AA, Hoffmeister D, Schwenk D, Hadar Y, Yarden O, de Vries RP,
Wiebenga A, Stenlid J, Eastwood D, Grigoriev IV, Berka RM, Blanchette RA, Kersten P, Martinez AT,
Vicuna R, Cullen D (2012) Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete
chrysosporium provide insight into selective ligninolysis. PNAS (published online ahead of print), doi:
10.1073/pnas.1119912109
Frohlich MW, Chase MW (2007) After a dozen years of progress the origin of angiosperms is still a great
mystery. Nature 450: 1184-1189
Fukushima K, Terashima N (1991) Heterogeneity in formation of lignin. Part XV: Formation and
structure of lignin in compression wood of Pinus thunbergii studied by microautoradiography. Wood Sci
Technol 25: 371-381
Galbe M, Zacchi G (2002) A review of the production of ethanol from softwood. Appl Microbiol
Biotechnol 59: 618-628
Gassara F, Brar SK, Tyagi RD, John RP, Verma M, Valero JR (2011) Parameter optimization for
production of ligninolytic enzymes using agro-industrial wastes by response surface method. Biotechnol
Bioproc E 16: 343-351
100
Goacher RE, Edwards EA, Yakunin AF, Mims CA, Master ER (2012) Application of time-of-flight
secondary ion mass spectrometry for the detection of enzyme activity on solid wood substrates. Anal
Chem 84: 4443-4451
Godfrey BJ, Mayfield MM, Brown JA, Gold MH (1990) Characterization of a gene encoding a
manganese peroxidase from Phanerochaete chrysosporium. Gene 93: 119-124
Gold MH, Alic M (1993) Molecular Biology of the lignin-degrading Basidiomycete Phanerochaete
chrysosporium. Microbiol Rev 57: 605-622
Grunwald C, Ruel K, Kim YS, Schmitt U (2002) On the cytochemistry of cell wall formation in poplar
trees. Plant Biol 4: 13-21
Haemmerli SD, Schoemaker HE, Schmidt HWH, Leisola MSA (1987) Oxidation of veratryl alcohol by
the lignin peroxidase of Phanerochaete chrysosporium: Involvement of activated oxygen. FEBS Lett 220:
149-154
Hamelinck CN, van Hooijdonk G, Faaij APC (2005) Ethanol from lignocellulosic biomass: techno-
economic performance in short-, middle- and long-term. Biomass Bioenerg 28: 384-410
Hammel KE, Cullen D (2008) Role of fungal peroxidases in biological ligninolysis. Curr Opin Plant Biol
11: 349-355
Hammel KE, Tardone PJ, Moen MA, Price LA (1989) Biomimetic oxidation of nonphenolic lignin
models by Mn(III): new observations on the oxidizability of guaiacyl and syringyl substructures. Arch
Biochem Biophys 270: 404-409
Harvey PJ, Palmer JM (1990) Oxidation of phenolic compounds by ligninase. J Biotechnol 13: 169-179
Henrissat B, Davies G (1997) Structural and sequence-based classification of glycoside hydrolases. Curr
Opin Struc Biol 7: 637-644
Henrissat B, Driguez H, Viet C, Schulein M (1985) Synergism of cellulases from Trichoderma reesei in
the degradation of cellulose. Bio/technology 3: 722-726
Hergert HL (1971) Infrared spectra. In: Sarkanen KV and Ludwig CH (eds) Lignins: occurrence,
formation, structure and reactions. Wiley-Interscience, New York, NY, USA
Hibbett DS, Donoghue MJ (2001) Analysis of character correlations among wood decay mechanisms,
mating systems, and substrate ranges in homobasidiomycetes. Syst Biol 50: 215-242
Hilden KS, Bortfeldt R, Hofrichter M, Hatakka A, Lundell TK (2008) Molecular characterization of the
basidiomycete isolate Nematoloma frowardii b19 and its manganese peroxidase places the fungus in the
corticoid genus Phlebia. Microbiol-SGM 154: 2371-2379
Hobro AJ, Lendl B, Kuligowski J, Doll M (2010) Differentiation of walnut wood species and steam
treatment using ATR-FTIR and partial least squares discriminant analysis (PLS-DA). Anal Bioanal Chem
398: 2713-2722
Hofrichter M, Lundell T, Hatakka A (2001) Conversion of milled pine wood by manganese peroxidase
from Phlebia radiata. Appl Environ Microbiol 67: 4588-4593
101
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Evolution - Bayesian inference of phylogeny
and its impact on evolutionary biology. Science 294: 2310-2314
Janse BJH, Gaskell J, Akhtar M, Cullen D (1998) Expression of Phanerochaete chrysosporium genes
encoding lignin peroxidases, manganese peroxidases, and glyoxal oxidase in wood. Appl Environ
Microbiol 64: 3536-3538
Kacurakova M, Smith AC, Gidley MJ, Wilson RH (2002) Molecular interactions in bacterial cellulose
composites studied by 1D FT-IR and dynamic 2D FT-IR spectroscopy. Carbohyd Res 337: 1145-1153
Kacurakova M, Capek P, Sasinkova V, Wellner N, Ebringerova A (2000) FT-IR study of plant cell wall
model compounds: pectic polysaccharides and hemicelluloses. Carbohyd Polym 43: 195-203
Kacurakova M, Belton PS, Wilson RH, Hirsch J, Ebringerova A (1998) Hydration properties of xylan-
type structures: an FTIR study of xylooligosaccharides. J Sci Food Agr 77: 38-44
Kapich A, Hofrichter M, Vares T, Hatakka A (1999) Coupling of manganese peroxidase-mediated lipid
peroxidation with destruction of nonphenolic lignin model compounds and C-14-labeled lignins. Biochem
Bioph Res Co 259: 212-219
Kenealy WR, Dietrich DM (2004) Growth and fermentation responses of Phanerochaete chrysosporium
to O-2 limitation. Enzyme Microb Technol 34: 490-498
Kersten PJ (1990) Glyoxal oxidase of Phanerochaete chrysosporium: Its characterization and activation
by lignin peroxidase. Proc Nat Acad Sci USA 87: 2936-2940
Kersten P, Cullen D (2007) Extracellular oxidative systems of the lignin-degrading Basidiomycete
Phanerochaete chrysosporium. Fungal Genet Biol 44: 77-87
Kersten PJ, Kalyanaraman B, Hammel KE, Reinhammar B (1990) Comparison of lignin peroxidase,
horseradish peroxidase and laccase in the oxidation of methoxybenzene. Biochem J 268: 475-480
Kim DW, Kim A, Kim RN, Nam SH, Kang A, Chung WT, Choi SH, Park HS (2010) Comparative
analysis of expressed sequence tags from the white-rot fungi (Phanerochaete chrysosporium). Mol Cells
29: 131-144
Kirk, T.K., Koning, J.W., Burgess, R.R., Akhtar, M., Blanchette, R.A., Cameron, D.C., Cullen, D.,
Kersten, P.J., Lightfoot, E.N., Myers, G.C., Sachs, I., Sykes, M., and Wall, M.B. (1993). Biopulping: a
glimpse of the future? Forest Products Laboratory, United States Department of Agriculture.
http://www.fpl.fs.fed.us/documnts/fplrp/fplrp523.pdf
Kirk TK, Farrell RL (1987) Enzymatic combustion - the microbial degradation of lignin. Annu Rev
Microbiol 41: 465-505
Kirk TK, Tien M, Faison BD (1984) BIochemistry of the oxidation of lignin by Phanerochaete
chrysosproium. Biotechnol Adv 2: 183-199
Lamar RT, Larsen MJ, Kirk TK (1990) Sensitivity to and degradation of pentachlorophenol by
Phanerochaete spp. Appl Environ Microbiol 56: 3519-3526
Lareau LF, Green RE, Bhatnagar RS, Brenner SE (2004) The evolving roles of alternative splicing. Curr
Opin Struc Biol 14: 273-282
102
Larrondo LF, Canessa P, Melo F, Polanco R, Vicuna R (2007) Cloning and characterization of the genes
encoding the high-affinity iron-uptake protein complex Fet3/Ftr1 in the basidiomycete Phanerochaete
chrysosporium. Microbiol 153: 1772-1780
Larrondo LF, Gonzalez B, Cullen D, Vicuna R (2004) Characterization of a multicopper oxidase gene
cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts.
Microbiol -SGM 150: 2775-2783
Leisola MSA, Kozulic B, Meussdoerffer F, Fiechter A (1987) Homology among multiple extracellular
peroxidases from Phanerochaete chrysosporium. J Biol Chem 262: 419-424
Levasseur A, Plumi F, Coutinho PM, Rancurel C, Asther M, Delattre M, Henrissat B, Pontarotti P, Asther
M, Record E (2008) FOLy: An integrated database for the classification and functional annotation of
fungal oxidoreductases potentially involved in the degradation of lignin and related aromatic compounds.
Fungal Genet Biol 45: 638-645
Li KC (2003) The role of enzymes and mediators in white-rot fungal degradation of lignocellulose. ACS
symposium series 845: 196-209
Li B, Nagalla SR, Renganathan V (1997) Cellobiose dehydrogenase from Phanerochaete chrysosporium
is encoded by two allelic variants. Appl Environ Microbiol 63: 796-799
Li D, Alic M, Brown JA, Gold MH (1995) Regulation of manganese peroxidase gene transcription by
hydrogen peroxide, chemical stress, and molecular oxygen. Appl Environ Microbiol 61: 341-345
Lin Y, Tanaka S (2006) Ethanol fermentation from biomass resources: current state and prospects. Appl
Microbiol Biotechnol 69: 627-642
Ma B, Mayfield MB, Godfrey BJ, Gold MH (2004) Novel promoter sequence required for manganese
regulation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium.
Eukaryot Cell 3: 579-588
Macarena S, Larrondo LF, Vasquez M, Vicuna R, Gonzalez B (2005) Incomplete processing of
peroxidase transcripts in the lignin degrading fungus Phanerochaete chrysosporium. FEMS Microbiol
Lett 242: 37-44
MacDonald J, Master ER (2012) Time-dependent profiles of transcripts encoding lignocellulose-
modifying enzymes of the white rot fungus Phanerochaete carnosa grown on multiple wood substrates
Appl Environ Microbiol 78: 1596-1600
MacDonald J, Doering M, Canam T, Gong YC, Guttman DS, Campbell MM, Master ER (2011)
Transcriptomic responses of the softwood-degrading white-rot fungus Phanerochaete carnosa during
growth on coniferous and deciduous wood. Appl Environ Microbiol 77: 3211-3218
MacDonald MJ, Ambler R, Broda P (1985) Regulation of intracellular cyclic AMP levels in the white-rot
fungus Phanerochaete chrysosporium during the onset of idiophasic metabolism. Arch Microbiol 142:
152-156
Mahajan S (2011) Characterization of the white-rot fungus, Phanerochaete carnosa, through proteomic
methods and compositional analysis of decayed wood fibre. PhD thesis, University of Toronto
103
Mahajan S, Master ER (2010) Proteomic characterization of lignocellulose-degrading enzymes secreted
by Phanerochaete carnosa grown on spruce and microcrystalline cellulose. Appl Microbiol Biotechnol
86: 1903-1914
Martinez D, Challacombe J, Morgenstern I, Hibbett D, Schmoll M, Kubicek CP, Ferreira P, Ruiz-Duenas
FJ, Martinez AT, Kersten P, Hammel KE, Wymelenberg AV, Gaskell J, Lindquist E, Sabat G, BonDurant
SS, Larrondo LF, Canessa P, Vicuna R, Yadav J, Doddapaneni H, Subramanian V, Pisabarro AG, Lavin
JL, Oguiza JA, Master E, Henrissat BC,P.M., Harris P, Magnuson JK, Baker SE, Bruno K, Kenealy W,
Hoegger PJ, Kues U, Ramaiya P, Lucash S, Salamov A, Shapiro H, Tu H, Chee CL, Misra M, Xie G,
Teter S, Yaver D, James T, Mokrejs M, Pospisek M, Grigoriev IV, Brettin T, Rokhsar D, Berka R, Cullen
D (2009) Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports
unique mechanisms of lignocellulose conversion. Proc Natl Acad Sci U S A 106: 1954-1959
Martinez D, Larrondo L, Putnam N, Gelpke M, Huang K, Chapman J, Helfenbein KG, Ramaiya P, Detter
JC, Larimer F, Coutinho PM, Henrissat B, Berka R, Cullen D, Rokhsar D (2004) Genome sequence of the
lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat Biotechnol 22: 695-700
Matityahu A, Hadar Y, Dosoretz CG, Belinky PA (2008) Gene silencing by RNA interference in the
white rot fungus Phanerochaete chrysosporium. Appl Environ Microbiol 74: 5359-5365
Mayfield MB, Godfrey BJ, Gold MH (1994) Characterization of the mnp2 gene encoding manganese
peroxidase isozyme-2 from the Basidiomycete Phanerochaete chrysosporium. Gene 142: 231-235
Means AR (2000) Calcium and calmodulin-mediated regulatory mechanisms. In: Conn PM and Means
AR (eds) Principles of molecular regulation. Humana Press Inc, Totowa, New Jersey, USA, pp 187-204
Minami M, Suzuki K, Shimizu A, Hongo T, Sakamoto T, Ohyama N, Kitaura H, Kusaka A, Iwama K,
Irie T (2009) Changes in the gene expression of the white rot fungus Phanerochaete chrysosporium due
to the addition of atropine. Biosci Biotech Bioch 73: 1722-1731
Minami M, Kureha O, Mori M, Kamitsuji H, Suzuki K, Irie T (2007) Long serial analysis of gene
expression for transcriptome profiling during the initiation of ligninolytic enzymes production in
Phanerochaete chrysosporium. Appl Microbiol Biotechnol 75: 609-618
Moreira LRS, Filho EXF (2008) An overview of mannan structure and mannan-degrading enzyme
systems. Appl Microbiol Biot 79: 165-178
Morgenstern I, Klopman S, Hibbett DS (2008) Molecular evolution and diversity of lignin degrading
heme peroxidases in the agaricomycetes. J Mol Evol 66: 243-257
Morreel K, Dima O, Kim H, Lu F, Niculaes C, Vanholme R, Dauwe R, Goeminne G, Inze D, Messens E,
Ralph J, Boerjan W (2010) Mass spectrometry-based sequencing of lignin oligomers. Plant Physiol 153:
1464-1478
Nobles MK (1958) Cultural characters as a guide to the taxonomy and phylogeny of the polyporaceae.
