(CANCER RESEARCH 56. 1498-1502. April I. IW6)

Advances in Brief

Identification and Characterization of a Radiation-inducible Glycosylated HumanEarly-Response Gene

Alexei D. Kondratyev, Koong-Nah Chung, and Mira O. Jung1

Department of Radiation Medicine, Division of Radiation Research, Georgetown University Medical Center. Washington, DC 20007 ¡A.D. K., M. O. ].]. and Mediane Branch,National Cancer Institute. NIH. Bethesda. Maryland 20892 ¡K-N.C.¡

Abstract

A radiation-inducible immediate-early gene, IEX-1, was identified and

characterized in human squamous carcinoma cells. Sequence analysisrevealed 156-amino acid nuclcotidcs, encoding a protein of A/r 20,000. Theprotein is glycosylated (Mt ~27,000) in the presence of microsomal mem

branes. Northern analysis reveals a 1.2-kb transcript. Treatment with

cycloheximide was associated with superinduction of this transcript, suggesting that it is an immediate-early gene. The abundance of IEX-1 mRNAincreased rapidly after exposure of the cells to ionizing radiation (2-10

Gy), reaching a maximum by 15 min and returning subsequently to basallevels by 4 h. Expression of //. \ -1 was also induced significantly by theprotein kinase C (PKC) activator 12-O-tetradecanoylphorbol-13-acetate

(TPA), the protein phosphatase inhibitor okadaic acid, and tumor necrosistarioi -a. whereas treatment of cells with UV light and II ,0: had little

effect on IEX-1 expression. Cells depleted of PKC by prolonged incubationwith TPA showed no attenuated IEX-\ response to tumor necrosis fac-tor-a. This is the first report of IEX-1, a radiation-inducible glycosylated

human protein, whose expression can be mediated through multisignaltransduction pathways.

Introduction

Gene expression is regulated in response to various extracellularstimuli including growth factors, cytokines, mitogens, UV light, andionizing radiation, all of which exert their effects by activating varioussignal transduction pathways (1, 2). Transcriptional regulation appears to be important for a variety of cellular responses to radiation,including cell cycle arrest, activation of DNA damage repair, andgrowth (2). These responses determine cellular survival or death, aswell as malignant transformation.

Cienes induced by stressful stimuli such as ioni/ing radiation arecategori/ed as early-, intermediate-, or late-response genes accordingto their relative time of induction (3, 4). Immediate-early genes, suchas those that encode NF-xB," c-fos, c-jun, and £.#/•-!.are induced

rapidly in a manner that is unaffected by the inhibition of proteinsynthesis (5-7). These genes predominantly encode transcription factors that are responsible for subsequent induction of later-respondinggenes (8, 9) and are associated with long-term changes in gene

expression during the progression of the cellular response.Although the roles of early-response genes have been the subject of

intensive investigation, the number of such genes identified thatrespond to ioni/ing radiation has been limited. Indeed, of the variousimmediate-early genes, only five (those encoding NF-tfB, c-fos, c-jun,Ei;r-\, and /•><;-!)have been shown to be induced by ioni/ing radi-

Rcccivcd 12/19/96: accepted 2/13/96.The costs ol publication of this article were defrayed in part hy the payment of paye

charges. This article must therefore he hereby marked advertisement in accordance withIS U.S.C. Section 1734 solely to indicate this laci.

1To whom requests for reprints should he addressed, at Department of Radiation

Medicine. Division of Radialion Research. The Research Building. K211A, 3970 Reservoir Road NW. Washington. DC"2(MX>7.Phone: (202) 687-8352: Fax: (202( 6X7-2221.

' The abbreviations used are: Ni-'-KB, nuclear factor K|Ì:PKC'. protein kinase ('; ROI.

reactive oxygen intermediate: TNK-a, tumor necrosis factor «;TPA, 12-O-teiradecano-\lphoiliol-13-acetate; NLS. nuclear locali/ation signal.

ation (10). Most early-response genes are induced by a PKC-mediated

signaling pathway that is triggered by various extracellular stimuli (1,2). The activation of PKC and protein-tyrosine kinases in response to

ionizing radiation is often associated with the formation of ROIs(7, 11).

