MOLECULARPHYLOGENETICSAND

Molecular Phylogenetics and Evolution 28 (2003) 529–535

www.elsevier.com/locate/ympev

EVOLUTION

Hox and paraHox genes from the anthozoan Parazoanthus parasiticus

April Hill,* Aimee Wagner, and Malcolm Hill

Biology Department, Fairfield University, Fairfield, CT 06430, USA

Received 10 July 2002; revised 21 November 2002

Abstract

We surveyed the genome of the Caribbean zoanthid Parazoanthus parasiticus for Hox and paraHox genes, and examined gene

expression patterns for sequences we uncovered. Two Hox genes and three paraHox genes were identified in our surveys. The Hox

genes belong to anterior and posterior classes. In phylogenetic analyses, the anterior Hox sequence formed an anthozoan-specific

cluster that appears to be a second class of cnidarian anterior Hox gene. The presence of an anterior Gsx-like paraHox gene supports

the hypothesis that duplication of a protoHox gene family preceded the divergence of the Cnidaria and bilaterians. The presence of

two Mox class paraHox genes in P. parasiticus deserves further attention. Expression analysis using RT-PCR, indicated that one

Mox gene and the anterior paraHox gene are not expressed in adult tissue, whereas the other three sequences are expressed in both

dividing and unitary polyps. Dividing polyps showed slightly lower Ppox1 (i.e., Mox) expression levels. Our data add to the number

of published anthozoan sequences, and provide additional detail concerning the evolutionary significance of cnidarian Hox and

paraHox genes.

� 2003 Elsevier Science (USA). All rights reserved.

1. Introduction

Hox and paraHox genes comprise the Antenapedia

class of homeotic genes, and encode a class of DNA-

binding transcription factors that are highly conservedamong and within animal lineages (Akam, 1989;

B€uurglin, 1994; B€uurglin et al., 1989; Davidson et al., 1995;

de Rosa et al., 1999; Gehring, 1987; Kenyon, 1994; Mito

and Endo, 1997; Murtha et al., 1991; Schierwater et al.,

1991). These gene families play a crucial role in axial

patterning and segmental identity in all metazoan ani-

mals (Aerne et al., 1995; Arenas-Mena et al., 1998;

Dolecki et al., 1986; Garcia-Fernandez et al., 1991;Holland and Hogan, 1986; Kenyon and Wang, 1991;

Knoll and Carroll, 1999; Krumlauf, 1994; Laughon and

Scott, 1984; McGinnis et al., 1984; Oliver et al., 1992;

Schummer et al., 1992; Shenk et al., 1993a,b). One

major feature of these genes is that they are arranged in

clusters, and the linear organization of the homeobox

genes correlates with their expression patterns along the

anterior–posterior axis of the developing animal (Akam,

* Corresponding author. Fax: 1-203-254-4253.

E-mail address: ahill@fair1.fairfield.edu (A. Hill).

1055-7903/$ - see front matter � 2003 Elsevier Science (USA). All rights res

doi:10.1016/S1055-7903(03)00062-9

1989; Graham et al., 1989; Kenyon and Wang, 1991;

Krumlauf, 1994; Pendelton et al., 1993; Peterson et al.,

2000; Valentine et al., 1996). There is evidence that the

paraHox and Hox clusters are evolutionary sisters

(Brooke et al., 1998), which has important implicationsfor our understanding of the current distribution of

these genes in the animal kingdom (Brooke et al., 1998;

Finnerty, 2001; Finnerty and Martindale, 1997; Finn-

erty and Martindale, 1999; Kourakis and Martindale,

2000).