Can J Bot 36: 883-926
Otjen L, Blanchette RA, Leatham GF (1988) Lignin distribution in wood delignified by white-rot fungi -
X-ray microanalysis of decayed wood treated with bromine. Holzforschung 42: 281-288
Otjen L, Blanchette R (1987) Assessment of 30 White Rot Basidiomycetes for Selective Lignin
Degradation. Holzforschung 41: 343-349
104
Palonen H, Thomsen AB, Tenkanen M, Schmidt AS, Viikari U (2004) Evaluation of wet oxidation
pretreatment for enzymatic hydrolysis of softwood. Appl Biochem Biotechnol 117: 1-17
Pandey KK, Pitman AJ (2003) FTIR studies of the changes in wood chemistry following decay by brown-
rot and white-rot fungi. Int Biodeter Biodegr 52: 151-160
Polanco R, Canessa P, Rivas A, Larrondo LF, Lobos S, Vicuna R (2006) Cloning and functional
characterization of the gene encoding the transcription factor Ace1 in the basidiomycete Phanerochaete
chrysosporium. Biol Res 39: 641-648
Raeder U, Broda P (1985) Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1: 17-
20
Ralph J, Lundquist K, Brunow G, Lu F, Kim H, Schatz PF, Marita JM, Hatfield RD, Ralf SA, Christensen
JH, Boerjan W (2004) Lignins: Natural polymers from oxidative coupling of 4-hydroxyphenyl-
propanoids. Phytochem Rev 3: 29-60
Ravalason H, Jan G, Molle D, Pasco M, Coutinho PM, Lapierre C, Pollet B, Bertaud F, Petit-Conil M,
Grisel S, Sigoillot JC, Asther M, Herpoel-Gimbert I (2008) Secretome analysis of Phanerochaete
chrysosporium strain CIRM-BRFM41 grown on softwood. Appl Microbiol Biotechnol 80: 719-733
Raven JA, Andrews M (2010) Evolution of tree nutrition. Tree physiology 30, 1050-1071
Rodriguez-Rincon F, Suarez A, Lucas M, Larrondo LF, de la Rubia T, Polaina J, Martinez J (2010)
Molecular and structural modeling of the Phanerochaete flavido-alba extracellular laccase reveals its
ferroxidase structure. Arch Microbiol 192: 883-892
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models.
Bioinformatics 19: 1572-1574
Sakamoto T, Yao Y, Hida, Honda Y, Watanabe T, Hashigaya W, Suzuki K, Irie T (2012) A calmodulin
inhibitor, W-7 influences the effect of cyclic adenosine 3', 5'-monophosphate signaling on ligninolytic
enzyme gene expression in Phanerochaete chrysosporium. AMB Express 2:7
Sakamoto T, Kitaura H, Minami M, Honda Y, Watanabe T, Ueda A, Suzuki K, Irie T (2010)
Transcriptional effect of a calmodulin inhibitor, W-7, on the ligninolytic enzyme genes in Phanerochaete
chrysosporium. Curr Genet 56: 401-410
Sato S, Feltus FA, Iyer P, Tien M (2009) The first genome-level transcriptome of the wood-degrading
fungus Phanerochaete chrysosporium grown on red oak. Curr Genet 55: 273-286
Sato S, Liu F, Koc H, Tien M (2007) Expression analysis of extracellular proteins from Phanerochaete
chrysosporium grown on different liquid and solid substrates. Microbiol -SGM 153: 3023-3033
Schmidt O (2006) Wood and tree fungi: biology, damage, protection, and use. Springer Berlin
Heidelberg, Berlin, Germany
Shaffer JP (1995) Multiple hypothesis testing. Annu Rev Psychol 46: 561-584
Sharma RK, Kalra J (1994) Molecular interaction between cAMP and calcium in calmodulin-dependent
cyclic-nucleotide phosphodiesterase system. Clin Invest Med 17: 374-382
105
Shary S, Kapich AN, Panisko EA, Magnuson JK, Cullen D, Hammel KE (2008) Differential expression
in Phanerochaete chrysosporium of membrane-associated proteins relevant to lignin degradation. Appl
Environ Microbiol 74: 7252-7257
Singh D, Zeng J, Chen S (2011) Increasing manganese peroxidase productivity of Phanerochaete
chrysosporium by optimizing carbon sources and supplementing small molecules. Lett Appl Microbiol
53: 120-123
Sjostrom E (1993) Wood chemistry : fundamentals and applications. Academic Press, San Diego
Soltis PS, Soltis DE, Chase MW (1999) Angiosperm phylogeny inferred from multiple genes as a tool for
comparative biology. Nature 402: 402-404
Stanke M, Tzvetkova A, Morgenstern B (2006) AUGUSTUS at EGASP: using EST, protein and genomic
alignments for improved gene prediction in the human genome. Genome Biol 7: S11
Stewart P, Gaskell J, Cullen D (2000) A homokaryotic derivative of a Phanerochaete chrysosporium
strain and its use in genomic analysis of repetitive elements. Appl Environ Microbiol 66: 1629-1633
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy
SL, Golub TR, Lander ES, Mesirov JP (2005) Gene set enrichment analysis: A knowledge-based
approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102: 15545-15550
Suzuki H, Igarashi K, Samejima M (2010) Cellotriose and cellotetraose as inducers of the genes encoding
cellobiohydrolases in the Basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 76:
6164-6170
Suzuki H, Igarashi K, Samejima M (2009) Quantitative transcriptional analysis of the genes encoding
glycoside hydrolase family 7 cellulase isozymes in the basidiomycete Phanerochaete chrysosporium.
FEMS Microbiol Lett 299: 159-165
Tien M, Kirk TK (1984) Lignin-degrading enzyme from Phanerochaete chrysosporium: Purification,
characterization, and catalytic properties of a unique H2O2-requiring oxygenase. Proc Natl Acad Sci U S
A 81: 2280-2284
Tien M, Kirk TK (1983) Lignin-degrading enzyme from the Hymenomycete Phanerochaete
chrysosporium Burds. Science 221: 661-663
Timofeevski SL, Reading NS, Aust SD (1998) Mechanisms for protection against inactivation of
manganese peroxidase by hydrogen peroxide. Arch Biochem Biophys 356: 287-295
Thomas P (2000) Trees: their natural history. Cambridge University Press, Cambridge, UK
Urek RO, Pazarlioglu NK (2004) Purification and partial characterization of manganese peroxidase from
immobilized Phanerochaete chrysosporium. Process Biochem 39: 2061-2068
Vallim MA, Janse BJH, Gaskell J, Pizzirani Kleiner AA, Cullen D (1998) Phanerochaete chrysosporium
cellobiohydrolase and cellobiose dehydrogenase transcripts in wood. Appl Environ Microbiol 64: 1924-
1928
van den Brink J, de Vries RP (2011) Fungal enzyme sets for plant polysaccharide degradation. Appl
Microbiol Biotechnol 91: 1477-1492
106
Vanden Wymelenberg A, Gaskell J, Mozuch M, BonDurant SS, Sabat G, Ralph J, Skyba O, Mansfield
SD, Blanchette RA, Grigoriev IV, Kersten PJ, Cullen D (2011) Significant alteration of gene expression
in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species. Appl Environ
Microbiol 77: 4499-4507
Vanden Wymelenberg A, Gaskell J, Mozuch M, Sabat G, Ralph J, Skyba O, Mansfield SD, Blanchette
RA, Martinez D, Grigoriev I:K,P.J., Cullen D (2010) Comparative transcriptome and secretome analysis
of wood decay fungi Postia placenta and Phanerochaete chrysosporium. Appl Environ Microbiol 76:
3599-3610
Vanden Wymelenberg A, Gaskell J, Mozuch M, Kersten P, Sabat G, Martinez D, Cullen D (2009)
Transcriptome and secretome analyses of Phanerochaete chrysosporium reveal complex patterns of gene
expression. Appl Environ Microbiol 75: 4058-4068
Vanden Wymelenberg A, Minges P, Sabat G, Martinez D, Aerts A, Salamov A, Grigoriev I, Shapiro H,
Putnam N, Belinky P, Dosoretz C, Gaskell J, Kersten P, Cullen D (2006a) Computational analysis of the
Phanerochaete chrysosporium v2.0 genome database and mass spectrometry identification of peptides in
ligninolytic cultures reveal complex mixtures of secreted proteins. Fungal Genet Biol 43: 343-356
Vanden Wymelenberg A, Sabat G, Mozuch M, Kersten PJ, Cullen D, Blanchette RA (2006b) Structure,
organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-
degrading basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 72: 4871-4877
Vanholme R, Demedts B, Morreel K, Ralph J, Boerjan W (2010) Lignin biosynthesis and structure. Plant
Physiol 153: 895-905
Vicentim MP, Ferraz A (2006) Enzyme production and chemical alterations of Eucalyptus grandis wood
during biodegradation by Ceriporiopsis subvermispora in cultures supplemented with Mn2+
, corn steep
liquor and glucose. Enzyme Microb Tech 40: 645-652
Wagner A, Ralf J, Akiyama T, Flint H, Phillips L, Torr K, Nanayakkara B, Kiri LT (2007) Exploring
lignification in conifers by silencing hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyltransferase in
Pinus radiata. PNAS 104: 11856-11861.
Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nature
Reviews.Genetics 10: 57-63
Wariishi H, Gold MH (1990) Lignin peroxidase compound 3: mechanism of formation and
decomposition. J Biol Chem 265: 2070-2077
Waterhouse A (2002) Determination of total phenolics by Folin-Ciocalteau colorimetry. Curr Prot Food
Anal Chem I1.1.1-I1.1.8
Welinder KG (1992) Superfamily of plant, fungal and bacterial peroxidases. Curr Opin Struc Biol 2: 388-
393
Weng JK, Chapple C (2010) The origin and evolution of lignin biosynthesis. New Phytologist 187: 273-
285
Werhan H, Mir JM, Voitl T, von Rohr PR (2011) Acidic oxidation of kraft lignin into aromatic monomers
catalyzed by transition metal salts. Holzforschung 65: 703-709
107
Wiedenhoeft AC, Miller RB (2005) Structure and function of wood. In Handbook of wood chemistry and
wood composites. Rowell RM, Ed. CRC Press, Boca Raton, Florida, USA.
Wong DWS (2009) Structure and action mechanism of ligninolytic enzymes. Appl Biochem Biotech 157:
174-209
Wood TM (1992) Fungal cellulases. Biochem Soc Trans 20: 46-53
Wu JM, Zhang YZ (2010) Gene expression in secondary metabolism and metabolic switching phase of
Phanerochaete chrysosporium. Appl Biochem Biotechnol 162: 1961-1977
Yelle DJ, Ralph J, Lu F, Hammel KE (2008) Evidence for cleavage of lignin by a brown rot
basidiomycete. Environ Microbiol 10: 1844-1849
Yelle DJ, Wei D, Ralph J, Hammel KE (2011) Multidimentional NMR analysis reveals truncated lignin
structures in wood decayed by the brown rot basidiomycete Postia placenta. Environ Microbiol 13: 1091-
1100
Zhou C, Li Q, Chiang VL, Lucia LA, Griffis DP (2011) Chemical and spatial differentiation of syringyl
and guaiacyl lignins in poplar wood via time-of-flight secondary ion mass spectrometry. Anal Chem 83:
7020-7026
Zhu JY, Pan XJ (2010) Woody biomass pretreatment for cellulosic ethanol production: Technology and
energy consumption evaluation. Bioresour Technol 101: 4992-5002
108
Appendix 1: PhD research publications and conference presentations
Research Papers
Published:
MacDonald J, Suzuki H, Master ER (2012) Regulation of genes encoding lignocellulose-
degrading activity in the genus Phanerochaete. Applied Microbiology and Biotechnology 94(2),
339-351.
MacDonald J, Master ER (2012) Time-dependent profiles of transcripts encoding
lignocellulose-modifying enzymes of the white rot fungus Phanerochaete carnosa grown on
multiple wood substrates. Applied and Environmental Microbiology 78(5), 1596-1600.