To extend our understanding of the cellular response to ionizingradiation, various groups have attempted to identify and characterizeradiation-inducible genes. Boothman et al. (12) have identified proteins induced by X-rays in human melanoma cells with the use oftwo-dimensional gel electrophoresis and have proposed a role for

these proteins in the repair of DNA damage. Singh and Lavin (13)have identified a DNA-binding protein in human cells that translo

cates from the cytoplasm to the nucleus in response to ionizingradiation. Brach et al. (6) showed that ionizing radiation induced theactivation and binding of NF-«Bto DNA in nuclei: binding occurred

even in the presence of the protein synthesis inhibitor cycloheximide.indicating activation of preexisting protein. Datta et al. (14) showedthat transcription of the EGR-l gene is increased in response to

radiation. Radiation also increases the expression of fibroblast growthfactor. TNF-a, interleukin Iß,and other cytokines (8, 15). Finally,

with the use of hybridization subtraction, Papathanasiou et ai. (16)identified a set of growth-arrest. DNA damage-inducible (GADD45)genes that are induced by X-rays and UV radiation in human cells.

We have studied the effects of ionizing radiation on gene expression in human squamous carcinoma (SCC-35) cells. Our previous

study showed that radiation induces expression of the elongationfactor-IS (EF-I8) gene (17). We now describe the identification andcharacterization of a novel human gene, ¡EX-\,that is also induced byexposure of SCC-35 cells to ionizing radiation.

Materials and Methods

Materials and Cell Culture. The human head and neck squamous carcinoma cell line SCC-35 was provided hy R. R. Weichselbaum (Departments of

Radiation and Cellular Oncology and Medicine. University of Chicago Hospitals and Clinics, Chicago, IL). The establishment and churuclcri/ation of thiscell line have been described previously ( 18). Cells were maintained in DMHMsupplemented with l()'/r fetal bovine serum, 2 HIM glutamine, KM) U/ml

penicillin. 100 (xg/ml slreptomycin, and 0.4 fig/ml hydrocorlisonc. The effectsof serum and H:O, on lEX-\ expression were determined aller incubation ofcells in scrum-tree medium for 24 h. The effects of all other agents weredetermined with complete medium. Okadaic acid, TNF-«. and TPA were

obtained from liclhcsda Research Laboratories. Cycloheximide was fromSigma Chemical Co.

Irradiation Procedure. Cells were harvested in logarithmic monolayergrowth and reseeded into 75-ctrr tissue culture flasks at 2 X 10'' cells/flask.The cells were incubated at 37"C for Id h and then either exposed lo 2-10 (¡yof y-radiation with a clinical ' (7C's irradiator or sham irradiated.

PC R Differential Display Analysis. The optimal reaction conditions wereestablished hy a modification of the method of Liang and Pardee ( I1)). TotalRNA ( I /Mg)isolated from irradiated or sham-irradiated cells (17) was reversetranscribed with anchored primers (5'-T|,-NG/NC/NA/NT) and a reversetranscription PCR kil (Perkin Elmer C'etus). The reaction was performed for I

1498

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

A RADIATION-INDUCIBLE GLYCOSYLATED HUMAN EARLY GENE

h at 37°Cfollowed by 5 min at 95°Cin a final volume of 50 jj.1containing 5

mM MgCU. 1X PCR buffer II, 0.2 mM deoxynucleotide triphosphates, 1unit/fil RNase inhibitor. 2.5 units/(j.l reverse transcriptase, and 2.5 JU.Manchored primer. A portion ( 10 /nl) of the reverse transcription reaction mixturewas then subjected to PCR in a final volume of 50 /j.1containing PCR bufferII and [a-"S]dATP (1200 Ci/mmol; DuPont New England Nuclear). Amplification was performed for 75 s at 94°C;40 cycles of 15 s at 94°C,75 s at

40°C,and 30 s at 72°C;and 255 s at 72°C.A portion (2.5 ¿il)of the stopsolution was added and then denatured for 2 min at 80°Cand analyzed by

electrophoresis on a 6% sequencing gel. Sequenced M13 DNA was used forsize markers. Human IEX-ÃŒwas detected with a 5'-T|5GA (or 5'-TliGG)anchored primer and the arbitrary primer 5'-GAAACGGGTG.