Among bilaterians, we currently recognize four clas-

ses of Hox gene families (anterior, group 3, central and

posterior) and three classes of paraHox gene families(Gsx, Xlox, and Cdx) (see Gauchat et al., 2000). While

anterior and posterior Hox and paraHox representatives

have been identified in the diploblasts, the cnidarians

appear to lack the middle Hox (group 3 and central) and

paraHox (Xlox) genes (e.g., Finnerty, 2001). Currently,

the early evolutionary history of the Hox and paraHox

gene clusters is unresolved, but several hypotheses have

been proposed. The leading hypothesis posits a proto-

Hox gene cluster consisting of at least three genes that

existed before the Hox/paraHox split (Brooke et al.,

1998; Ferrier and Holland, 2001; Finnerty, 2001; Finn-

erty and Martindale, 1998, 1999; Gauchat et al., 2000;

erved.

530 A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535

Kuhn et al., 1996, 1999; Masuda-Nakagawa et al.,2000). There are several lines of support for this

hypothesis including the fact that in all phylogenetic

analyses to date, the paraHox genes cluster within es-

tablished Hox gene families (e.g., Kourakis and Mar-

tindale, 2000). Under this scenario, metazoans lost the

central paraHox gene while cnidarians lost the central

genes in both Hox and paraHox gene clusters. Kourakis

and Martindale (2000) recently proposed a protoHox

cluster, predating the Hox/paraHox split, that contained

all four Hox families.

With additional homeobox gene surveys of different

classes and species of cnidarians, the Hox/paraHox

gene families continue to grow, and it has been sug-

gested that additional work with cnidarians is likely to

broaden our understanding of the origin and evolution

of these genes, as well as the structure and function ofancestral protoHox genes (Ferrier and Holland, 2001;

Finnerty, 2001; Gauchet et al., 2000). For example, it is

possible (albeit remotely) that the ‘‘middle’’ Hox/

paraHox genes have been missed in the numerous

surveys that have been conducted to date (e.g., Ko-

urakis and Martindale, 2000). Additional surveys and

analysis of genome organization (i.e., linkage analysis)

of basal animal groups should elucidate the earlyevolution of these developmentally important gene

families.

In the present study we adopted the former ap-

proach, and surveyed a previously unexamined antho-

zoan species (Parazoanthus parasiticus) for Hox and

paraHox genes. Our goal was to obtain novel gene

sequences, and expand the number of anthozoans

surveyed to date. P. parasiticus was chosen because it iscommon throughout the Caribbean, it is conspicuous

due to its epibiotic growth habit (Hill, 1998), and can

be collected in various stages of asexual reproduction.

In addition to the Hox/paraHox sequences obtained,

we present data on the expression of these genes in

P. parasiticus tissues in the process of dividing (i.e.,

asexual reproduction) compared to unitary polyps. Our

data lend support to the hypothesis that cnidariansdiverged from the metazoan lineage after the duplica-

tion of the protoHox cluster. Larger scale sequencing

efforts have produced useful phylogenetic hypotheses

concerning the molecular evolution of cnidarian Hox

and paraHox genes, and our data add detail to these

gene trees.

2. Materials and methods

2.1. Isolation and sequencing of DNA

Parazoanthus parasiticus polyps were collected from

the surface of the sponge Callyspongia vaginalis in the

Florida Keys in the summer of 1999. Tissue samples of

both dividing and unitary P. parasiticus polyps werestored at )80 �C. Polyps showing any evidence of fission

were classified as ‘‘dividing.’’ DNA was isolated from P.

parasiticus using Qiagen�s DNeasy kit following the

manufacturer�s protocol. Two sets of degenerate primers

were used to survey the genome for Hox genes. The first

primer set, Homeo 1 & Homeo 2, was described in

Finnerty and Martindale (1997). Reactions for the Ho-

meo 1/2 primer set contained 3.5 mM MgCl2, 200 lMdNTPs, 0.6 U Taq, 12.5 pmol each primer, and 150 ng

genomic DNA. The cycle profile for the reaction in-

cluded 5 cycles of 94 �C for 45 s, 37 �C for 45 s, 72 �C for

45 s, then 35 cycles of 94 �C for 45 s, 42 �C for 45 s, and

72 �C for 45 s on the Perkin–Elmer 2400 Thermocylcer.