MacDonald J, Doering M, Canam T, Gong Y, Guttman DS, Campbell MM, Master ER (2011)
Transcriptomic responses of the softwood-degrading white-rot fungus Phanerochaete carnosa
during growth on coniferous and deciduous wood. Applied and Environmental Microbiology
77(10):3211-3218.
Koehler A, Desser S, Chang B, MacDonald J, Tepass U, Ringuette M (2009) Molecular
evolution of SPARC: absence of the acidic module and expression in the endoderm of the starlet
sea anemone, Nematostella vectensis. Development Genes and Evolution 219:509-521.
Submitted:
Suzuki H, MacDonald J, Khajamohiddin S, Salamov A, Hori C, Aerts A, Henrissat B,
Wiebenga A, vanKuyk PA, Barry K, Lindquist E, LaButti K, Lapidus A, Lucas S, Coutinho P,
Gong Y, Samejima M, Mahadevan R, Abou-Zaid M, de Vries RP, Igarashi K, Yadav JS,
Grigoriev IV, Master E. Comparative genomics of the white-rot fungi, Phanerochaete carnosa
and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize.
Submitted for publication.
109
Anticipated:
MacDonald J, Goacher R, Master ER. Lignin peroxidase and manganese peroxidase have
different abilities to modify coniferous and deciduous wood.
Conference Presentations
MacDonald J*, Master E (2011) Time-dependent profiles of transcripts encoding
lignocellulose-modifying enzymes of the white rot fungus Phanerochaete carnosa grown on
multiple wood substrates. 6th Annual DOE JGI User Meeting (international, poster).
MacDonald J*, Master E (2011) Time-dependent profiles of transcripts encoding
lignocellulose-modifying enzymes of the white rot fungus Phanerochaete carnosa grown on
multiple wood substrates. 26th Fungal Genetics Conference at Asilomar (international, poster).
MacDonald, J.*, Doering, M., Canam, T., Gong, Y., Campbell, M., and Master, E. (2010)
Analysis of gene expression in the white-rot fungus Phanerochaete carnosa grown on hardwood
and softwood. NSERC Bioconversion Network First Annual General Meeting (national, poster).
MacDonald J*, Doering M, Canam T, Gong Y, Campbell M, Master E (2010) Analysis of gene
expression in the white-rot fungus Phanerochaete carnosa grown on hardwood and softwood.
Society for Industrial Microbiology 32nd
Annual Symposium on Biotechnology for Fuels and
Chemicals (international, poster).
MacDonald J*, Master E (2009) Time- and substrate-dependent transcript profiles of genes
encoding lignocellulose-modifying enzymes in the softwood-degrading fungus, Phanerochaete
carnosa. Gordon Research Conference: Cellulosomes, Cellulases & Other Carbohydrate
Modifying Enzymes (international, poster).
Canam T*, MacDonald J, Tsai A, Campbell MM, Master ER (2009) In planta expression of
cell-wall deconstructing enzymes from fungi in Arabidopsis thaliana. Institute of Plant and
Microbial Biology: 9th
IPMB Congress (international, poster).
MacDonald J, Mahajan S, Master ER* (2008) Transcription profiles and proteomic analysis of
P. carnosa grown on softwood feedstocks for tailored applications of hydrolytic enzymes. MIE
110
Bioforum: Biotechnology of Lignocellulose Degradation, Biomass Utilization and Biorefinery
(international, poster).
MacDonald J*, Master E (2008) Applications of genes from a softwood-degrading fungus. Pulp
and Paper Centre: 15th
Annual Graduate Student Research Conference (institutional, oral
presentation).
MacDonald J*, Master E (2008) Evolution and applications of softwood-modifying enzymes of
the white-rot fungus, Phanerochaete carnosa. US Department of Energy Joint Genome Institute:
Microbial and Metagenomics Worshop (international, poster).
MacDonald J*, Canam T, Campbell M, Master E (2008) Identification and characterization of
genes encoding lignocellulose-modifying enzymes in the white-rot fungus, Phanerochaete
carnosa. University of Toronto Energy Research Showcase (institutional, poster).
MacDonald J*, Master E (2007) Genome sequencing, annotation, and differential transcription
in the softwood-degrading fungus, Phanerochaete carnosa. 14th
Annual Graduate Student
Research Conference. Pulp & Paper Centre, University of Toronto (institutional, poster).
* Indicates presenting author.
111
Appendix 2: Quantitative estimation of P. carnosa growth on hardwood and softwood
Introduction
Studies of Phanerochaete carnosa have used this organism to represent a softwood-
degrading white-rot fungus (Mahajan and Master 2010, MacDonald et al. 2011, Suzuki et al.
2012), since P. carnosa is found growing most often on softwood (Burdsall 1985), whereas the
majority of white-rot fungi grow preferentially on hardwood (Hibbett and Donoghue 2001).
However, better growth of this organism on softwoods compared to hardwoods has not been
demonstrated in a controlled laboratory setting.
Quantitative measurements of fungal growth on solid substrates are challenging. White-
rot fungi grow as mycelia that attach to the solid substrate. To measure dry weight, they can be
grown on plates covered with membranes from which the biomass can be more easily removed
(Edelstein et al. 1983). However, large amounts of biomass are required for accurate
measurements (Prosser 1995) and P. carnosa is a slow-growing fungus, which grows even more
slowly when separated from the media by a membrane. Moreover, using a membrane to separate
fungal growth from the substrate is not entirely representative of a natural environment, where
hyphae penetrate the solid medium (Prosser 1995). Attempts to estimate dry weight from P.
carnosa grown over membranes were unsuccessful because the weight of dried mycelia was
below the detection limit of the analytical balance. Similarly, attempts to measure weight loss of
wood blocks after cultivation with P. carnosa for up to 72 days resulted in high variability
between replicates (Hitoshi Suzuki, unpublished); which may be due to difficulty adding the
same amount of inoculum to each wood block, and very small weight changes resulting from the
slow growth of P. carnosa.
Other common methods for measuring fungal growth include visual estimates and
indirect estimates based on fungal cell components such as chitin, protein, and ergosterol. Chitin,
a polymer of N-acetylglucosamine, is a cell wall component of most fungi, including wood-rot
fungi. The chitin assay involves depolymerisation followed by quantification of glucosamine,
112
typically by a colorimetric reaction. Biomass is estimated using a conversion factor that
compares chitin content to dry weight for a particular species. However, this method has long
been criticized as a indicator of biomass due to variability of the chitin-to-dry-weight ratio in
relation to culture age and media composition (e.g. Sharma et al. 1977); a problem that is
apparent in the white-rot fungi P. chrysosporium, Pleurotus sajor-caju, Lentinula edodes, and
Flammulina velutipes (Boyle and Kropp 1992). Similarly, protein content of these white-rot
fungi differed by about 2.5-fold after growth on medium containing comparatively high nitrogen
content, and either decreased or remained constant after 2-4 weeks of growth (Boyle and Kropp
1992). Ergosterol is the most abundant sterol in cell membranes of most filamentous fungi
(Weete 1989), and has also been measured to quantify fungal growth. Although commonly
applied, this growth measurement is complicated by changes in ergosterol concentration with
culture age and media composition. In a test of nine species of aquatic fungi, only three showed
correlation between ergosterol content and biomass over two weeks of incubation (Bermingham
et al. 1995). The ergosterol-to-dry-weight ratio of food spoilage fungi also varied up to 110-fold
for the same species in different media (Taniwaki et al. 2006), while exposure of the red yeast
Rhodotorula glutinis to various stress factors generally resulted in higher ergosterol-to-dry-
weight ratios, up to 6-fold higher than control cultures (Marova et al. 2010). Without the ability
to compare chitin, protein, or ergosterol content to the dry weight of P. carnosa over time and on
the relevant wood substrates, it is highly questionable whether any of these components can be
an appropriate indicator of growth under such conditions.
In addition to chitin, protein, and ergosterol measurement, a practical and frequently
applied approach to assessing relative fungal growth is based on visual estimates of colony
diameter and thickness (Battaglia et al. 2011; www.fung-growth.org/ ). While colony diameter
alone can be a reliable indicator of growth on the same substrate over time (Brancato and
Golding 1953, Marin et al. 2005), comparisons between growth substrates also need to consider
colony thickness (Brancato and Golding 1953). Measurement of colony diameter to represent
growth is based on the equation µ = Kr / w , where µ is the specific growth rate, Kr is the radial
growth rate (in µm/h), and w is the peripheral growth zone (in µm), which is the length of the
region that contributes protoplasm to the growing edge (Prosser 1995). Colony diameter is
therefore proportional to biomass only when w is constant, i.e. µ = Kr. However, this is not the
case if nutrient concentrations vary between substrates. Within certain limits, radial growth of a
113
filamentous fungus is constant, and occurs as the fungus is seeking new sources of nutrients
away from the colony centre. The thickness of the colony is determined by hyphal branching,
which is used to take advantage of available nutrients. During growth on nutrient-rich substrates,
the fungus will likely produce more branches, and therefore more biomass, compared to growth
on nutrient-poor substrates, although colony diameter may be the same (Prosser 1995).
Measurements of fungal growth on different substrates should therefore consider both the radial
extension and the branching or thickness of the colony.
Mycelial branching can be measured by determining the distance between branching
points under a microscope. Compared to commonly used media, however, wood is a nutrient-
poor substrate and branches in P. carnosa grown on wood were few, with variable lengths, and
difficult to measure (Fig. A2.1). By contrast, visual assessment of colony diameter and thickness
has been used to reproducibly determine relative growth patterns of many different fungi
(www.fung-growth.org), and these growth patterns correlate well with corresponding genome
content (Battaglia et al. 2011, Goodwin et al. 2011). The aim of the current study was to improve
this common and practical approach to fungal measurement by estimating fungal biomass based
on image data.
114
Figure A2.1. Light microscopy of P. carnosa grown on sugar maple. Images are taken from the
same sample on the same day. Visible branching points are indicated.
Materials and Methods
Cultures
Thin YMPG-agar plates consisted of 14 mL YMPG and 0.2 g agar poured into a standard
90 mm diameter plate. Each wood plate consisted of 5 mL water or B3 medium (see section
2.2.1), and 1.0 g rinsed and dried wood powder that passed between a 53 µm sieve, but was
115
retained by a 150 µm sieve. Triplicate cultures were grown on sugar maple (Acer saccharum),
trembling aspen (Populus tremuloides), yellow birch (Betula alleghaniensis), balsam fir (Abies
balsamea), lodgepole pine (Pinus contorta), and white spruce (Picea glauca). Media was
portioned and then autoclaved at 120°C for 20 min before being placed into sterile plastic Petri
plates of 60 mm diameter. Each wood plate was overlaid with a black polycarbonate membrane
filter of 47 mm diameter and 0.4 µm pore size (GE Osmonics).
P. carnosa was inoculated onto YMPG-agar plates from a freezer stock, and the growing
edge of a fresh mycelial colony was transferred to the middle of a thin YMPG-agar plate for
inoculation of the wood plates. In an attempt to inoculate the wood plates with consistent
amounts of mycelia, an inoculation tool was created by placing a piece of copper wire inside a
Glass Pasteur Pipette 5-3/4" (Fig. A2.2). The wire was bent in half inside the narrow end of the
pipette, and bent over the rim at the wide end to allow moving the wire without contaminating
the inside of the pipette. The narrow end was used as a cookie-cutter to remove a small plug
from the thin YMPG-agar plate, and the plug was pushed out of the pipette using the wire. Plates
were incubated at 27°C for 14 days, with up to 300 µL water added on day 10 to prevent
dehydration.
Figure A2.2. Inoculation tool.
116
Image analysis
Membranes were carefully removed from the plates and placed on a smooth, black,
minimally reflective surface. Here, a large hexagonal polystyrene weigh boat (8.5 cm inner
diameter from flat edges) was painted with 2-3 coats of black chalkboard paint (Rust-Oleum
Corporation, Vernon Hills, IL, USA). Photographs were taken of each membrane in the same
position using a tripod and digital camera. Using Image J software (National Institutes of
Health), images were converted to strict black and white and the brightness of each image was
measured. This process used the following commands:
Image -> type -> 8 bit
Image -> adjust -> threshold, choose "triangle" -> apply
Analyze -> set measurements, choose "mean gray value"
Analyze -> measure
For comparison, colony diameters were also measured using the line selection tool and the
“Analyze -> measure” command. Diameters were recorded as the average of three measurements
for each photograph.
Results
P. carnosa was grown in Petri plates containing moistened wood particles, which were
overlaid with a black membrane to facilitate the sample recovery and image analyses. Both the
diameter and thickness of P. carnosa growth on six wood species was estimated by the
brightness of photographs of colonies on a black background (Fig. A2.3).
117
Figure A2.3. Pictures of membranes with P. carnosa taken from hardwood (top) and softwood
(bottom) cultivations moistened with water. Shown are original photographs (left) and
corresponding strict black and white conversions (right).
118
Using water as the liquid, the highest amount of P. carnosa growth was seen on aspen wood
(Fig. A2.4). Using Bonferroni's post-test following 1-way ANOVA, growth on aspen was
significantly higher than growth on any of the other wood substrates, except for spruce.