Isolation of RNA and Northern Analysis. Total RNA was isolated fromcells with an mRNA isolation kit (Invitrogen) and RNazolB (Tel-Test). Re-amplified and cloned cDNA probes were labeled with [a-12P]dCTP and a

random primer kit (Bethesda Research Laboratories). Total RNA was fractionated on agarose gels containing 1.2% formaldehyde and transferred to anylon membrane (Schleicher & Schuell). Hybridization was performed with anIEX-1 cDNA probe and with a 28S rRNA cDNA probe to determine the quality

and quantity of the loaded RNA samples.Cloning and DNA Sequencing. A human placenta cDNA library in the

pDR2 vector (Clontech Laboratories, Inc.) was screened with PCR productsobtained by differential display analysis. Positive colonies were isolated froma total of 2 X IO6 clones screened. The plasmid DNA was digested with EcoR\

to confirm the size of inserts and then sequenced with a Sequenase kit (UnitedStates Biochemical Co.).

In Vitro Translation and Glycosylation. A 1.2-kb segment of full-lengthcDNA IEX-\ was subcloned into PCR TM II plasmid containing two prokary-

otic promoters. SP6 and T7, and multicloning sites. Using the TNT SP6coupled-reticulocyte lysate system (Promega), IEX-\ was transcribed and

translated in the presence of 25 ¿dof TNT rabbit reticulocyte lysate, 2 fil ofTNT reaction buffer. 1 (j.1 of TNT SP6 RNA polymerase, 1 /xl of 1 mMcysteine-free amino acid mixture. 0.5 mCi [35S]cysteine (1000 Ci/mmol;

Amersham). 1 /j.1 of RNasin RNase inhibitor (40 units//il), and 1 fig of theplasmid DNA. The reaction was incubated at 30°Cfor 90 min. The glycosy-

lation assay was performed using in vitro protein products in the presence ofcanine microsomal membranes (Promega). as suggested by the manufacturer's

protocol. Ten ¿xlof the reaction were electrophoresed on 10% SDS/PAGE gel.The gel was fixed, presoaked in Amplify fluorographic enhancer (Amersham).dried, and exposed to Kodak Bio-Max film.

Results and Discussion

Identification of the Radiation-inducible Early Gene lEX-\.SCC-35 is a human head and neck tumor epithelial cell line that hasbeen characterized as radiation resistant (18). SCC-35 cells were

exposed to ionizing radiation (10 Gy), after which total RNA wasisolated at various intervals and subjected to a differential display ofmRNA analysis with combinations of four anchored and seven random primers. Cells exposed to 10 Gy of ionizing radiation were viablefor up to 24 h; head and neck tumor cells (SQ-20B) have been shown

previously to remain viable for similar periods after irradiation (7). Ofseven candidate radiation-inducible genes, one showed a pattern ofinduction consistent with that of an immediate-early gene (Fig. IA).The abundance of the cDNA corresponding to this gene, ¡EX-\,

increased rapidly after irradiation; the increase was apparent as earlyas 15 min after exposure, and the cDNA abundance decreased subsequently to basal levels by 4 h.

The expression of IEX-1 was confirmed by Northern analysis (Fig.

Iß).The size of the predominant mRNA was 1.2 kb. The same patternof induction kinetics of ¡EX-1was observed after exposure of cells to2-10 Gy of radiation (data not shown). Ionizing radiation had no

effect on 28S rRNA gene transcription.Our data show that the kinetics of IEX-\ induction by irradiation were

more rapid than the effects of radiation observed in other cells (10, 20,21). The rapid induction of ¡EX-1after exposure to ionizing radiation

M 1234567

270 bp »>—¿�

B 1 23 67

1.2Kb

28 S

Fig. 1. Identification of radiation-inducible genes in SCC-35 cells. A, differentialdisplay of mRNA analysis of SCC-35 cells at various times after radiation (10 Gy)exposure. Transcripts from SCC-35 cells were reverse transcribed with 5'-TlsGA andamplified with the random primer 5'-GAAACGGGTG. The PCR was performed asdescribed in "Materials and Methods." Lanes 1-7, 0. 15. and 30 min and 2, 4, 6. and 8 h.

respectively. Lane M, molecular size standards. The tirrow indicates the differentiallyexpressed 270-bp candidate cDNA (IEX-Ì).B, Northern analysis of mRNA expression.

Total RNA was isolated at various times after radiation and hybridized with an[a-32P]dCTP-labeled IEX-\ cDNA fragment obtained from the differential display. Lanes1—7,as in A. As a control, the same membrane was hybridized with a 32P-labeled

oligonucleotide (40-nucleotide) specific for 28S rRNA. Arrows. IEX-\ mRNA (1.2 kb)

and 28S rRNA.

suggests that it is unlikely that this phenomenon is a result of radiation-induced alterations in the cell cycle, because these effects are usually notmanifested until several hours after radiation exposure ( 1).