The second primer set, Hox A & Hox B, was described

in Schierwater et al. (1991). PCR conditions included

3 mM MgCl2, 200 lM dNTPs, 1 U Taq, 1 lM eachprimer and 500 ng genomic DNA. The PCR profile in-

cluded 30 cycles of 95 �C for 1 min, 40 �C for 1 min, and

72 �C for 1 min. Taq was added to all reactions after the

reactions were heated to 95 �C for 10 min. Products were

visualized on a 2% agarose gel.

For each primer set, inserts of appropriate size were

chosen for cloning. PCR products were purified using

the QIA Quick Spin Purification Kit (Qiagen) andcloned using a T/A cloning system into the p(T) Ad-

vantage vector (Clontech). DNA sequencing was car-

ried out using the ABI PRISM Big Dye Termination

Cycle Sequencing Ready Reaction Kit (Perkin–Elmer).

Samples were sent to the University of Connecticut

Macromolecular Characterization Facility for se-

quencing.

2.2. Sequence and phylogenetic analysis

Chromatograms were examined, and amino acid

sequences were deduced using GeneTool 1.1. The

P. parasiticus homeodomain sequences recovered from

degenerate PCR were compared to sequences in the

GenBank database using the BLAST algorithm (Altsc-

hul et al., 1990). Alignment of amino acid sequences wasperformed using CLUSTAL W (Thompson et al., 1994),

and phylogenetic relationships of known cnidarian Hox

and paraHox homeodomain sequences were inferred

using the neighbor-joining method in PAUP* 4.0b8

(Swofford, 1999). Amino acids that were used to con-

struct degenerate primers were not used in phylogenetic

analyses. Two non-Hox Antp-class sequences were in-

cluded in the analysis as outgroups. The first sequencecame from the NK-2 family, and the second came from

the Prh/Hex family (see Gauchat et al., 2000).

2.3. Gene expression analysis

RNA was isolated from dividing and unitary

P. parasiticus tissue samples using Trizol (Life

A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535 531

Technologies). Reverse transcriptase-PCR was con-ducted to determine whether Hox gene expression dif-

fered in the two stages of P. parasiticus development.

Primers for each of five Hox sequences identified in this

survey were designed using GeneTool 1.1 (primer se-

quences are available upon request). cDNA was syn-

thesized according to the ThermoScript RT-PCR

System protocol (Invitrogen). PCR was conducted ac-

cording to the procedure outlined in the ThermoScriptRT-PCR System. The cycle profile for the reaction was

30 cycles of 94 �C for 2 min, 94 �C for 30 s, 54 �C for 30 s,

72 �C for 45 s, and 72 �C for 5 min. The RT-PCR ex-

pression products were run on a 2% Molecular Screen-

ing Agarose Gel. Parazoanthus-specific 18S primers were

used as the positive control and were included in each

RT-PCR reaction. Primers were designed from pub-

lished Parazoanthus axinellae 18S sequences (GenBankAccession No. U42453). The forward 18S primer se-

quence was 50 CAGGGAGGTAGTGACAAAAAATA

AC 30 and the reverse 18S primer sequence was 50 GCTT

TCGCAGTAGTTCGTCTTT 30. Band intensities were

measured with Kodak ID Image Analysis Software.

Fig. 1. Alignments of anthozoan homeodomain fragments (amino acids 21–4

suggested by Finnerty and Martindale, 1999; Gauchat et al., 2000; Masuda-N

on both Clustal W alignment and BLAST searches. Gene names are listed to

the gene was retrieved (Af, Acropora formosa; Am, A. millepora Pp, Parazo

P. parasiticus sequences obtained in this study are shown in bold, and acces

3. Results

3.1. Sequence and phylogenetic analyses

We isolated five homeodomain sequences from P.

parasiticus corresponding to four distinct paraHox or

Hox gene families (Fig. 1). The results of the phyloge-

netic analysis are shown in Fig. 2. The neighbor-joining

tree indicated that Ppox1 and Ppox2 grouped within theMox/Cnox5 paraHox family. The Ppox3 sequence

grouped within the Gsh/Cnox2 paraHox gene family.