However, growth on each of the softwoods (fir, pine, and spruce) was significantly greater than
growth on either maple or birch (P < 0.05; Fig. A2.4a). Overall, the order of wood from best to
least mean growth was: aspen > spruce > fir > pine > birch > maple. This order was retained in a
repeated experiment with the exception of aspen, where two of the three replicates did not grow
at all (data not shown).
Moistening powdered wood samples with B3 medium significantly increased the growth
of P. carnosa on maple, pine, and spruce, while the opposite was observed for growth on fir and
aspen (t-tests, p < 0.05). Moreover, the trend for wood preference changed such that growth on
maple, pine, and spruce was significantly greater than growth on fir, and growth on spruce was
significantly greater than growth on aspen (Bonferroni's post-test, p < 0.05; Fig. A2.4b).
Colony diameters were also measured for correlation with the growth values obtained
using image brightness. The two measurements were well correlated when B3 was used as the
liquid (Fig. A2.4b and Fig. A2.5b), but not when water was used as the liquid (Fig. A2.4a and
Fig. A2.5a).
119
Figure A2.4. Measurements of P. carnosa growth on hardwoods (maple, aspen, birch) and
softwoods (fir, pine, spruce) with water (A) or B3 (B).
Figure A2.5. P. carnosa colony diameter on hardwoods (maple, aspen, birch) and softwoods (fir,
pine, spruce) with water (A) or B3 (B).
Discussion
The current method used brightness of photographs to reduce the subjectivity of fungal
growth measurements that are estimated from colony diameter and thickness. Notably, placing a
membrane between the fungus and wood sample could influence growth yields and rate as it is
Map
le
Asp
en
Birch Fir
Pin
e
Spru
ce0
20
40
60
80A)
Wood Substrate with Water
P.
ca
rno
sa
Gro
wth
(arb
itra
ry u
nit
s)
Map
le
Asp
en
Birch Fir
Pin
e
Spru
ce0
20
40
60
80B)
Wood Substrate with B3
P.
ca
rno
sa
Gro
wth
(arb
itra
ry u
nit
s)
Map
le
Asp
en
Birch Fir
Pin
e
Spru
ce0
200
400
600
800A)
Wood Substrate with Water
Co
lon
y D
iam
ete
r(p
ixels
)
Map
le
Asp
en
Birch Fir
Pin
e
Spru
ce0
200
400
600
800B)
Wood Substrate with B3
Co
lon
y D
iam
ete
r(p
ixels
)
120
not entirely representative of a natural environment, where hyphae penetrate the solid medium
(Prosser 1995). Still, this method provides a practical approach to obtaining relative growth
patterns of P. carnosa while minimizing bias introduced by the observer. This analysis was
consistent with visual inspection and therefore could be used to automate fungal growth
comparisons. However, the method may not work for all species, and in fact, attempts to
estimate growth of P. chrysosporium were not successful because the colonies were transparent
(data not shown). When comparing growth between species, a reference growth condition may
be required to compensate for colony appearance and variable growth rates. Such has been done
previously using glucose media as a reference (www.fung-growth.org).
The results of this experiment suggest that under more natural conditions (i.e., with water
as the liquid), P. carnosa grows well on all three of the tested softwoods. By contrast, this
cultivation condition supported the growth of P. carnosa on only one of the three hardwoods
tested. This result suggests that nutrients required to support the growth of P. carnosa were not
limited to the softwoods, but included species in three conifer subfamilies of commercial
importance. Use of B3 during cultivation resulted in greater growth of P. carnosa on some
wood species, but lesser growth on others. B3 minimal medium was developed to promote
ligninolytic activity by Phanerochaete chrysosporium (Kirk et al. 1978). The main components
of this medium are KH2PO4, MgSO4, CaCl2, thiamine, a source of nitrogen (ammonium tartrate),
a source of carbon (variable) and a buffering agent (dimethylsuccinic acid). A ten-component
mineral solution is also added (see section 2.2.1) In B3, lower nitrogen concentrations promote
ligninolytic activity (Kirk et al. 1978), and the buffering agent can also affect lignin degradation,
where dimethylsuccinic acid improves lignin degradation compared with previously used o-
phthalate (Fenn and Kirk 1979). The composition of B3 minimal medium is similar to other
commonly used growth media, including Kremer and Wood‟s medium (Kremer and Wood
1992). Kremer and Wood‟s medium is based on a formula that was developed to grow
cellulolytic basidiomycetes (Norkrans 1950, Eriksson and Pettersson 1975, Ayers et al. 1978)
and the current version mainly differs by the source of nitrogen (ammonium phosphate and urea)
and the absence of several mineral components: both B3 and Kremer-Wood media contain
MnSO4, FeSO4, CoSO4, and ZnSO4, while only B3 contains NaCl, CuSO4, AlK, H3BO3,
NaMoO4, and nitrilotriacetate.
121
It is possible that B3 contains components that are important for growth but are inhibitory at
higher levels. For example, while Mn is required for MnP activity, levels of Mn above 200
g/mL negatively affect the growth of P. chrysosporium, and the same is true for Co and Cu
(Falih 1997), which are also present in B3 medium. The effects of B3 components on the growth
of P. carnosa with wood could be studied by adding individual B3 components to cultures grown
with wood and water. In any case, these results encourage the use of caution in expanding
conclusions using artificial media to natural situations. It is of interest, however, that growth
measurements obtained using image brightness were well correlated to colony diameters using
B3. It is possible that colony diameters are sufficient to measure P. carnosa growth in the
presence of B3 medium; this would suggest that the peripheral growth zone w is constant in the
presence of B3. Alternatively, differing thickness of overall thicker colonies may not be visible,
and therefore could not be discriminated by the image brightness method.
Appendix 2 References:
Ayers AR, Ayers SB, Eriksson KE (1978) Cellobiose Oxidase, Purification and Partial Characterization
of a Hemoprotein from Sporotrichum pulverulentum. Eur J Biochem 90: 171-181
Battaglia E, Benoit I, van den Brink J, Wiebenga A, Coutinho PM, Henrissat H, de Vries RP (2011)
Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized
approach to carbohydrate degradation depicted at genome level. BMC Genomics 12: 38
Bermingham S, Maltby L, Cooke RC (1995) A critical assessment of the validity of ergosterol as an
indicator of fungal biomass, Mycol. Res. 99:479-484
Boyle CD, Kropp BR (1992) Development and comparison of methods for measuring growth of
filamentous fungi on wood. Can J Microbiol 38: 1053-1060
Brancato FP, Golding NS (1953) The diameter of the mold colony as a reliable measure of growth.
Mycologia 45: 848-864
Burdsall HH (1985) A contribution to the taxonomy of the genus Phanerochaete. Mycologia Memoirs 10:
1-165
Edelstein L, Hadar Y, Chet I, Henis Y, Segel LA (1983) A model for fungal colony growth applied to
Sclerotium rolfsii. J Gen Microbiol 129: 1873-1881
Eriksson KE, Pettersson B (1975) Extracellular enzyme system utilized by fungus Sporotrichum
pulverulentum (Chrysosporium lignorum) for breakdown of cellulose. 1. Separation, purification and
physicochemical characterization of 5 endo-1,4-beta-glucanases. Eur J Biochem 51: 193-206
Falih AM (1997) Influence of heavy-metals toxicity on the growth of Phanerochaete chrysosporium.
Bioresource Technol 60: 87-90
122
Fenn P, Kirk TK (1979) Ligninolytic system of Phanerochaete chrysosporium - inhibition by ortho-
phthalate. Arch Microbiol 123: 307-309
Goodwin SB, Ben M'Barek S, Dhillon B, Wittenberg AHJ, Crane1 CF, Hane JK, Foster AJ, Van der Lee
TAJ, Grimwood J, Aerts A, Antoniw J, Bailey A, Bluhm B, Bowler J, Bristow J, van der Burgt A, Canto-
Canche1 B, Churchill ACL, Conde-Ferraez1 L, Cools HJ, Coutinho PM, Csukai11 M, Dehal P, De Wit P,
Donzelli B, van de Geest HC, van Ham RCHJ, Hammond-Kosack KE, Henrissat B, Kilian A, Kobayashi
AK, Koopmann E, Kourmpetis Y, Kuzniar A, Lindquist E, Lombard V, Maliepaard C, Martins N,
Mehrabi R, Nap JPH, Ponomarenko A, Rudd JJ, Salamov A, Schmutz J, Schouten HJ, Shapiro H,
Stergiopoulos I, Torriani SFF, Tu H, de Vries RP, Waalwijk C, Ware SB, Wiebenga A, Zwiers LH,
Oliver RP, Grigoriev IV, Kema GHJ (2011) Finished genome of the fungal wheat pathogen
Mycosphaerella graminicola reveals dispensome structure, chromosome plasticity, and stealth
pathogenesis. PLOS Genet 7: e1002070
Hibbett DS, Donoghue MJ (2001) Analysis of character correlations among wood decay mechanisms,
mating systems, and substrate ranges in homobasidiomycetes. Syst Biol 50: 215-242
Kirk TK, Schultz E, Connors WJ, Lorenz LF, Zeikus JG (1978) Influence of culture parameters on lignin
metabolism by Phanerochaete chrysosporium. Arch Microbiol 117: 277-285
Kremer SM, Wood PM (1992) Evidence that cellobiose oxidase from Phanerochaete chrysosporium is
primarily an Fe(III) reductase - Kinetic comparison with Neutrophil NADPH oxidase and yeast
flavocytochrome B2. Eur J Biochem 205: 133-138
MacDonald J, Doering M, Canam T, Gong YC, Guttman DS, Campbell MM, Master ER (2011)
Transcriptomic responses of the softwood-degrading white-rot fungus Phanerochaete carnosa during
growth on coniferous and deciduous wood. Appl Environ Microbiol 77: 3211-3218
Mahajan S, Master ER (2010) Proteomic characterization of lignocellulose-degrading enzymes secreted
by Phanerochaete carnosa grown on spruce and microcrystalline cellulose. Appl Microbiol Biotechnol
86: 1903-1914
Marin S, Ramos AJ, Sanchis V (2005) Comparison of methods for the assessment of growth of food
spoilage moulds in solid substrates. Int J Food Microbiol 99: 329-341
Marova I, Carnecka M, Halienova A, Breierova E, Koci R (2010) Production of carotenoid-/ergosterol-
supplemented biomass by red yeast Rhodotorula glutinis grown under external stress. Food Technol
Biotech 48: 56-61
Norkrans B (1950) Influence of cellulolytic enzymes from Hymenomycetes on cellulose preparations of
different crystallinity. Physiol Plantarium 3: 75-87
Prosser JI (1995) Kinetics of filamentous growth and branching. In: Gow NAR and Gadd GM (eds) The
growing fungus. Chapman & Hall, London, UK
Sharma PD, Fisher PJ, Webster J (1977) Critique of the chitin assay technique for estimation of fungal
biomass. Trans Br Mycol Soc 69: 479-483
Suzuki H, MacDonald J, Khajamohiddin S, Salamov A, Hori C, Aerts A, Henrissat B, Wiebenga A,
vanKuyk PA, Barry K, Lindquist E, LaButti K, Lapidus A, Lucas S, Coutinho P, Gong Y, Samejima M,
Mahadevan R, Abou-Zaid M, de Vries RP, Igarashi K, Yadav JS, Grigoriev IV, Master E (2012)
123
Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to
elucidate the genetic basis of the distinct wood types they colonize. Submitted for publication
Taniwaki MH, Pitt JI, Hocking AD, Fleet GH (2006) Comparison of hyphal length, ergosterol, mycelium
dry weight, and colony diameter for quantifying growth of fungi from foods. Advances in Experimental
Medicine and Biology 571: 49-67
Weete AD (1989) Structure and function of sterols in fungi. Adv Lipid Res 23:115-167
124
Appendix 3: Details of mRNA-Seq
For mRNA-Seq, the first step uses cDNA rather than genomic DNA:
Figure A3.1, continued on next page...
125
Figure A3.1. Details of mRNA-Seq. Figure from Mardis (2008). Reproduced with permission
from Annual Reviews, license number 2932670103836.
Appendix 3 References:
Mardis ER (2008) Next-generation DNA sequencing methods. Annu Rev Genomics Hum Genet
9: 387-402
126
Appendix 4: Revised gene models
The following gene models were manually revised prior to completion of the final draft P.
carnosa genome.
