Histone Deacetylase Is Required for GA-Induced · cells increased gradually in aleurone layers, and half of the cells were dead by 6 d after GA treatment (Fig. 1A). When aleurone

Histone Deacetylase Is Required for GA-InducedProgrammed Cell Death in Maize Aleurone Layers1[OPEN]

Haoli Hou, Xueke Zheng, Hao Zhang, Mengxia Yue, Yan Hu, Hong Zhou, Qing Wang, Chengshen Xie,Pu Wang, and Lijia Li2

State Key Laboratory of Hybrid Rice, College of Life Sciences, Wuhan University, Wuhan 430072, Hubei,China

ORCID ID: 0000-0002-8774-7515 (L.L.).

Recent discoveries have shown that epigenetic regulation is an integral part of phytohormone-mediated processes. Thephytohormone gibberellin (GA) triggers a series of events in cereal aleurone cells that lead to programmed cell death (PCD), butthe signaling cascade mediating GA-induced PCD in cereal aleurone layers remains largely unknown. Here, we showed thathistone deacetylase (HDAC) activity gradually increased relative to histone acetyltransferase (HAT) activity, leading to a globaldecrease in histone H3 and H4 acetylation levels during PCD of maize (Zea mays) embryoless aleurone layers after 3 d oftreatment with GA. HDAC inhibition prevented GA-induced PCD in embryoless aleurone cells, whereas HAT inhibitionresulted in PCD even in the absence of GA. Hydrogen peroxide concentrations increased in GA- or HAT inhibitor-treatedaleurone cells due to reduced levels of reactive oxygen species scavengers. Hydrogen peroxide-treated aleurone cells showed nochanges in the activity or expression of HATs and HDACs. We show that it is possible to predict whether epigeneticmodification enzymes serve as a regulator of the GA-triggered PCD signaling pathway in maize aleurone layers. Takentogether, these findings reveal that HDAC activity is required for GA-induced PCD in maize aleurone layers and regulatesPCD via the reactive oxygen species-mediated signal transduction pathway.

Programmed cell death (PCD) is a physiological celldeath process that plays an important role in plant growthand development and in the response to environmentalstress. The cereal aleurone layer is the outermost livingcell layer of the endosperm, and themetabolism and geneexpression of cereal aleurone layers are controlled by theplant hormones gibberellin (GA) and abscisic acid (ABA)(Mozer, 1980; Kuo et al., 1996; Bethke et al., 1999). Duringseed germination, aleurone cells hydrolyze carbohydratereserves and secrete hydrolases to the inner starchy en-dosperm, which is immediately followed by PCD (Fathet al., 2000). The PCD of aleurone cells is elicited by GAthatwas secreted by the embryo of the germinated seed so

that nutrients in the aleurone layers can finally be com-pletely utilized by the developing embryo (Fath et al.,2001a; Domínguez and Cejudo, 2014). Some putativeGA-triggered PCD regulators have been identified in ce-real aleurone cells (Fath et al., 2001b). The concentration ofreactive oxygen species (ROS), including hydrogen per-oxide (H2O2), superoxide anion, and hydroxyl radicals,was increased rapidly in GA-triggered PCD in the cerealaleurone, implicating ROS in the GA-mediated develop-mental program that culminates in PCD (Schopfer et al.,2001; Fath et al., 2002; Bissenbaev et al., 2007). Cell deathhas been demonstrated to result from increased H2O2stimulated by GA in barley (Hordeum vulgare) aleuronelayers and protoplasts (Fath et al., 2002). Ca2+also plays avital role in regulating the PCD of aleurone layers (Jones,2001). The finding that treatment with the phosphataseinhibitor okadaic acid prevents the PCD of aleurone cellssuggests that protein phosphorylation is involved in aleu-rone cell death (Lovegrove and Hooley, 2000). However,the signaling pathway controlling GA-induced aleuronePCD remains largely undefined.

Eukaryotic chromatin consists ofDNAandhistones. Thehistone tails are subject to variousmodifications, includingmethylation, acetylation, phosphorylation, ubiquitination,and ADP-ribosylation (Peterson and Laniel, 2004). Amongthese chromatin-associated marks, the balance betweenhistone acetylation and deacetylation has been shown toplay an important role in regulating gene expression and isinvolved in many biological processes (Berger, 2002, 2007;Karli�c et al., 2010). Histone acetyltransferases (HATs) andhistone deacetylases (HDACs) are two key enzymes that

1 This work was supported by the National Natural Science Foun-dation of China (no. 31571265).

2 Address correspondence to [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Lijia Li ([email protected]).

H.H. designed the study and experiments, performed fluorescein/propidium iodide staining assays, western blotting, quantitative real-time PCR, and ChIP experiments, and wrote the article; X.Z. per-formed hydrogen peroxide measurements and ROS-related enzymeassays; Ha.Z., Ho.Z., and Y.H. performed HAT and HDAC activityassays; Q.W., M.Y., and C.X. performed statistical analyses; P.W.modified the article and provided administrative support; L.L. de-signed the experiments, wrote the article, and provided financial andadministrative support; all authors read and approved the final article.