Ppox4, an anterior Hox sequence, was found in the

AntHox-Cnox1 clade, and Ppox5, a member of

the posterior Hox (Cnox3) family, was embedded in the

posterior Hox Scyphozoa-Cnox5 group.

3.2. Gene expression analysis

We determined that Ppox2 and Ppox5 were not ex-

pressed at a detectable level in either dividing or unitary

P. parasiticus polyps (data not shown). However,

Ppox1, 3, and 4 exhibited a low level of expression in

7) organized by most probable functional paraHox and Hox groups (as

akagawa et al., 2000). Functional group assignments were made based

the left with the final two letters representing the species from which

anthus parasiticus; Ms, Metridium senile; Nv, Nematostella vectensis).

sion numbers for all sequences are located in the parentheses.

Fig. 2. Phylogenetic relationships of known cnidarian Hox and paraHox homedomain sequences were inferred using the neighbor-joining method in

PAUP* 4.0b8 (Swofford, 1999). The phylogeny is based on analysis of 27 amino acids. Gene names are listed with the final two letters representing

the species from which the gene was retrieved (Af, Acropora formosa; Am, A. millepora; Cv, Chlorohydra viridissima; Cx, Cassiopeia xamachana; Ed,

Eleutheria dichotoma; Hv, Hydra vulagaris ; Hm, H. magnipapillata; Hys, Hydractinia symbiolongicarpus; Pc, Podocorynae carnea; Pp, Parazoanthus

parasiticus; Ms, Metridium senile; and Nv, Nematostella vectensis). Accession numbers for the anthozoan sequences are given in Fig. 1. The remaining

accession numbers are: Cnox1�Pcc1 (X81455), Cnox5�Edc1 (U41842), Cnox1�Hvc1 (AJ252181), Cnox 4�Hmc1 (S39067), Cnox3�Hvc1 (L22787),

Cnox1�Cvc1 (X64625), Cnox3�Ed (U41840), Cnox2�Pc (X64626), Cnox4�Ed (U41841), Scox1�Cx (AF124591), Scox4�Cx (AF124594),

Scox5�Cx (AF124595), Cnox1�Hm (Z22638), Cnox3�Hv (AJ252182), Cnox1�Ed (Kuhn et al., 1996), Scox3�Cx (AF124593), Cnox4�Pc

(AY036893), Cnox5�Hm (Z22640), Scox2�Cx (AF124592), Cnox 2�Ed (Kuhn et al., 1996), Cnox2�Cv (X64626), Cnox2�Hv (AJ277388), and

Cnox2�Hm (X61542). Asterisks indicate positions of the five Ppox sequences. The boxes correspond to functional Hox/paraHox groups; Box 1

represents posterior Hox sequences, Box 2 represents Mox paraHox genes, Box 3 represents anterior paraHox sequences, and Box 4 represents

anterior Hox sequences (see Finnerty and Martindale, 1999; Gauchat et al., 2000; Masuda-Nakagawa et al., 2000).

532 A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535

both dividing and unitary polyps. The expression

products of these genes were evaluated along with the

18S primer pair as an internal control (Fig. 3). Densi-

tometry indicated that Ppox1 was expressed at a twofold

greater level in unitary polyps compared to dividing

polyps indicating that there may be differential control

of the expression of this paraHox gene between unitary

and dividing developmental stages.

Fig. 3. Reverse transcriptase PCR expression products. Lane (1) 100 bp

ladder, lanes (2) and (3) correspond to Ppox1, lanes (4) and (5) cor-

respond to Ppox3, and lanes (6) and (7) correspond to Ppox4. Polyps

in some stage of dividing are found in lanes (2), (4), and (6), the other

lanes contain unitary adult polyps. 18S control bands are indicated.