Each shows a section of the genome with the following scheme:
pink - exons confirmed by RT-PCR/RACE, but not part of the automated model
red - overlap between RT-PCR/RACE sequences and automated model
blue - automated gene model not validated by RT-PCR/RACE
orange - model-predicted exon, re-annotated as intron based on alignments with homologous
cDNAs
green - re-annotated as exon based on alignments with homologous cDNAs
start and stop codons are underlined
MnP 45 - JGI ID#262882
scaffold 15:
GGTGTATGTGGTATAAAAACGGGCCATCGTCGACGACGGTTAGCCAGGACGTCCAGTTCTACCTCCTCCGGTAAACC
ACTCAGTCTTTCAGACATCGCAATGGCCTTCTCCTCTCTTCTGGCCCTCGTTGCCCTCGTCGCGGTCACTCGCGCAG
CCCCGACCGCAGTCTGCTCTGACGGCACTCGCGTCAGCAACTCTGCTTGCTGTGCTTTCATTCCTGTGTGTCATTAC
TGCATTCTGGCTTCTTATATCTTTGTTCACAGCTTCTATCCTTCATAGCTTGCTCAGGATCTGCAGGAGACCCTTTT
CATGAATGAGTGTGGTGAAGATGGTTAGTCTATTTCAAACAGCCTTCATTCCGCCCTACCTAATCATGGCTACTTGC
AGCTCACGAGGCCATTCGTCTGACTTTCCACGATGCTGTCGCGATCTCCCGCTCCAAGGGAGCCAAGGCGTAAGTCC
TTACTTGGCCTGGCTTTTACCTGTCTGACGTAACGGTCCCACAGCGGAGGAGGCGCCGACGGCTCGATGCTCCTGTT
CCCCACCGTCGAGCCTAACTTCTCGGCCAACAACGGTATCAGCGACTCTGTCAACAACCTCATTCCTCTCATGCAGA
AGCACGACACCATCAGCGCTGGTGACCTCGTCCAGTTCGCTGGTGCCGTTGCCCTTAGTAACTGCCCCGTAAGCCTT
ACCTACGACATATTCTCCGCCCGCTTGCTCATATTGACATTGAATTTCTGCAGGGCGCGCCGCGTCTCGAATTTTTG
GCTGGTCGCCCGAACAAGACCATTGCTGCCATCGATGGCCTGATCCCTGAGCCTCAGGACGATGTCACCAAGATCCT
CGAGCGTTTCGATGATGCTGGAGGCTTCACGCCCTTCGAGGTCGTATCTCTCCTTGCGTCCCACTCTGTCGCCCGCG
CGGATAAGGTCGACTCGACCATTGATGCCGCTCCCTTCGACTCAGTCAGTGGCTCGTCCAAGTGCTTATGTTTCCAC
ACCTGACCAGCTCTCCTCTAGACGCCGTTTGTCTTTGACACACAGGTCTTCCTCGAGGTTCTGCTCAAAGGCGTAGG
TTTCCCAGGAACGAACAACAACACGGGCGAGGTCGCCTCGCCTCTCCCGAACACCACCGGTACCGACACCGGCGAGA
TGCGTCTGCAGTCCGACTTTGCGCTCGCACACGACGAGCGCACGGCGTGCTTCTGGCAGGGCTTCGTCAACCAGCAG
GACTTCATGTCGAACAGCTTCCAGCAAGCGATGGCGAAGCTCGCCATCCTTGGCCACGATCGCAACAAGCTGGTCGA
CTGCAGCGACGTCGTCCCCGTGCCGCAACCCGCCGTCAAGAAGCCCGCGACGTTCCCCGCGACGACCGGCCCGAAGG
127
ATCTTCAGCTCACGTGCCGCGCCGAGAGGTTCCCGACCCTCACCACCGACAGTGCGTGTCTCTTCTTTCATTCGAGG
TGCCGAGTGCTGATTGTGTGTTCTTGCTGCAGATGCTGCTCAAGAGACTCTGATTCCTCACTGCCCCGACGGCAGCA
TGAACTGCACTACGGTCCAGTTCAATGGCCCGGCATAAATTTGCCCATAGGCAACTTTGGATACGATAGTTCTGATT
ACCTCGGAGTTATTGAGTCGTCGGATGTATAAGCGTCTCGACAAGTTTGAATATGTATCTATCTTTCTCACAAGCAC
CGTACAAAGTGATGCACCCCTATGCATTACGATCAGCCTGATCATG
MnP 31+169 (originally predicted as two genes) - JGI ID#256991
Scaffold 232:
GCCAAAGACTTCAGGACACCGAGTTATCTCCTCGCCAACCTCCTCAGGACACCAGGTCTCATTCGCTCTGCGACCCC
TCCTAGCTCTCCACAAGTCAGACATCGCAATGGCTTTCGCTACTTCGCTCTTCGCCTTGGTCGCTCTTGCTGCCGTC
ACCACCGCTGCGCCGGCTACCACTCAGGCAGTCTGCTCTGACGGAACCCGTGTCAGCAACGAGGCCTGCTGCGCCTT
CATCCCCGTATGTGACATTTCTCGTTATCTCACTCAGTGCGGCGCGCTCAACAATTTATCCAGCTCGCGCAAGATCT
GCAGGAGAATATCCTGATGAACGACTGCGGTGAAGATGCTCACGAGGTCATCCGTCTTACTTTCCGTAAGCGAAACC
ACATAGTGCAATAAATCGGGGATTCTAATGATTATTTTACAGACGACGCTGTTGCGATCTCCCGCAGCCAGGGTCCC
TCTGCGTAGGCAATTTCCGTCTGCACTTGCAAGTACGATTTTCTGACAGATCTTCACGATAATAGCGGTGGTGGAGC
TGACGGCTCGATGCTCCTCTTCCCGACCATTGAGCCCAACTTCTCGGCCAACAACGGTATCAGCGACTCCGTCAACA
ATCTCATCCCCTTCATGCAGAAGCACAACACCATCAGCGCTGGCGATCTTGTCCAGTTCGCAGGTGCCATCGCGCTC
ACCAACTGCCCCGTAAGTATATTTGCCACTCACTGATGGCGGTACCCGTCTCATACTTTACGATCTATAGGGTGCTC
CTCAACTCGAGTTCTTGGCTGGCCGCCCGAACCACACTATT
Not in Genome Checkpoint Assemby:
CCCGCCGTCGACGGCCTGATCCCCGAGCCCCAGGACAACGTCACCCACATTCTCGAGAGGTTCGACGATGCTGGTGG
CTTCAGCCCTTTCGAAGTCATCGCCCTGCTCGCTTCCCACTCCATCGCTCGCGCGGACAAGGTCGACGAGACGATCG
ACGCTGCGCCCTTCGACTCCACCCCGTTCGTGTTCGACACCCAGGTCTTCCTCGAGGTCCTGCTCAAGGGCGTCGGC
TTCCCCGGAACCGACAACAACACCGGCGAGGTTGCATCTCCTCTCCCAACGACCGTCGGCACCGACACCGGCGAGAT
GCGTCTCCAGTCTGACTTCGCCCTCGCCCGCGACGAGCGCACTGCTTGCTTCTGGCAGAG
Scaffold 1095:
TTTCGTGAACGAGCAGGAGTTCATGGCGTCGAGCTTCAAGTCGGCGATGGCCAAGCTCGCCGTCCTCGGCCACAACC
GCAACGACCTGATCGACTGCTCCGACGTCATTCCCACGCCCAAGCCCGCCGTGAACACGCCCGCGAGCTTCCCCGCC
ACCACCGGCCCGCAGGACCTCGAGCTCACGTGCACGGCCGAGAAGTTCCCGACTCTGACCACAAACGGTACGTGTCT
GCTGATGTTCCTCGCTGTTGGTTGCAACCGTACTGACCATCGTTGCTCGTACAGCTGGTGCGCAGCAGACTCTGATC
CCTCACTGCTCGGACGGCAACATGACGTGCAACACCGTCCAGTTCAACGGCCCCGCTTAAATCTCTCGTCGAGGGTT
ATTTATCTTGGGATTTTATTACAAGGTTTC
MnP 1138 - JGI ID#144982
Scaffold 2 RC:
CGACTTCCAATGGCTTTCCGATCGCTCCTTGCCCTTGTGGCTCTCGCCGCTGTTTCCAACGCTGCACCGACCACGGT
GTGCCCCGACGGCACCCATGTCAGCAACGCAGCTTGCTGCCCCTTCATTCCGGTACGGAGTACTTAGTGACCATTGC
CAGCTTGATTCTGACAGTGCATATACTTCGCAGCTTATCGACGACCTGCAGAACACCCTGTTCCAGGGCGAATGCGG
TGAAGACGGTAGGTGTCCGTCCGCTGACTCCAGCTGGACTTGCGCTGACTCTCTTTCTCGCAGCGCACGAGGCTATC
CGACTGACTTTCCGTACGCATTATTCAAATGGTTTGCCGCTACCTGACTCGTGCTGACCACAAACCCCCAGACGACG
CCATTGCTATCTCTCAGAGCCAGGGCCCGAAAGCGTGAGTTGCATTTCACATTTGAGACAGCATATCATCTAACGAA
GACATTACCAGTGGCGGAGGTGCCGATGGCTCCATGCTCATCTTCCCCACCGTCGAACCAGGCTTCCACGCCAACGC
CGGTATCAGCGACAGCGTTAATAACCTCATTCCCTTCCTTTCTACGCACAATGTCAGTGCCGGTGACCTCGTCCAGT
128
TTGCCGGCGCCGTTGCGCTGAGTAACTGCCCCGTAAGTGTTCAGACGGGCTTCATTTTGGATGCAGGTTGGCTCATC
CGCTACTAGGGTGCCCCCCGCGTTCAGTTCCTCGCCGGTCGCCCGAACGCGACTGCCCCCGCCGTCGACGGCCTGAT
CCCCGAGCCTCAGGACGGCGTCAGCCAGATTCTCGAGCGGTTCGCCGACGCGGGCAACTTCAGTCCCTTTGAGGTTA
TCGCGCTCCTGGCCTCACACTCCATCGCACGCGCTGACAAGGTTGACACGTCCATCGACGCCGCACCCTTCGACTCC
GTAAGTGACAATGCTTCCTATCCCAACATCACGCTAACCAGTACTTGCAGACCCCATTCGTATTCGACACCCAGGTC
TACCTCGAGGTCTTGCTCAAGGGTGTGGGCTTCCCCGGAAACGGCAGCCAAGTCGGTGAGGTCCCGTCCCCGCTTCC
CGCGCACAGCGGCAACGACACCGGCGAGATGCGTCTCCAGTCCGACTTTGCGCTCGCACGCGACCCGCGCACGGCCT
GCTTCTGGCAGGGCTTCGTGAACGAGCAGGACTTCATGGTGTCGAGCTTCCAGGCCGCGTTTGCCAAGCTCGCCGTC
CTCGGCCACAACCCCAGCAAACTGATCGACTGCTCCGAGGTCGTGCCCACCCCGAAGCCGGCCGTCAACAAGCCCGC
CACCTTCCCCGCCACCACCGGCCCGCAGGACCTGCAGCTTTCGTGCCCCACCCAGAAGTTCCCGACCTTGTCTGTCG
ATCGTGAGTGCCCACAGCCTCCCATTTCTGCGTTGGACACTAACGCTCTGTTCCCGCTGCCGCAGCCGGTGCACAGG
AGACCCTTATCCCTCACTGCCCTGACGGTGGCCAGGACTGCCCCTCGGTCCAGTTCAGCGGCCCTGCGCCTGATATC
CCTTAAGTCACAGCTGACTTTCTCAGTGTGCTCTAGT
MnP 1168 - JGI ID#94349
Scaffold 2:
ATCCTCCCTCACTTTCCAGACTACACAATGATCCTCAAATTCTCTTCACTCATCGCCCTCGTCGCCGTTGCTGTGGC
CGTGCACACTGCTTCAGCCTCCATCGCTGCCACCTGCTCCGACGGCACACAGGTCCCCGACAAGATGTGCTGCAACT
TCATCCCTGTGCGTCTACTCCATTTTGTACGGCGCTACAGCTGTGGCTGAAACACTTGAATGTAGCTCATATCAGCG
CTCCAGAATACTTTGTTCATGGAAGAATGCGGTGAAGATGGTAGGTCATTTGTCTTCTTCGATTTGTGATGATGGCG
CTGACGTCTCATCCAAGCTCACGAGGTCATTCGTCTAACTTTCCGTAAGTGAAACTCTGTCGAGGGTAGCTAGCAGT
AAGCTTATTGTTATGTTGTCAGATGATGCCATTGCTATCTCTCAGAGCCAGGGTCCCGCGGCGTGAGTTGCTCTACG
TCTTGATCAGTGGTCGGAAGTATACTGACCCTGGGTGTGCAGCGGTGGAGGAGCCGACGGGTCGATGCTCATCTTCC
CGACCGTCGAGCCATCGTTCGCAGCGAACGTGGGCATCAACGACAGTGTCGACAGTCTGACTCCGTTCATGTCTCAG
TTCCCCAGCATCACCGCTGCCGACCTCGTCCAGTTCGCAGGCGCGGTCGCACTGAGCAACTGCCCAGTAAGTAGTCG
TGAGCTGCCCATCTCCTGCTGTATTCGTGCTCACACGATCACCCACGATAGGGCGCGCCCCAACTGGAGTTTCTTGC
CGGTCGTCCCAATGCTACTGCGCCGGCCGTCGAGGGCCTGATCCCCGAACCACAGGACAACATCACGTCGATCCTGG
ACCGGTTCGCCGATGCCGGTAGCTTCAGCCCGTTCGAGGTTGTCTCCCTCCTTGCCTCTCACTCTATTGCTCGTGCC
GATAAGGTCGACCCGACCATCGACGCCGCGCCATTCGACTCCGTAAGCGAAAATACTTGCTGTCGTGAGATCACGCT
AGATATTGTTTGCAGACCCCATTCGTGTTTGACACCCAGGTCTTCCTCGAGGTTCTCCTCAGGGGCGTCGGCTTCCC
GGGTACCGACAACAACACCGGCGAGGTCGAGTCCCCACTCCCGCTCACCGTCGGCAGCGACACCGGCGAGATGCGTC
TCCAATCGGACTTTGCACTCGCTCGCGACCCGCGCACGGCGTGCTTCTGGCAGGGCTTCGTCAACCAGCAGGAGTTC
ATGGCATCGAGCTTCAAGGCGGCCATGTCCAAGCTTGCGATCCTGGGCCACAATCGCGCGGACCTGGTCGACTGCTC
GGCCGTCGTCCCCGTTCCGAAGCCGGCGGTGAACAAGCCTGCGAGCTTCCCCGCCACCACTGGCCCGCAGGACCTGG
AGCTGTCGTGCACGACCGAGAAGTTCCCGACGCTGACCGTCGACGGTATGTGTTTTCAAACTGTGCACGCGCGGTGT
ATAATGGAGCTGACGATTGGCTATCGTACAGACGGCGCATACGAGACGGTGATCCCGCACTGCCCGGACGGCAGCAT
GACATGCAACGATGTCCGGTTCAGAGTCCAGGCCGTCGACTATTAAGCGGTCTCACGGCGAAGTTCATTCATCTAGC