Analysis of ¡EX-1cDNA and Predicted Amino Acid Sequences.To characterize the structure of lEX-\. the cDNA fragment (270 bp)

isolated from the differential display assay was used as a probe toscreen a human placenta cDNA library. The sequence of the isolatedfull-length 1.2-kb IEX-1 cDNA is shown in Fig. 2A. A search of the

GenBank database revealed no significant homology to known humansequences; however, the IEX-1 cDNA showed 68% sequence homology to the mouse g/y96 serum growth factor-inducible immediate-

early gene that encodes a glycoprotein and has been shown to beexpressed during the G0-G, transition of the cell cycle in quiescent

1499

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

A RADIATION-INDUCIBLE GLYCOSYLATED HUMAN EARLY GENE

H l acactcgctcggctcaccATGTGTCACTCTCGCAGCTGCCACCCGACCATGACCATCCTGCAGGCCCCGMCHSRSCHPTMTILQAP

M ctgcacaacgtctaaatt N H L H G R

70 ACCCCGGCCCCCTCCACCATCCCGGGACCCCGGCGGGGCTCCGGTCCTGAGATCTTCACCTTCGACCCTTPAPSTIPGPRRGSGPEIFIFDPS GEL

40

139 CTCCCGGAGCCCGCAGCGGCCCCTGCCGGGCGCCCCAGCGGCTCTCGCGGGC ACCGAAAGCGC AGCCGCLPEPAAAPAGRPfiGSRG H R K R S R

R VVSTA LNT

63

208 AGGGTTCTCTACCCTCGAGTGGTCCGGCGCCAGCTGCCAGTCGAGGAACCGAACCCAGCCAAAAGGCTTRVLYPRVVRRQLPVEEPNPAKRL

TI V86

CTCTTTCTGCTGCTCACCATCGTCTTCTGCCAGATCCTGATGGCTGAAGAGGGTGTGCGGGCGCCCCTGLFLLLTIVFCQILMAEEGVRAPL

FAI S Q

346 CCTCCAGAGGACGCCCCTAACGCCGCATCCCTG

PPEDAPNAASL.A TS VTPE

GCGCCCACCCCTGTGTCCCCCGTCAPTPVSPV

ITAP128

Fig. 2. Sequence analysis of /EX-I. A, thecDNA and deduced amino acid sequences ofIEX-\. Numbers on the left, nucleotide position:number.1*on the right, the last amino acid on theline. *, termination codon. Putative phosphoryl-

ation siles for PKC appear bold and underlined.RNA stabilization domains in the .V untranslatedregion (A ITI A in cDNA) appear lowercase andunderlined. Putative W-glycosylation and his-tone-hinding sites are underlined. B. hydropho-hicity-hydrophilicity predictions for the proposedIEX-1 protein. Locations of the predicted ¿V-gly-cosylation and histone binding sequences are indicated. The plot was derived with the Universityof Wisconsin GCG program PEPPLOT.

403 CTCGAGCCCTTTAATCTGACTTCGGAGCCCTCGGACTACGCTCTGGACCTCAGCACTTTCCTCCAGCAAL E P F N L T SEPSDYALDLSTFLQQ

L S K A tagcaa

472 CACCCGGCCGCCTTCTAActgtgactccccgcactccccaaaaagaatccgaaaaaccacaaagaaacaH P A A F *

catccggcggccttctaaacgcgatgggtcacagtccgaagaaa ....... caaaggcaccatg .....

541 ccaggcgtacctggtgcgcgagagcgtatccccaactgggacttccgaggcaacttgaactcagaacac.gatgggtacctggtgcgagagaacgtatcccaaactgggatttctaaggcaacgctaactcagaacac

610 tacagcggagacgccacccggtgcttgaggcgggaccgaggcgcacagagaccgaggcgcatagagacctaccgccaaga .gacacc ........... gcgggtcc ................................

679 gagcacagcccagctgggctaggcccggt .aaaaaaaaaaacatcattaatttatittcEtatitacticct:............... tggctaggcccactggggacggacagagac ......... tttctccgtg. .tct

747 aattaatatttatatatatttatatacatcctcctaaata.ataagatiatgtacgtaatatttatttta

aattaatatt ..tatgtatttatgtatatcctcctaggtgaaggaggggtgtatgtaatatttattcta

815 acttatgcaagggtgtgagatgtCcc .ccctactataaatacaaatctcttaatatttattaaactttaacttatgcaggggtgcgagatatgcctccctgctgtaa ......... cacagatatttattacgattta

873 tgggactggtggaagcaggacacctggaactgcggcaaagtaggagaagaaatggggaggactcgggtgtagggtcggt ...... aagaca ....gagttgtggga ................. gggaggacccgggt .