A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535 533

4. Discussion

4.1. Phylogenetic analysis and evolutionary implications

Our survey of the P. parasiticus genome increases the

number of currently identified anthozoan Hox and

paraHox genes to just over 15 (Finnerty, 2001). At least

three interesting observations can be made when our P.

parasiticus sequences are compared to other anthozoan

Hox/paraHox genes. First, Ppox4 shows a strong affinityfor two of the Nematostella sequences (Fig. 2). Thus,

there appear to be two distinct anterior Hox groupings

in the Cnidaria, as has been suggested previously

(Finnerty, 1998; Finnerty and Martindale, 1997; Finn-

erty and Martindale, 1999; Kourakis and Martindale,

2000), but one of the groupings may be anthozoan-

specific (see Ppox4 group in Fig. 2). Indeed, the high

degree of similarity between the orthologous Ppox4 andAnthox7 and Anthox8 provide strong evidence that the

anthozoans contain an anterior Hox family that is dis-

tinctive from previously known anterior families found

in other cnidarian classes. It is possible that this second

anterior family has not yet been identified in non-

anthozoan cnidarians, or that the family was lost in

more derived cnidarians. Additional surveys are clearly

needed to address this hypothesis.The second finding from our phylogenetic analysis

was that Ppox3 and Anthox2-Ms sequences belong to a

distinct cluster, coming from a deep branching point,

when compared to the rest of the Gsh/Cnox2 grouping

(Fig. 2). Considered alone, the presence of a divergent

sequence like Anthox2�Ms might be interpreted as a

species-specific anomaly, but with our Ppox3 sequence,

this grouping looks more like a novel, perhaps antho-zoan-specific, anterior paraHox cluster. The significance

of a second anterior paraHox family in the Anthozoa

remains to be determined, but it is clear that additionalsurveys with other anthozoan species might reveal a

greater degree of complexity and variability in the

paraHox families than is currently recognized. Given the

basal position of the Anthozoa in the cnidarian phy-

logeny, important insights into the early evolution of the

anterior class Hox/paraHox families will be gained

through a detailed examination of other anthozoan

species. Nonetheless, the presence of an anterior Gsx-like paraHox gene in P. parasiticus (i.e., Ppox3) supports

the hypothesis that duplication of a protoHox gene

family preceded the divergence of the Cnidaria and bi-

laterians.

The third observation coming from the neighbor-

joining gene tree was the placement of the Ppox5 se-

quence within posterior Hox genes isolated from

scyphozoans, and not among the Anthox sequenceswhere, phylogenetically, it was expected to fall (Fig. 2).

Whether this represents additional variability in the

posterior Hox family of the anthozoans remains to be

seen. Perhaps additional sequence information or inclu-

sion of more species would clarify this. It should also be

noted that the presence of two Mox/Cnox-5 class para-

Hox genes in P. parasiticus (Ppox1 and 2) was surprising

given that only two other Mox/Cnox-5 class sequenceshave been described to date. The diversity and function

of these paraHox genes deserves further attention.

As with previous cnidarian studies, we failed to

identify genes from the central Hox and paraHox gene

families. Several evolutionary explanations for the ab-

sence of this class of Hox/paraHox genes from the

Phylum Cnidaria have been offered. Many have pro-

posed that the protoHox cluster present at the paraHox/

Hox split was composed of at least three genes corre-

sponding to anterior, central (central and PG-3), and

posterior classes (Brooke et al., 1998; Ferrier and Hol-

land, 2001; Finnerty, 2001; Kourakis and Martindale,

2000; Schubert et al., 1993). The documented inability to

locate central class paralogs in cnidarians does not rule

out the possibility that this gene family exists in cnida-

rians. Because the choice of primers in degenerate PCR-based studies is vital, it is likely that small differences in

primer sequences will produce differences in the genes

recovered. In our study, four of the five genes we re-

covered were obtained using the Homeo 1/2 primers;