CCTAAATTATGGTAAAAGGCATTTTTGGACTCGATGTGATGTC
MnP 697 - JGI ID#256984
Scaffold 2:
CATTCTCCTCTCGACATCGAACTCTCTTTCTCTCGAGCCATCTACCTTCGCTCTGTAGGCCACACAATGGCTTTCAA
ATTCTCTTCACTTTTCGCCCTCGTCGCCGTTGCTGCGACCGTGCGCGCCGCTCCGGCTTCCACCACCACCACCTGCT
CCGATGGCACACAGGTCCCCGACGAAATGTGCTGCAACTTCGTCCCTGTACGTCTACTTCGTATCACCCTGCGCTAC
GACGGTGGCTGAATTTCTTGAATGCAGCTCGTGTCAGCGCTCCAGAACACGCTATTCATGGGAGACTGTGGTGAAGA
CGGTAGGCCGTTTGCCTTCCCGCTTTGTAGCAACAAGGTTGAAATCTCTTCCTAGCTCACGAGGTCATCCGTCTTAC
TTTCCGTGAGTGACATTTGTGTCGAAGCCAGTTACCGGTTACCAGCATACTTACTATTACCTTGCCAGACGACGCCA
TCGCTATCTCTCAGAGCCAGGGTCCCGCAGCGTGAGTGTGACCACGCCTTGATCCGTAGTCTGAAGGTTGTTGACCC
CGAATGTACAGCGGAGGAGGAGCCGACGGGTCGATGCTCATCTTCCCGACCGTTGAGCCATCGTTCGCAGCGAACAC
129
GGGCATCGGCGACAGTGTCAACAACCTGATTCCGTTCCTGTCCCAGTTCCCCAACGTCACCGCTGGCGACCTGATCC
AGTTCGCAGGCACGGTCGCACTGAGCAACTGCCCGGTAAGCAACCGCAGACTGCCCAGCTCCTGCTGTACTTCGTGC
TCACACAATCTCCAACAACAGGGTGCGCCGCAGCTGGAGTTCCTTGCTGGTCGCCCGAATGCGACTGCGCCGGCCGT
TGACGGCTTAATCCCCGGGCCGCAGGATAGCGTCACGTCGATCCTCGACCGGTTTGCCGATGCTGGCGGCTTCAGCC
CCTTCGAAGTCATCTCCCTCCTTGCCTCTCACTCCATTGCTCGTGCCGACAAGGTTGACCCGACGATCGACGCCGCG
CCTTTCGACTCCGTAATTATCCGTGCTTCCTCTCCCTTGGGAGTCGGACTCCACTGACAATAATCTACTCGTGCAGA
CTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTCGTGTTCGACACTCAGGTCTTCCTCGAGGTCCTGCTCAAGGGTGTCGGCTTCCCTGGCACCCCCAACA
ACACCGGCGAGGTCGCCTCTCCGCTCCCGCTCACCGTCGGCAGCGACACCGGCGAGCTGCGTCTGCAATCGGACTTT
GCGCTGGCGCGCGACTCACGCACGGCGTGCTTCTGGCAGGGCTTCGTCAACCAGCAGGAGCTCATGGCATCGAGCTT
CCAGGCGGCCATGTCCAAGATGACGATCCTCGGCCACAACCGCGCCGATCTCGTTGACTGCTCGGCCGTCGTCCCTG
TGCCGAAGCCCGCGGTCAACAAGCCTGCGAGCTTCCCGGCGACGACTGGCCCTCAGGACCTGGAGCTGTCGTGCACG
ACCTCGCAATTCCCGACGCTGACCGTCGACGGTATGTGTTTTCCAGGTGTGCTCGCTTGCTGTCCAATGAAGCTGAC
TCTCGACTCTGGTACAGCCGGCTCACAGGAGACGGAGATCCCGCACTGCTCGGACGGCAGCATGACGTGCAACACTG
TCCAGTTCACCGGCCCGGCTGTCGACTAAGCGGTATCACGGCAAAGTTC
MnP 383 (incomplete, 5' only) - JGI ID#256980
Scaffold 2 RC:
CAGAATACACAATGGCTTTCAAGTTCTCCTCCCTCCTCGCCCTCGTCGCCACTGCCGCGACCGTGCGCGCTGCCCCG
GCCTCCACCGCCGCCACCTGCTCCGATGGTACACAGGTCCCCAACGAAGTTTGCTGCAACTTCGTCCCCGTATGCCT
ACTTCACATCACACTATGCTACAGCGGTGACTAAATCACTTAAATACAGCTTATCTCGGCGCTCCAGAACAATCTGT
TCATGGAAGACTGCGGTGAAGACGGTAGGTCCTGTCTTCCCTGATCTGTGGCAATAGCACTAACATCTCGTCTAAGC
CCACGAGGTCATCCGTCTTACTTTCCGTGAGTAACACTCCATTGAAAATAGTCGTCAACATACTCACCATGCCTTAC
CAGACGATGCCATTGCTATCTCTCGGAGCCAGGGTCCCACAGCGTGAGTGCCGCCATCTATTGATCAGTGATCATAA
ACATACTTACCTCAAATGTTCAGTGGTGGTGGAGCCGACGGGTCGATGCTCATCTTCCCGACCGTCGAACCGTCGTT
CTCAGCGAACAACGGCATCGGCGACAGTGTCGACAATCTGATTCCGTTCCTCTCCCAGTTCCCCGCCGTCTCCGCTG
GCGATCTCGTCCAGTTCGCAGGCACGGTCGCGCTCAGCAACTGCCCTGTAAGTGATCGTGGCACACAGATACTGATA
TGCTATATTCTGACATAACTCCTTTCAATAGGGCGCGCCCCAACTTGAGTTCCTTGCCGGTCGCCCGAACGCGACTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
MnP 1579 (incomplete, 5' only) - JGI ID#256997
Scaffold 232 RC:
ACTCGCATCCCCCTCTCGACACCGAGTTCTCTCTAGCTCGAGTCATCCATTCTCGCTCTCTAGGCCACACAATGGCT
TTCAAATTCTCTTCGCTTTTCGCCCTCGTCGCCGTTGCTGCGACCGTGCGCGCCGCTCCGGCCTCCACCACCGCCAC
CTGCTCCGATGGCACACAAGTCCCCGACGAAGTGTGCTGCAACTTCGTTCCTGTATGTTTACTTCACACTTTTCCAC
GGTGTTATAGCGACTGAAACACTGTAATGCAGCTTGTGTCAGCTCTCCAGAACACGCTGTTCATGGGAGACTGCGGT
GAAGACGGTAGGCCACTCATCTTCCCTGGTTTATAGCGATAACACTAACGTTTCATCCAAGCCCACGAGGTCATCCG
TCTTACTTTCCGTGAGTGACACTCTGTCAGACGTAGCTGGCAGCAATCTTACCATTATCTTGCCAGACGATGCCATC
GCTATCTCTCAGAGCCAAGGTCCCGCGGCGTGAGTGGCACCAAATCTTGACGAGTGGTCGGAAGTATACTGACCGCG
AATACGCAGTGGTGGAGGAGCTGACGGGTCAATGCTCATCTTCCCGACCGTCGAGCCATCGTTCGCAGCGAACGCGG
GCATCGGCGACAGTGTCAACAACCTGATTCCGTTCCTGTCCCAGTTCCCCAATGTCACCGCCGGCGACTTGATCCAA
TTCGCAGGCACGGTCGCACTGAGCAACTGCCCGGTAAGCGGTCGTGTGCTGCTTAGCATCTGTTGCGCTCCGCACTG
ACATGGTCTCTCACAACAGGGTGCGCCGCAACTGGAGTTCCTTGCCGGTCGCCCGAATGCGACTGCGCCGGCCGTTG
ACGGCCTGATCCCCGAGCCACAGGACAACGTCACGTCGATCCTCGACCGATTTGCCGATGCTGGTGGCTTCAGCCCC
TTCGAGGTCATCTCCCTCCTTGCCTCTCACTCCATTGCTCGTGCCGACAAGGTTGACCCGACGATCGACGCTGCGCC
ATTCGACTCCGTAAGTAGCCATGCTGTCTCTCTTGGGAGTCGAACTCCGCTGACAATAATTCACCCGTGCAGACTCC
G
130
scaffold ends here
MnP 789 (incomplete, 3' only - part of MnP 383) - JGI ID#256980
Scaffold 1428:
scaffold starts here
CTTCGTCAACCAGGAGGATTTCATGGCGTCGAGCTTCAAGGCGGCCATGTCCAAGCTCGCCATCCTCGGCCACAACC
GCGAGGACCTCGTCGATTGCTCCGCCGTCGTCCCCGTGCCGAAGCCCGCGGTCAACAAGCCCGCGAGCTTCCCCGCC
GGCACTAGCCCTGAGGACCTCCAGCTCACGTGCACGACTGAGAAGTTCCCGACTCTGACCATTGATGGTGCGTGTCT
GCGGACGTCTCGATTTTGATTGCAATTGGACTGACTTTCGACTCTCGTACAGCCGGTGCCCAGCAAACTCTGATCCC
GCACTGCTCTGACGGCAACATGACGTGCAACACCGTCCAGTTCAACGGCCCGGCTGCTGGTGTGTAAGAGGTCGTAG
CTTAGGATCTATTTATCCAGCTATAAGTTA
LiP 9 - JGI ID#263501
Scaffold 25:
AAAGGGGGACGCAACTCGCGATACTCTCTCCAAGACACTCGCAGTCTCTTCTACAGCCTCATTCCAGCGGTCATGGC
CTTCAAGCAGCTCATCGTCGCAATTTCCATCGCGCTCTCTCTCCAGGTCACTCAAGGTACGTTTCTGTGTCCCCGAG
CATATTCACGCTTGTGCCAATGATACCGAACACCGTGTGCAGCTGTCGTGCTGAAGGACAAGCGCGCCACCTGCTCA
AACGGTGCCAGCGTCGGCGACGAATCGTGCTGCGCATGGTTCGACGTCCTCGACGACATCCAGCAGAACCTCTTCAA
CGGAGGCCAATGCGGCGCTGAAGCCCACGAGTCCATCCGACTGTGAGTGCTTCTGCGGACCAAGCGTTCTGCACATG
AGACTAATTTAAATCTGCAGCGTCTTCCACGACTCCATCGCCATCTCTCCTGCAATGGAGGCACAGGGGAAGTTTGG
GTATGTTCCCTGTGCATTGCATGTCTCTCAAAAGTGTCACTGAGAAATTTATAGTGGTGGAGGTGCCGACGGCTCCA
TCATTCTCTTCGATGAGATTGAGACCGCATTCCACCCGAACATCGGTCTCGACGAAGTCGTCAATCTTCAGAAGCCA
TTCATCGCTAAACACGGTGTCACCCCCGGCGATTTTATTGCCTTCGCCGGTGCAGTCGCCATGAGCAACTGCCCCGG
TGCCCCGCAGATGAACTTCTTCACTGGTCGCGCTCCTGGTACGCCGACGTTTTTCAATCGGCAAATAATTTTGATTA
TTTATCTGCGTTCTGCAGCTACCCAAGCCGCGCCCGATGGTCTCGTTCCCGAGCCGTTCCGTACGTCACCAAAGCAT
TGAAAAGATTCGGAATGAAGCTGATCAACACACAGACACTGTCGACCAGATCATTGACCGTGTCAACGATGCCGGCC
AGTTCGATGAGCTCGAGCTTGTCTGGATGCTCTCGGCGTGAGTGCTTTGCGCGTTTTCCACCACTCCCGCTCTGACC
ATGCGATCTCAGCCACTCTGTCGCGGCCTCCAACGACGTCGACCCGACTGTCCAAGGCCTGCCGTTCGACTCCACTC
CCGGCGTCTTTGACTCCCAGTTCTTCGTCGAGACCCAGCTACGCGGTGTGCTCTTCCCCGGCTCTGGGGGCAACCAA
GGCGAGGTCGAGTCTGGACTCGCGGGTGAAATCCGTCTTCAGTCCGACCATACCCTCGCGCGCGACTCGCGCACGGC
CTGCGAGTGGCAGTCCTTTGTCAGTATGTATCGCCCCGAACTAGATATAGGTGCTACAGAAAATACTGACAACGGGC
CACAGACAACCAGTCGAAGCTGACGAGCGACTTCCAGTTCATCTTCCTCGCGCTCACACAGCTCGGCCAGAACCCGG
ACGCGATGACCGACTGCTCGGCCGTCATTCCGATCTCCAAGCCCATCCCCGGCAACGGCCCGTTCTCGTTCTTCCCC
GCCGGCAAGACCAGCGCCGACGTCGAGCAGGCTGTGCGTCCTCCGATTTGCCACGCACGAGCGTGACGGAAGCTGAC
TGCCCCTCTTCTAGTGCGCGTCCACCCCCTTCCCGAGCCTCACGACTCTCCCTGGCCCCACGACTTCGGTCGCTCGC
ATGTACGTAGACATTTGGAACGGATTGAGTGTTCTTGCTGACATGTTCCCTCTCTAGCCCCCCGCCTCCCGGTGCTT
AAGCCATAACCACGGTCGCGACGGCTATAACGGTCACTTCGGAATACGG
LiP 489 - JGI ID#213241
Scaffold 25 RC:
ATTAAACGGTCATGGCTTTCAAGCAACTCATCGCTGCTCTTTCCGTTGTGCTCTCTCTTCAGGCAGCCCAAGGTATG
CCTTCTCCAGCTGCACATATCCCCTTACCGTGCTGATCGCGATGCGTAGCTGCCGTGGTGAAGAGTAAGCGCGCAGC
131
ATGCTCCAACGGCGCCAGTGTCAGCGACGAGTCGTGCTGCGCGTGGTTCGACGTCCTCGACGACATTCAGCAGAACC
TCTTCAACGGAGCTCAGTGCGGGGCCGAGGCTCACGAGTCTATCCGTCTGTAAGTGCTCCTGGTTTTTCGCGATTTT
GCGAGATGGCTTATCTGCAATCTAGCGTCTTCCACGATGCCATTGCCATCTCTCCTGCCCTTGAGGCCCAGGGCCAG
TTTGGGTATGTTTCTTTCTTTATTAGTGTGCATCAAACGATCGCTAAGTGTGCTTAATAGCGGTGGTGGTGCCGACG
GCTCCATCATGATCTTTGATAGCGTCGAGACTGCGTTCCAGGCGAATGTCGGCCTTGATGAGATTGTCCAACTCCAG
AAACCATTCGTCGCGAAGCACAACGTTACCCCCGGCGACTTTATTGCGTTTGCCGGTGCGGTCGCGATGAGCAACTG
TCCGGGTGCTCCACAGATGAATTTCTTCACCGGCCGCGCTCCCGGTAGGCTCGACTTGTTTACTCGACAAAAACGGC
TCTAACCCGTACTGCGCAGCTACCCAAGCTGCTCCTGATGGTCTTGTCCCTGAGCCTTTCGGTATGTTGACAGAACG
GAACGATAATTTGTCTCTGGCTGACCGCTTTTGTAGACGATGTCACTAAGATTATCAACCGCGTCAACGATGCCGGC
CAGTTCGATGAGCTCGAGCTTGTCTGGATGCTTTCGGCGTAAGTAGCTCGCACTTTTGCCGCCGCATGTGCCCTGAC
TATCTGACCTCAGCCACTCTGTTGCTGCTTCTAACGACATCGACCCGACTGTCCAAGGCCTGCCGTTTGACTCCACT
CCCGGCATATTCGACTCCCAATTCTTCGTCGAATCCCAGCTTCGCGGCACTCTCTTCCCTGGCTCTGGCGGAAACCA