952 ggggaggacgtcccggctgggatgaagtctggtggtgg .gtcgtaagtttaggag .gtgactgcatcct.ggtaggactcccagcttggggattagtctggggggggtgtaataagattaggggtaacactccgtctt

1019 ccagcattctcaactccgtctgtcCactgtgCgagacctcggcggaccattaggaatgagatccgtgagccagcacc .tcaactctgt .agtct ..gtcgtaaggctctggaagacccttgggaatccggcctttga .

1088 atccttccatcttcttgaagtcgcctctagggtggctgcgaggtagagggttgggggttggtgggctgt....... tgtcttctggttg .cttctcaggggcagcCgc ...... aggagtctCgggCccatggattgt

1157 cacggagcgactgtc .gagatcgccta ....gtatatitctiataaacacaaataaaattiQattit.actatcagagggcggctgtctggggtcgcctagtatgtatgttctgtgaacacgaataaacttgatctgcctgt

1220 ctgc ----cattatta

156

B

-3

TransmembraneDomain

HPhobic

HPhilic

50 100 150

HRKR NLT

1500

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

A RADIATION-INDUCIBLE GLYCOSYLATED HUMAN EARLY GENE

B1 2 1 2 3

1.2kb

28S

Fig. 3. Effects of cycloheximide and IH vitro glycosylution of IEX-\. A, SCC-35 cells

were incubated with cycloheximide (10 fig/ml) for 30 min before exposure to radiation;total RNA was isolated at various times after irradiation and subjected to Northernanalysis with a 32P-labeled ¡EX-\cDNA fragment. Lane Ì,control; Lane 2, cycloheximide

treatment for 30 min and 3 h after irradiation. B. in vitro translated IEX-1 protein was

incubated with canine pancreatic microsomal membranes for glycosylation. lume ¡,invitro translated IEX-1 protein; Lane 2, the glycosylated protein; Lane 3, absence of

protein. / and //, unprocessed and processed proteins, respectively.

ration of amino acid analogues or inhibition of an initiated processingstep such as /V-linked glycosylation can change later processing stepsor residue-secretion competency. The addition and processing of/V-Iinked carbohydrate can be crucial for proper folding and secretion

of proteins. The carbohydrate composition of a protein can havedramatic effects on biological function, half-life, and antigenicity

(27).To examine whether the IEX-1 protein processes posttransductional

modification, glycosylation. the full-length cDNA was subcloned into

a plasmid vector containing the SP6 promoter. In vitro translation of¡EX-1mRNA yielded a M, 20.000 protein, the product of which was

glycosylated in the presence of canine pancreatic microsomal membranes and resulted in the product of a M, 27,000 protein (Fig. 3B,Lane 2).

Effects of Various Agents on IEX-1 Expression. Most early-

responding genes are induced by the various stimuli through multiplesignaling pathways. The activation of PKC in response to ionizingradiation is often associated with the formation of ROIs. ROIs areproduced during various electron-transfer reactions. ROI has been

A 12345

3T3 fibroblasts (22). It was also suggested that gly96 induction mayoccur through PKC-independent pathways. The IEX-\ cDNA encodes

a protein of 156 amino acids (three residues longer than that of themouse protein) with a predicted isoelectric point of 9.5. The putativetranslation initiation site (CACCATG) was consistent with the Kozakrule for efficient translation initiation (23). The region in which thecDNA sequences diverged was near the 5' end. The 5' untranslated

region of human cDNA sequence differed completely from that of themurine sequence, whereas the 3' untranslated sequences shared some

similarity, containing five ATTTA repeats thought to be responsiblefor rapid degradation of mRNA (24). The promoter sequence has noidentity to that of mouse.3 The NHrterminal and COOH-terminal

regions of the predicted protein are predominantly hydrophilic and areseparated by a single putative transmembrane domain (Fig. 2B). Theprotein also contains putative histone binding (HRKR), an /V-glyco-