only one sequence, Ppox5, was obtained using the Hox

A/B primer set, and this was a posterior Hox gene. This

type of primer-driven amplification bias indicates that

the cnidarian genome may contain currently unknownHox gene families (see e.g., Ferrier and Holland, 2001),

and perhaps a central paralog. Furthermore, Kourakis

and Martindale (2000) point out that ancestor sequences

can be highly divergent from members of extant Hox/

paraHox gene families. Additional surveys are likely

to reveal further diversity of the cnidarian Hox and

paraHox paralogs.

534 A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535

4.2. Gene expression analysis

The absence of expression of Ppox2 and 5 at both

stages in P. parasiticus development suggests that these

genes might be expressed at earlier stages of develop-

ment. Low level expression of Ppox1, 3, and 4 was found

in both the dividing and unitary stages of P. parasiticus,

which might indicate that these genes have a more

important role earlier in P. parasiticus development.P. parasiticus�s reliance on asexual reproduction (Hill,

1998) might make this organism particularly attractive

for studies of gene expression in adult tissue. Future

work will include in situs using polyps in various stages

of dividing.

In conclusion, our results increase the number of

known anthozoan Hox/paraHox genes, and add details

to the scenario proposed for the early evolution in thisgroup. Adding other anthozoan species to survey efforts

will help increase the resolution of these gene trees thus

increasing the probability of discerning patterns of

molecular evolution. As suggested previously, the next

step should involve gathering detailed information re-

garding cnidarian genome structure (i.e., linkage anal-

ysis). This information will provide insights concerning

the characteristics of the protoHox cluster.

Acknowledgments

We would like to thank Tom Wilcox for his assis-

tance during the collection of P. parasiticus. This re-

search was made possible by a grant from the National

Science Foundation (IBN) as well as by a Fairfield

University Fellows Scholar Research Stipend.

References

Aerne, B.L., Baader, C.D., Schmid, V., 1995. Life stage and tissue

specific expression of the homebox gene cnox1-Pc of the hydrozoan

Podocoryne carnea. Dev. Biol. 169, 547–556.

Akam, M., 1989. Hox and Hom: homologous gene clusters in insects

and vertebrates. Cell 57, 347–349.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990.

Basic local alignment search tool. J. Mol. Biol. 215, 403–410.

Arenas-Mena, C., Martinez, P., Cameron, R.A., Davidson, E.H.,

1998. Expression of the Hox gene complex in the indirect

development of a sea urchin. Proc. Natl. Acad. Sci. USA 95,

13062–13067.

Brooke, N.M., Garcia-Fernandez, J., Holland, P.W.H., 1998. The

ParaHox gene cluster is an evalutionary sister of the Hox gene

cluster. Nature 392, 920–922.

B€uurglin, T., 1994. In: Duboule, D. (Ed.), A Comprehensive Classifi-

cation of Homeobox Genes. Oxford University Press, New York.

B€uurglin, T., Finney, M., Coulson, A., Ruvkun, G., 1989. Caenor-

habditis elegans has scores of homeobox-containing genes. Nature

341, 239–243.

Davidson, E.H., Peterson, K.J., Cameron, R.A., 1995. Origin of

bilaterian body plans: evolution of developmental regulatory

mechanisms. Science 270, 1319–1325.

de Rosa, R., Grenier, J.K., Andreeva, T., Cook, C.E., Adoutte, A.,

Akam, M., Carroll, S.B., Balavoine, G., 1999. Hox genes in

brachiopods and priapulids and protostome evolution. Nature 399,

772–776.

Dolecki, G., Wannakrairoj, S., Lum, R., Wang, G., Riley, H., Carlos,

R., Wang, A., Humphreys, T., 1986. Stage-specific expression of a

homeobox-containing gene in the non-segmented sea urchin

embryo. EMBO J. 5, 925–930.