AGGCGAGGTTGAGTCTGGAATCCCGGGAGAAATGCGCCTGCAGTCCGACTCCTTGATCGCGCGCGACTCGCGCACGG
CCTGCGAGTGGCAGTCCTTCGTCAGTGCGTATAACCCCGAGCCCGATGTAACTACAGTAGAAAGGCTGAAAACGGGT
CACAGACAACCAGTCGAAGCTGACGAGCGACTTCCAGTTCATCTTCCTCGCGCTCACCCAGCTCGGTCAGAACCCGG
ACGTGATGACTGACTGCTCGGCCGTCATTCCACTCTCTAAGCCGATCCCTGGCAACGGTCCGTTTTCGTTCTTCCCC
GCTGGAACATCCATTGCCGACGTTGAGCAGGCCGTGCGTACCCGTGTCACTCGAACATGAGCGTGACGATTAGACTG
ACTGTCCCTAACAGTGCGCATCCACCCCCTTCCCGAGTCTCACGACTCTACCCGGCCCGGCGACCTCGGTCGCGCAC
ATGTACGTGGTCCTTCACTTAACTTTTTTTTGAGAACATTTGCTCATGGGATCCTCCAGCCCGCCGCCTCCTGGTGC
TTAGACAATTTCTACCACGGTCCTAACGGCTATACTATAACAT
LiP 8106 - JGI ID#152156
Scaffold 4:
CAATGGCCTTCAAGAAACTGCTCTGCGTCCTTTTCACCGCTCTCTCTCTTCGCGCCGTTCAAGGTACGTGGCTGCCT
GCTCAGGAGCCGCTGCAAGGCGCTGACGACGATGTCTCAGGTGCTGTCGTCGAGAAGCGTGCCACTTGCTCTAACGG
CGTCGCCGTTAGCAACGAATCGTGCTGCGCCTGGTTCACCGTCCTCGAAGACATCCAGGAGAACCTCTTCAACGGCG
GCCAGTGTGGTGCTGAGGCCCATGAGTCTATCCGTCTGTAAGGATGGCAAATGCCCATTACTCAATGACTGTGCGCT
GACACAGTCGTAGCGTCTTTCACGACGCCATCGCTATCTCTCCCGCGCTGGAGGCCGAGGGCCAGTTCGGGTATGTA
TTCGCTGCCCTCAGCGTCATCTTAGTATCTCACAATACTACGTGCCAGTGGTGGAGGTGCCGATGGCTCTATCATGA
TCTTCGACGAGATAGAGACCAACTTCGAGGCAAATGTCGGCCTTGACGAAATTGTTAAGCTGCAGAAGCCCTTTGTG
CAGAGGCACGGCGTCACACCCGGAGACTTCATTGCCTTCGCTGGTGCGGTCGCGATGAGCAACTGCCCCGGTGCTCC
GCAGATGAATTTCTTCACCGGACGCGCTCCCGGTACGCTCAACAAGTTTCTCCAGCGAACGGAGCTCTGACTCGTGC
TTTACAGCCACCCAAGCTGCTCCCGATGGCCTTGTCCCCGAGCCTTTTGGTATGGTCTCAGGACGGCACGGACACCC
ATCCCCAAACTTATCACCTTCACAGATTCCGTTGACAAGATCATCGCTCGCGTTGACGATGCTGGCCAGTTCGATGA
GCTCGAACTTGTCTGGATGCTTTCTGCGTGAGTAGCCCGTGCGTTTGCTACCGCATATACACTGACCATCCAACCCC
AGTCATTCCGTTGCCGCCTCCAACGACATTGACCCGACCATCGAGGGTTTGCCGTTTGACTCCACTCCTGGCATCTT
CGATTCCCAGTTCTTTGTCGAGACCCAGCTCGTTGGCACTGGCTTCCCGGGGTATGTTATCTTTGACTGAGTGCCTG
TGTGCGCGGAGCGCTCACCGCTTGTTTGTTCAGCTCCTCCGGCAATCAGGGAGAGGTGGAGTCGCCGCTCCGGGGCG
AGATGCGTCTTCAGTCCGACTTTTCTATCGCGCGCGACTCGCGCACAGCCTGCGAGTGGCAGTCCTTTGTCAGTGCG
TACCGCTCTGTGCATTCCTCGTCGTAGCAGAAACACGCTCACCATGCCCCCCGCAGACAACCAATCGAAGCTGACGA
GTGACTTCCAGTTCATCTTCCTCGCGCTCACCCAGCTTGGCCAGAACCCGGACGTGATGACCGACTGCTCGGCCGTC
ATTCCGCTCTCAAGGGCGATCCCCGGAAACCGCCCGTTCTCGTTCTTCCCCGCCGGCAAGACCGTCGCCGATGTCCA
GCAGGCCGTGCGTACCCCCGCGACGCTGTGCATCAGGCGTGCAAGCCGCTGACCGCTCTCCTTGTAGTGTGCGTCCA
CGCCTTTTCCGACCCTCACGACTCTCCCTGGCCCTGAGACCTCGGTTGCGCGCATGTACGTGCCCGCCAACAGCCAC
AAAGCTACCTTCGCTGACAATTTGCTCCCATAGCCCCCCGCCGCCTGGTGCGTAGATAGCCACCACAGCTCGATTTA
TCTCTCGGCAAGGGAATGTCAATTAAGTTCCGGTGTTTCGCGGTGTTTG
LiP-like 9982+9983 (originally predicted as two genes) - JGI ID#212237
Scaffold 25:
132
AGACTCCGAGTCCTACAGTAGCCTTTGTAGCAATGGCTCCCAAAAAACTCATCTCCCTCCTCTTCTTCGCTCTCTCC
ATCTCCGCAGTGCCAGCCACGTTGCTGCCTGCTCGAGGGTCACCGCGAGACGACTCCCTACGTGCCGTCGAGAAGCG
TGCCACCTGCTCTAACGGCGCCTCCGTCAGTGACCAGTCGTGTTGCGTCTGGGTCGACGTCCTAGAAGACATCCAGG
AAAACCTCTTCAGCGGCGGACAATGTGACGCTGAGGCCCACGAGTCCCTCCGTCTGTAAGCTCAGCAATGCCCGTTA
CTCGATGGCTGTTCGCTGACATGGCTACAGTACCTTTCACGACGCAATCGGGTATTCTTCCGCGCTAGCAGCCGAGG
GCAAGTGGCCGTATGTATCTACTGCCCTCAGCATTGTCTCAGCGTCTTACAATGTATGCCAGTGGTGGAGGCGCCGA
CGGCTCCATCCTCGCGTTCAGCGACACAGAAACTGCCTTCTCGGCGAACGCCGGTCTCGACGATATCGTCGAACTCC
AGAAGACTTTCGTCGAGAAGCACAACGTTTCTCCCGGCGACTTCATCGCCTTCGCTGGTGCGGTCGCAACGAGCAAC
TGCCCGGGTGCTCCGCAGATGCCCTTCCTCGCTGGCCGCGCTCCCCGTATGCTTGACGAATTTTTTCAGCAAATAGG
CTCTGACTCGTATTTTACAGCTACCCAGGCTTCTCCTCCTGACCTTGTCCCCGAGCCTTTCGGTGTGTTGAGTGGAC
AGCATGAGCATCCGTACATAAACTTACTCTCTTCGTAGATTCTGTCAGCAAGATCCTTAACCGCGTCGACGATGCCG
GCGGGTTCGATGAGGTAGATCTCGTATGGCTGCTTGCTTCGTGAGTAGTGTATGCGTTCGACACCGCATTGACGCTG
ACCATCCGACTTCAGCCATTCCATTGCTTCCTCCAACGAAATCGAGCCAACCAACGAGTCCTTCGCGTTCGACACCA
CTCCTCACACTTTCGTACTCCCAACTTCTTCGTTGAGACTCTGCTTGTCGGCACTGGCTTCCCTGGGTGCGTAATCT
TTGAACCAGTGCCTGTGCGCGCAGACCGCTCACGGTTTGTTCAGCTCCTCTCGCGCTCGGGGCGAGGTCAAGTCGCC
GTTCCCAAATCAGATACGTCTTCAGTCCGACTTCGCCATCGCGCGTGACCCGCGCACGTCCTGCGAGTGGCAAAACT
TCGTCAGTGCGTACCGCCCCGTGCATTTCTCATCGCAGCAGAAACACGCTCACCGCGTACCTCGCAGATAACCAGAC
AAAGATGATGAAAAACTTCCAGTCCGTCTTCCAAAACCTTACGCTGATCGGCCAGAACGTGGACCAGCTCACCAACT
GCTCGGACGTCATTCCAATCTCTACGCCGCTCCCTACCAATCGTCCGGTCTCGTACTTCCCATATGGGAAGACCATA
AACGATATCCAGCAGAGTGTACGTAGTATCCCCCGATGCTGTGCATGAGGCGTGCCGCCCGCTGACTGCCCTTCCTG
CAGTGCGCGACCGCGCCCTTCCCGAACCTTACGACGTTCTCTGGTCCCGAGACTTCGGGTACGAACGTACGTGCCTG
CCAACGACCGCGAAGGCACCTTGGCTGACAAATTGCTCCTATAGACCACTACCGTCTAGTGCATAGATATTCGCCGG
CACTCGGTCTTTGTCTCGGCAAAGGAACGACATTAAGTTATTTTGTGGT
CRO 8976+10028 (originally predicted as two genes) - JGI ID#123913
Scaffold 8:
CACAGCCTACGGCCCCGTGCCATCACGCTCGTTTGACTCCCTTCCACCCCTCGGTCGTCTAGCATGTCGCCGAAACG
GCATTCTGCACCTGCCTTCGCTCTGCTGGGGTTCGCCATACTCACGTCCGCGCAGACCCTGCCTCCACCAGGCCAGC
CCGCTCGCTCGAACGCGTCGCTCGGGAAATACGACATCGTCGGGAACAGTCTCGTCAGTGCGCAACAGGTACGTCGG
CCGCCCTGGCTTCTCGCGCGCGCGTTCGTTCGTTTTTCGGGCGCGTCTCTCGACGCGTCCGCGCATGACGCGCGTTT
TCGGGCCGCGTGATGTCCTTCCCTCGTTCTCACCCGTCTCGCAGCTCTTCCTCGGCACGGAGAACACCGTCTTCATC
ATCGACAAGGTCGAGAACAACTCCGCGCGGCTCAATGGTCACCCTGCGTGGGCGTCGCGTTACGACCTGGGCTCGAA
CGACGCCAGTCCGATGGATGCCATCACGAATACCTTCTGTGCGGTATGTTCTCCGGGGCACGCTCACGCGCGAGCAA
CGCCATGCTGATGGTGCGTGTAACAGGGTGGCGGCGTACTCGGAAACGGCAGTTGGCTGGTCGTCGGCGGAAACCAG
GCAGTTACGACAGGCGGTGCAACTGCGAGCAGCCAAAACGGTGTCCCACCTTATGATGATCCCGACGGAGGGAAGAG
GCGCGTGCTTCCACTTGATTTGCAACGAATTGCGTACTAACCAGCATATAGCTTGCGGTAGGCATCGCGCAATACTG
TCCGACTCTATTCGTCCCTAAATTTTCTCTGTTAGGTTGCTTCAACCCTGCGACGGCGATAGCTGTGATTGGCAGCT
CGTTGGGCAGATGGCCACTCGACGATGGTATCCCACTGTGTACGTCACTGCGCGTTTTCAACTGCTCCAGCGCTTTT
AACGCTTTTTCTTAGCGAGACCTTGGAAGACGGCCGAGTAATCATCGTAAATGCATGCTAATTCATTATTGTATGCG
TGCTGATTGGTGTATCTCAGATTGGTGGAGACGGCTATGGTGGGTTCGTGAACGATGCCTCGCAAACCAATCCGACC
TACGAATTCTTTCCCGCTGCCGCCGGTGCACAGCCCGTTACCTCGCCTCTTCTGCAACGCACCCTTCCCGCAAACCT
CTACCCATTGACGTGGCTGCTCCCCTCTGGACGCCTATTTATGCAGGCAACTTTGGTACTGCGATTCTTGATTACAA
GGTAGAGCAGGAGTATCAACTTCCGGACATGCCTCACGCCGTGCGCACGTATCCTGCGAGCGCTGGCACCGCGATGT
TGCCGCTGACGCCGGCAAACAACTGGACGGCAACAATCGTATTCTGCAGTGGCATGGACGTCGCCCCGAACGCCTGG
GACCCGAACGCGGACTGGCCAACGATGTCGACATCCAAGTCTTGCGTGCGCATCACGCCCGACGTGTCGCAGAACTA
TGAAGAGGACGACGACGTACCGGGGCCGCGGTCAATGGGGAATATGATCATCCTCCCCACAGGCAAGATCATGTATC
TCAACGGTGCGCAGACCGGCGTTGCGGGATATGGCAGTGGGTCGAACACTGTCGGCGACTCGTATGCGGACAACCCT
GCGTTCCAGCCGATGATCTACGACCCCGATGCGCCAGCCGGATCGCGCTGGTCCTCAGACGGCCTTTATCCTAGTAC
TATCGCGCGCATGTACCACTCGACCGCGACCCTGCTCGTCGACGGCTCCATCCTCGTCTCCGGGTCCAACCCGCACC
CCGACGTCGTCCTCTCCAACACCAAGTTCCCGACCGAGTACCGTGTCGAGATCCTCTACCCCTCGTACTACAACGCG
CCGCGCCCGGAGCCGCAGGGCATCCCGGCGTCGATCGGCTACGGCGGGCCGTACTTCAACCTTACGCTTTGGCCGCC
133
GACCTCGCGCACGACGTCGCGAACCTGAACCGCACGTCCGTCGTGCTCGTGCGCCCCGGCTTCTCGACGCACGCGAT
GAACATGCAGCAGCGCATGCTCGTGCTCGAGAACACGTACACCGGCACCACCAGCACCAACACTAGCGGCGGCGGCG
GGGGCACGCTGCACGTCGCGCCCGTGCCGCCGAACCCGGCGCTCTTCCCGCCCGGCCCCGCCCTCCTCTTCGTCGTC
GTCGCCGGCACGCCGAGCGTCGCGCGCCAGGTCACCGTCGGCGCCGGCAGCATCGGCGCGCAGCCCACGCGCGCGGC
CGTCGCGCTCCCCGCGAGCCGCGTCCTCGCCGCGGACGCGGACGCGACGGGCCAGGGCCCGAACCAGACGGCGACGG
CGAGTGCCACCGGCGTGAAGGTCCAGGCGGCGAGTGCGGCGCCGCCGGCGCGCGGCTTGGTGGGACTCTGGACGGCG
GTTGGAGCGCCGCTTGTGGTTGCGGGTGTGTTGTTGCTGCTGTGTGCGCCGCCGTTGTGACTGCACCGCGCATGGAC
CCACGAAATTTCTCGTGATCCCTGTT
134
Appendix 5: Evolution of glucuronoyl esterase
Glucuronoyl esterase (GE) has an interesting evolutionary history. In the fungi, GEs form a
distinct phylogenic group that seems to have branched off earlier than other types of fungal
carbohydrate esterases. However, it is not present in all species, consistent with GE gene loss in
multiple species (Duranova et al. 2009).
Figure A5.1. Species phylogeny of selected Basidiomycete and Ascomycete fungi. A brief