sylation site (NLT), and an NLS (RKRSRR), which contains primarily lysine and arginine residue. However, whether the NLS has acritical role for IEX-\ function is not clear, in that the small molecularsize of proteins (Mt <50.000) can enter freely, without the NLS-

specific sequences, into the nuclear compartment (25).IEX-1 Is a Glycosylated Immediate-Early Gene. Most immedi

ate-early genes are induced rapidly in a manner that is unaffected by

inhibition for protein synthesis. To investigate whether protein synthesis was required tor induction of ¡EX-\expression, we examined

the effect of cycloheximide. Pretreatment of cells with cycloheximidedid not prevent the radiation-induced increase in IEX-\ mRNA expression (Fig. 3/4, Lane 2), consistent with an immediate-early response. We also observed the additive effects on IEX-1 expressionwhen cells were exposed to ionizing radiation in the presence ofcycloheximide (4 h: data not shown), suggesting that cycloheximideinduces the IEX-1 expression.

In general, the secretion of biologically active protein from mammalian cells is in the final step in the complex pathway of posttrans-

lational modification performed in the endoplasmic reticulum andGolgi complex. Proteins destined for the exocytic pathway are firstcotranslationally translocated into the lumen of the endoplasmic reticulum (26). Alteration of the conformation of a protein by incorpo-

1A. D. Kondratyev, A. Dimchev. S. Varghcse. and M. O. Jung. Isolation of the

radiation-inducihle yene. lEX-\. promoter, manuseript in préparation.

1.2kb

28S

B

1.2kb

28S

1.2kb

28S

Fig. 4. Effects of TPA. okadaic acid, and TNF-a on IEX-\ expression. A. SCC-35 cellswere incubated with 50 n\i TPA for the various times (0. 0.25. 0.5. I. 2, and 4 hi. afterwhich total RNA was isolated and subjected to Northern analysis with a ':P-labeled ÃŒEX-1

cDNA fragment. Ltme Õ,0 h; Lane 2. 15 min; Lane 3, 30 min; Lune •¿�/.2 h; lume 5. 4 h.B. cells were incubated with 150 n,Mokadaic acid and analyzed as in A. C, cells wereincubated for 24 h in the absence (Lanes I and 21 or presence (Lanes 3 and 4) of I(X) nMTPA and then incubated with TNF-a (20 ng/mll for 30 min. Total RNA was isolated andanalyzed as in A. The same membrane was hybridized with «-"'P-labeled oligonucleotide

(40-nucleotide) specific for 28S rRNA. Arrows. IEX-ÃŒmRNA (1.2 kb) and 28S rRNA.

1501

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

A RADIATION-tNDUCIBLE GLYCOSYLATED HUMAN EARLY GENE

shown to activate immediate-early genes including NF-KB and AP-1(28-30). The activation of NF-KB by H202 was inhibited by the

antioxidant and radical scavengers, suggesting that oxygen radicalswere involved in the activation process (31). Therefore, we examinedthe effects of UV light and H2O2 on ¡EX-Ìexpression in SCC-35cells. Cells were grown in serum-free medium for 24 h before treat

ment with H2O2 (100 JU.M)to limit H2O2 decomposition catalyzed byserum components (32). We observed no effect on H2O2 on IEX-1

expression, whereas UV irradiation induced a delayed and low levelof induction in ¡EX-\mRNA abundance (data not shown).

Most early-response genes are also induced by the PKC-mediated

signaling pathway that is triggered by various extracellular stimuli,such as cytokines, mitogens, and ionizing radiation (2). We examinedthe effects of the PKC activator TPA, the protein phosphatase inhibitor okadaic acid, and TNF-a on IEX-\ expression. Both agents, TPAand okadaic acid, increased IEX-\ mRNA abundance, with maximal

effects apparent at 2 h (TPA; Fig. 44) and 4 h (okadaic acid; Fig. 4B),whereas TNF-a increased IEX-1 expression with a maximal response

apparent at 30 min (Fig. 4C). The magnitude of the effect of ionizingradiation was similar to those of TPA and TNF-a but smaller thanthose of okadaic acid and cycloheximide. PKC-depleted cells, however, did not attenuate the TNF-a-induced increase in IEX-1 mRNA

abundance (Fig. 4C, Lanes 3 and 4). The different kinetics andmagnitude of IEX-1 expression induced by these agents may reflect

the different mechanisms by which they activate PKC.Taken together, these data suggest that the transiently and rapidly

induced IEX-1 mRNA expression is associated directly with the effectof radiation by a PKC-independent mechanism. No radiation-induc-ible glycosylated gene has been reported previously. Therefore, ¡EX-1is a novel radiation-inducible glycosylated gene. It is also likely ageneral stress-response gene.