Ferrier, D., Holland, P., 2001. Ancient origin of the Hox gene cluster.

Nature 2, 33–38.

Finnerty, J.R., 1998. Homeoboxes in sea anemones and other

nonbilaterian animals: implications for the evolution of the Hox

cluster and the zootype. Curr. Top. Dev. Bio. 40, 211–254.

Finnerty, J.R., 2001. Cnidarians reveal intermediate stages in the

evolution of Hox clusters and axial complexity. Am. Zool. 41,

608–620.

Finnerty, J., Martindale, M., 1997. Homeoboxes in sea anemones

(Cnidaria; Anthozoa): A PCR-based survey of Nematostella

vectenisis and Metridium senile. Biological Bulletin 193, 62–76.

Finnerty, J.R., Martindale, M.Q., 1998. The evolution of the

Hox cluster: insights from outgroups. Curr. Opin. Genet. Dev. 8,

681–687.

Finnerty, J.R., Martindale, M.Q., 1999. Ancient origins of axial

patterning genes: Hox genes and ParaHox genes in the Cnidaria.

Evol. Dev. 1, 16–23.

Garcia-Fernandez, J., Baguna, J., Salo, E., 1991. Planarian homeobox

genes: cloning, sequence analysis and expression. Proc. Natl. Acad.

Sci. USA 88, 7338–7342.

Gauchat, D., Mazet, F., Berney, C., Schummer, M., Kreger, S.,

Pawlowski, J., Galliot, B., 2000. Evolution of Antp-class genes and

differential expression of Hydra Hox/paraHox genes in anterior

patterning. Proc. Natl. Acad. Sci. USA 97, 4493–4498.

Gauchet, D., Mazet, F., Berney, C., Schummer, M., Kreger, S.,

Pawlowski, J., Galliot, B., 2000. Evolution of antp-class genes and

differential expression of hydra Hox/paraHox genes in anterior

patterning. Proc. Natl. Acad. Sci. USA 97, 4493–4498.

Gehring, W., 1987. Homeoboxes in the study of development. Science

230, 1245–1252.

Graham, A., Papalopulu, N., Krumlauf, R., 1989. The murine and

Drosophila homeobox gene complexes have common features of

organisation and expression. Cell 57, 367–378.

Hill, M.S., 1998. Sponges harbor genetically identical populations of

the zoanthid Parazoanthus parasiticus. Bull. Mar. Sci. 63, 513–522.

Holland, P., Hogan, B., 1986. Phylogenetic distribution of Antenna-

pedia-like homeoboxes. Nature 321, 251–253.

Kenyon, C., 1994. If birds can fly, why can�t we? Homeotic genes and

evolution. Cell 78, 175–180.

Kenyon, C., Wang, B., 1991. A cluster of Antennapedia-class

homeobox genes in a nonsegmented animal. Science 253,

516–517.

Knoll, A., Carroll, S., 1999. Early animal evolution: emerging views

from comparative biology and geology. Science 284, 2129–2137.

Kourakis, M.J., Martindale, M.Q., 2000. Combined-method phyloge-

netic analysis of Hox and ParaHox genes of the Metazoa. J. Exp.

Zool. 288, 175–191.

Krumlauf, R., 1994. Hox genes in vertebrate development. Cell 78,

191–201.

Kuhn, K., Streit, B., Schierwater, B., 1996. Homeobox genes in the

Cnidarian Elutheria dichotoma: evolutionary implications for the

origin of Antennapedia-class (HOM/Hox) genes. Mol. Phylogenet.

Evol. 6, 30–38.

Kuhn, K., Streit, B., Schierwater, B., 1999. Isolation of Hox genes

from the scyphozoan Casseiopei xamachana: implications for the

early evolution of Hox genes. J. Exp. Zool. 285, 63–75.

A. Hill et al. / Molecular Phylogenetics and Evolution 28 (2003) 529–535 535

Laughon, A., Scott, M., 1984. Sequence of a Drosophila segmentation

gene: protein structure homology with DNA-binding proteins.