description that indicates food source is included for each species, where known. Numbers
indicate glucuronoyl esterase (GE) genes. A ">=" symbol denotes species without sequenced
genomes, where the true number of GE genes is unknown. Based on blast searches and
phylogenetic analyses from: Berbee 2001; Hibbett and Binder 2002; Tehler et al. 2003.
135
GE seems to have been retained only in fungi that feed on lignocellulose (Fig. A5.1). Of
the analysed Basidiomycetes, GE was found in P. carnosa, P. chrysosporium, and Postia
placenta, all known exclusively as wood degraders (JGI 2008). Coprinus cinereus is a
coprophilic decomposer, and is therefore expected to feed on a variety of substances, including
lignocellulose (Schmit 2002). The four Basidiomycete species found not to contain GE represent
species that feed directly on sugar and starch, or on animal matter. For the Ascomycetes, it was
difficult to correlate GE presence with food source, as many species feed on a variety of things
and many details of their biology remain unknown. However, GEs were found in the species
known to cause wood degradation - Chaetomium globosum and Trichoderma spp. - and were
absent in Pichia stipitis, an animal symbiont, and Aspergillus niger and Botrytis cinerea, which
are known to feed on simple sugars.
A GE gene tree was constructed using MrBayes 3.1 with a mixed protein model: this
means that the program can jump between all available models of protein evolution, and choose
the most appropriate one for tree construction. The analysis ran for 3.5 million generations and
trees were sampled every 100 generations. The first 2500 trees were discarded as the burn-in,
and trees were viewed in Treeview 1.6.6 (Fig. A5.2). Among the three closely related wood-
degrading Basidiomycetes (near the bottom), one P. chrysosporium GE is shown to group
externally to the other P. chrysosporium GE, the P. carnosa GE, and the two Postia placenta
GEs. It is possible that GE was duplicated in the common ancestor, and that the P. placenta
sequences underwent convergent evolution after the separation of Postia and Phanerochaete.
P.carnosa may have lost a GE, or it may have another GE that has not yet been found.
Of general interest, this tree groups one GE of the Basidiomycete Coprinus cinereus
(CC1G_04800.1) with a GE of Chaetomium globosum (XP 001221315.1), an Ascomycete,
suggesting that one or both species acquired a GE through horizontal gene transfer. This
hypothesis is supported by the fact that C. globosum XP 001221315 shares two of its four intron
positions with two of the three C. cinereus CC1G_04800.1 introns. No intron positions are
shared between any of the seven C. cinereus GEs, and the other C. globosum GEs do not have
introns. Because Coprinus cinereus CC1G_04800.1 and Chaetomium globosum XP 001221315.1
group with other C. cinereus GEs, their common ancestor likely originated in C. cinereus before
being transferred to C. globosum.
136
Even excluding C. cinereus CC1G_04800.1 and C. globosum XP 001221315, the
Basidiomycete sequences do not form a separate clade from the Ascomycetes. The first group to
branch off includes the Aspergillus species and some close relatives (Ascomycetes), followed by
Sclerotinia sclerotiorum (Ascomycete), then the Phanerochaete and Postia sequences
(Basidiomycetes), and finally the Trichodermas (Ascomycetes). The Basidiomycete C. cinereus
sequences form an internal clade with various Ascomycetes. Even excluding the Basidiomycetes,
the Ascomycete phylogeny does not match up to the species phylogeny (see Fig. A5.1) except
for very close relatives. This suggests a complex evolutionary history, possibly involving parallel
evolution between ancestor species, or horizontal gene transfer early in fungal history.
137
Figure A5.2. Bayesian tree of fungal glucuronoyl esterase (GE) amino acid sequences, using the
Whelan and Goldman (WAG) model of protein evolution.
Appendix 5 References:
Berbee ML (2001) The phylogeny of plant and animal pathogens in the Ascomycota. Physiol Mol Plant P
59: 165-187
Duranova M, Spanikova S, Wosten HAB, Biely P, de Vries RP (2009) Two glucuronoyl esterases of
Phanerochaete chrysosporium. Arch Microbiol 191: 133-140
0.1
C.cine AXE
A.nige PME outgroup
S.scle XP 001586190
C.glob XP 001221315.1
C.cine Ge CC1G 04800.11.00
C.cine Ge CC1G 09360.1
C.cine Ge CC1G 13471.11.00
0.50
C.cine Ge CC1G 05857.1
C.cine Ge CC1G 05856.11.00
0.51
C.cine Ge CC1G 05848.1
C.cine Ge CC1G 05859.11.00
0.55
P.anse XP 001903136
C.glob XP 0012260411.00
M.gris MGG 03128.6
N.crass Ge NCU09445.3
C.glob XP 001227750.1
P.anse XP 0019057271.00
1.00
1.00
C.hete 103739
P.trit XP 001931471
P.nodo XP 0017996020.99
0.99
0.98
0.98
0.57
T.atro 91976
T.vire e gw1.3.969.1
H.jeco AAP577491.00
1.00
0.94
P.chry Ge1
P.plac Ge fgenesh3 pg.168 5
P.plac Ge fgenesh3 pg.44 801.00
P.chry Ge2
P.carn1.00
1.00
1.00
0.88
0.94
A.terr ATEG 00945
A.terr XP 0012110311.00
N.fisc XP 001258567
A.fume XP 751313
Pen.chry CAP918040.78
0.92
0.95
138
Hibbett DS, Binder M (2002) Evolution of complex fruiting-body morphologies in homobasidiomycetes.
P Roy Soc Lond B Bio 269: 1963-1969
Schmit JP (2002) Tradeoffs between reproduction and mycelium production in the unit-restricted
decomposer Coprinus cinereus. Mycologia 94: 40-48
Tehler A, Little DP, Farris JS (2003) The full-length phylogenetic tree from 1551 ribosomal sequences of
chitinous fungi, Fungi. Mycol Res 107: 901-916
139
Appendix 6: Commercial MnP and LiP alignments
Figure A6.1. Alignment of P. chrysosporium LiP with LiP sequences from P. carnosa. * fully
conserved residue; : conservation of strong group; . conservation of weak group
140
Figure A6.2. Alignment of Phlebia sp. strain MG-60 MnP3 with MnP sequences from P.
carnosa. * fully conserved residue; : conservation of strong group; . conservation of weak group
141
Appendix 7: Supplemental ToF-SIMS data
Figure A7.1. Percent modification of lignin from softwood (light grey) and hardwood species
(dark grey) exposed to MnP and LiP. Shown are averages of two replicate experiments using
MnP (n=6) and one using LiP (n=3); error bars represent standard deviation. Biological
replicates consist of three different species of coniferous or deciduous wood (coniferous: balsam
fir, lodgepole pine, and white spruce; deciduous: sugar maple, yellow birch, and trembling
aspen). p-values are indicated as follows: *, 0.01 to 0.05; ***, <0.001.
142
Figure A7.2. Percent modification of lignin from softwood and hardwood species exposed to
MnP and LiP. For reactions with MnP, samples from two replicate experiments are indicated by
numbers.
143
144
Copyright Acknowledgements
Parts of Chapter 1 are published in Applied Microbiology and Biotechnology, volume 94 April
2012 pages 339-351 DOI 10.1007/s00253-012-3937-z. The original publication is available at
www.springerlink.com.
Chapter 3 and parts of Chapter 4 are published in Applied and Environmental Microbiology,
volume 77 May 2011 pages 3211-3218 DOI 10.1128/AEM.02490-10 and volume 78 March
2012 DOI 10.1128/AEM.06511-11, respectively. Copyright © American Society for
Microbiology.
Figure 5.1 is reproduced with permission from Elsevier Inc., license number 2916251402633.
Figure A3.1 is reproduced with permission from Annual Reviews, license number
2932670103836.