References

1. Weichselbaum, R. R., Hallaban. D. E.. Sukhatme, V., Dritschilo. A., Sherman. M. L.,and Kufe. D. W. Biological consequences of gene regulation after ionizing radiationexposure. J. Nat!. Cancer Inst.. 83: 480-484, 1991.

2. Fuks. Z.. Haimovitz-Friedman, A.. Hallaban. D. E.. Kufe. D. W., and Weichselbaum.R. R. Stress response genes induced in mammalian cells by ionizing radiation. Radiât.Oncol. Invest., /: 81-83, 1993.

3. Sukhatme. V. P. Early events in cell growth. J. Am. Soc. Nephrol., /.•859-866. 1990.

4. Ziff. E. P. Transcription factors: new family gathers at the cAMP response in situ.Trends Genet.. 6: 69-72, 1990.

5. Sherman. M. L., Datta. R.. Hallaban. D. E.. Beckett. M. A.. Weichselbaum. R. R., andKufe. D. W. Ionizing radiation regulates expression of the c-jun protooncogene. Proc.Nati. Acad. Sci USA. 87: 5663-5666, 1990.

6. Brach. M. A., Hass, R.. Sherman. M. L.. Gunji. H.. Weichselbaum, R. R., and Kufe,D. Ionizing radiation induces expression and binding activity of the nuclear factor KB.J. Clin. Invest.. 88: 691-695, 1991.

7. Hallaban, D. E.. Sukhatme, V. P., Sherman. M. L.. Virudachalam, S„Kufe, D. W.,and Wcichselhaum. R. R. Protein kinase C mediates X-ray inducibility of nuclearsignal transducers EGRI and JUN. Proc. Nati. Acad. Sci USA. 88: 2156-2160. 1991.

8. Hallaban. D. E.. Spriggs, D. R., Beckett, M. A.. Kufe. D. W., and Weichselbaum.R. R. Increased tumor necrosis factor mRNA following ionizing radiation exposure.Proc. Nati. Acad. Sci. USA, 86: 1014-1017, 1989.

9. Sherman, M. L.. Datta. R.. Hallaban, D. E.. Weichselbaum. R. R., and Kufe. D. W.Tumor necrosis factor gene expression is transcriptionally and post-transcriptionally

regulated by ionizing radiation in human mycloid leukemic cells and peripheral bloodmonocytes. J. Clin. Invest., 87: 1794-1801. 1991.

10. Wilson, R. E.. Taylor. S. L.. Atherton. G. T.. Johnston. D.. Waters, C. M., and Norton,J. D. Early response gene signaling cascades activated by ionizing radiation inprimary human B cells. Oncogene. 8: 3229-3237, 1993.

11. Uckun. F. M., Schieven. G. L.. Tuel-Ahlgren. L. M.. Dibirik. I.. Myers. D. E..

Ledbetter. J. A., and Song. C. W. Tyrosine phosphorylation is a mandatory proximalstep in radiation-induced activation of the protein kinase C signaling pathway inhuman B-lymphocyte precursors. Proc. Nati. Acad. Sci. USA. 90: 252-256, 1993.

12. Boothman, D. A.. Bouvard, I., and Hughes, E. N. Identification and characterizationof X-ray-induced proteins in human cells. Cancer Res., 49: 2871-2878. 1989.

13. Singh, S. P., and Lavin. M. F. DNA-binding protein activated by y radiation in humancells. Mol. Cell. Biol.. 10: 5279-5285. 1990.

14. Datta. R., Rubin, E., Sukhatme. V.. Oureshi. S.. Hallaban. D.. Weichselbaum. R. R.,and Kufe. D. W. Ionizing radiation activates transcription of the KCRI gene via CArGelements. Proc. Nati. Acad. Sci. USA, 89: 10149-10153. 1992.

15. Brach. M. A.. Grub. H. J.. Kaisho. T.. Asano. Y.. Hirano, T.. and Hermann. I. Ionizingradiation induces expression of interleukin 6 by human fibroblasts involving activation of nuclear factor-KB. J. Biol. Chem., 26«.-8466-8472, 1993.