Nature 310, 25–30.

Masuda-Nakagawa, L.M., Gr€ooger, H., Aerne, B.L., Schmid, W., 2000.

The Hox-like gene Cnox2-Pc is expressed at the anterior region in

all life cycle stages of the jellyfish Podocoryne carnea. Dev. Genes

Evol. 210, 151–156.

McGinnis, W., Garber, R.L., Wirz, J., Kuroiwa, A., Gehring, W.J.,

1984. A homologous protein-coding sequence in Drosophila home-

otic genes and its conservation in other metazoans. Cell 37, 403–408.

Mito, T., Endo, K., 1997. A PCR survey of Hox genes in the sea star,

Asterina minor. Mol. Phylogenet. Evol. 8, 218–224.

Murtha, M., Leckman, J.F., Ruddle, F.H., 1991. Detection of

homeobox genes in development and evolution. Proc. Natl. Acad.

Sci. USA 88, 10711–10715.

Oliver, G., Vispo, M., Mailhos, A., Martinez, C., Sosa-Pineda, B.,

Fielitz, W., Ehrlich, R., 1992. Homeoboxes in flatworms. Gene 121,

337–342.

Pendelton, J., Nagai, B., Murtha, M., Ruddle, F., 1993. Expansion of

the Hox gene family and the evolution of chordates. Proc. Natl.

Acad. Sci. USA 90, 6300–6304.

Peterson, K.J., Irvine, S.Q., Cameron, R.A., Davidson, E.H., 2000.

Quantitative assessment of Hox complex expression in the indirect

development of the polychaete annelid Chaetopterus sp. Proc. Natl.

Acad. Sci. USA 97, 4487–4492.

Schierwater, B., Murtha, M., Dick, M., Ruddle, F., Buss, L., 1991.

Homeoboxes in cnidarians. J. Exp. Zool. 260, 413–416.

Schubert, F.R., Nieselt-Struwe, K., Gruss, P., 1993. The Antennape-

dia-type homeobox genes have evolved from three precursors

separated early in metazoan evolution. Proc. Natl. Acad. Sci. USA

90, 143–147.

Schummer, M., Scheurlen, I., Schaller, C., Galliot, B., 1992. HOM/

HOX homeobox genes are present in hydra (Chlorohydra viridiss-

ima) and are differentially expressed during regeneration. EMBO

11, 1815–1823.

Shenk, M., Gee, L., Steele, R., Bode, H., 1993a. Expression of Cnox-2,

a HOM/HOX gene, is suppressed during head formation in hydra.

Dev. Biol. 160, 108–118.

Shenk, M.A., Bode, H.R., Steele, R.E., 1993b. Expression of Cnox-2, a

HOM/HOX homeobox gene in hydra, is correlated with axial

pattern formation. Development 117, 657–667.

Swofford, D.L., 1999. PAUP*: phylogenetic analysis using parsimony

(* and other methods). Ver. 4 Sinauer Associates, Sunderland, MA.

Thompson, J., Higgins, D., Gibson, T., 1994. Clustal W: improving the

sensitivity of progressive multiple sequence alignment through

sequence weighting, position specific gap penalties and weight

matrix choice. Nucleic Acids Res. 22, 4673–4680.

Valentine, J., Erwin, D., Jablonski, D., 1996. Developmental evolution

of metazoan body plans: the fossil evidence. Dev. Biol. 173,

373–381.

Further reading

Miller, D., Miles, A., 1993. Homeobox genes and the zootype. Nature

365, 215–216.

Naito, M., Ishiguro, H., Fujisawa, T., Kurosawa, Y., 1993. Presence of

eight distinct homeobox-containing genes in cnidarians. FEBS

Lett. 333, 271–274.

Slack, J.M.W., Holland, P.W.H., Graham, C.F., 1993. The zootype

and the phylotypic stage. Nature 361, 490–492.