16. Papathanasiou. M. A., Ker. N. C. K., Robbins, J. H., McBride, O. W., Alamo, I..Barrett, S. F., Hickson. I. D.. and Fornace. A. J. Induction by ionizing radiation of thegadJ 45 gene in cultured human cells: lack of mediation by protein kinase C. Mol.Cell. Biol.. //: 1009-1016. 1991.

17. Jung, M.. Kondratyev, A. D.. and Dritschilo, A. Elongation factor 15 is enhancedfollowing exposure to ionizing radiation. Cancer Res.. 54: 2541-2543. 1994.

18. Weichselbaum, R. R., Dahlberg, W.. Beckett. M., Karrison, T.. Miller. D., Clark, J.,and Ervin, T. J. Radiation-resistant and repair-proficient human tumor cells may be

associated with radiotherapy failure in head and neck cancer patients. Proc. Nati.Acad. Sci. USA, 88: 2684-2688, 1986.

19. Liang, P., and Pardee, A. B. Differential display of eukaryotic messenger RNA bymeans of the polymerase chain reaction. Science (Washington DC). 257: 967-971.

1992.20. Murphy. J. J.. and Norton. J. D. Coupling of early response gene expression to distinct

regulatory pathways during a-interferon and phorbol ester-induced plasmacyloiddifferentiation of ßchronic lymphocytic leukemia cells. FEES Lett.. 267: 242-244,

1990.21. Murphy. J. J., and Norton, J. D. Cell-type-specific early response gene expression

during plasmacytoid differentiation of human ßlymphocytic leukemia cells. Biochim.Biophys. Acta. I049: 261-271, 1990.

22. Charles. C. H.. Yoon. J. K., Simske, J. S.. and Lau. L. F. Genomic structure. cDNAsequence, and expression of K/y96. a growth factor-inducible immediate-early geneencoding a short-lived glycosylated protein. Oncogene, 8: 797-801. 1993.

23. Kozak. M. Point mutations define a sequence flanking the AUG initiator codon thatmodulates translation by eukaryotic ribosomes. Cell, 44: 283-292. 1986.

24. Shaw, G.. and Kamer. R. A conserved AU sequence from the 3' untranslated region

of GM-CSF mRNA mediates selective mRNA degradation. Cell. 46: 659-667. 1986.

25. Dingwall, C., and Lasky R. A. Protein import into the cell nucleus. Annu. Rev. CellBiol., 2: 367-390. 1986.

26. Kornfeld. R., and Kornfeld. S. Assembly of asparagine-linked oligosaccharides. Am.Rev. Bioehem.. 54: 631-664. 1985.

27. Domer. A. J., Bole. D. G.. and Kaufman. R. J. The relationship of AMinked glyco-sylation and heavy chain-binding protein association with the secretion of glycopro-tein. J. Cell Biol.. 105: 2665-2674, 1987.

28. Stein. B.. Rahmsdorf, H. J.. Steffen. A., Litfin. M., and Herrlich. P. UV-induced DNAdamage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1. collagenase. c-fos. and metallolhionein. Mol. Cell. Biol.. 9:5169-5181. 1989.

29. Devary, Y., Gottlieb, R. A., Laus, L. F., and Karin, M. Rapid and preferentialactivation of the c-jim gene during the mammalian UV response. Mol. Cell. Biol.. II:2804-2811, 1991.

30. Nose. K., Shibanuma, M.. Kikuchi. K.. Kageyama. H.. Sakiyama. S.. and Kuroki. T.Transcriptional activation of early response genes by hydrogen peroxide in a mouseosteoblastic cell line. Eur. J. Bioehem.. 201: 99-106. 1991.

31. Anderson, M. T.. Staal, F. J. T.. Gitler. C.. and Herzenberg. L. A. Separation ofoxidant-initiated and redox-regulated steps in the NF-KB signal transduction pathway.Proc. Nati. Acad. Sci. USA, 91: 11527-11531. 1994.

32. Link, E. M.. and Riley. P. A. Role of hydrogen peroxide in the cylotoxicity of thexanthine/xanthine oxidase system. Bioehem. J., 249: 391-399, 1988.

1502

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

1996;56:1498-1502. Cancer Res   Alexei D. Kondratyev, Koong-Nah Chung and Mira O. Jung  Glycosylated Human Early-Response GeneIdentification and Characterization of a Radiation-inducible

  Updated version

  http://cancerres.aacrjournals.org/content/56/7/1498

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/7/1498To request permission to re-use all or part of this article, use this link

Research. on February 16, 2021. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from