[OPEN] Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.17.00953

1484 Plant Physiology�, November 2017, Vol. 175, pp. 1484–1496, www.plantphysiol.org � 2017 American Society of Plant Biologists. All Rights Reserved. www.plantphysiol.orgon July 22, 2020 - Published by Downloaded from

Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://orcid.org/0000-0002-8774-7515

http://orcid.org/0000-0002-8774-7515

http://orcid.org/0000-0002-8774-7515

http://orcid.org/0000-0002-8774-7515

http://crossmark.crossref.org/dialog/?doi=10.1104/pp.17.00953&domain=pdf&date_stamp=2017-10-24

mailto:[email protected]

http://www.plantphysiol.org

mailto:[email protected]

http://www.plantphysiol.org/cgi/doi/10.1104/pp.17.00953


are responsible for establishing andmaintaining the state ofhistone acetylation across the genome (Kuo andAllis, 1998;Strahl and Allis, 2000; Yang and Seto, 2007). Histone acet-ylation often is associatedwith gene transcription, whereashistone hypoacetylation typically marks silenced genes(Grunstein, 1997; Turner, 2000). Altered expression ofHATor HDAC genes has been linked to many regulatory pro-cesses, such as rapid responses to internal or externalsignals, changes in cell proliferation, the switch fromvegetative to reproductive growth, and PCD (Kouzarides,1999; Pawlak and Deckert, 2007).Aleurone cell death is a typical PCD process in plants,

which is thought to be an excellent model system inwhich to explore the molecular mechanisms involved inPCD (Buckner et al., 1998). In this study, we showed thatthe relative activity of HDACs to HATs was increasedin maize (Zea mays) embryoless aleurone layers aftertreatment with GA for 3 d. HDAC inhibition blockedGA-triggered PCD, whereas HAT inhibition induced thedevelopmental program of embryoless aleurones, leadingto PCD in the absence of GA, which suggests that HDACsare regulated by GA during aleurone PCD and are a nec-essary regulator in the signaling cascade of GA-initiatedPCD of the maize aleurone layer. Furthermore, we foundthat HAT inhibition induced an increase in H2O2 content,leading to the PCD of aleurone cells. In contrast, HDACinhibition did not cause the accumulation of H2O2, even inthe presence of GA, and no PCD occurred. We concludedthatGA induces PCD inmaize aleurone layers through theregulation of HDACs, followed by the ROS-mediatedsignaling pathway.

RESULTS

GA Induces PCD in the Maize EmbryolessAleurone Layers

Cereal aleurone cells have been shown to undergoPCD regulated by plant hormones (Bethke et al., 1999).During seed germination, plant aleurone layers un-dergo PCD in response to GA produced by the seedembryo, and this effect is prevented by ABA (Fath et al.,2000). In this study, we first investigated PCD in maizeembryoless aleurone layers after GA or ABA treatment.Fluorescein diacetate (FDA) is a live-cell stain that is takenup by living aleurone cells and then hydrolyzed to yieldgreen fluorescein (Schwille et al., 1999). Propidium iodide(PI) is a red fluorescent dye that accumulates rapidly indead cells and often is applied to identify dead cells in apopulation (Ergen et al., 2013). Thus, we monitored theviability and death of aleurone cells in an intact, dissectedmaize aleurone layer by FDA/PI staining. Embryolessaleurone layers were isolated from maize seeds asdescribed by Hou et al. (2015). The prepared aleuronelayers were treated with or without different reagentsand cultured for the indicated times. FDA/PI stainingshowed that the number of green (e.g. living) cells de-creased gradually,whereas the number of red (e.g. dead)cells increased gradually in aleurone layers, and half ofthe cells were dead by 6 d after GA treatment (Fig. 1A).

When aleurone layers were cultured for 9 d, almost noliving cells remained in the treated aleurones, whereasthe untreated aleurone cells were all alive (Fig. 1A). Incontrast, no dead cells were observed when aleuronelayers were treatedwith ABA for up to 9 d (SupplementalFig. S1). The number of living and dead cells at the indi-cated time points was counted and statistically analyzed(Fig. 1B). These results were similar to the PCD process ofbarley aleurone protoplasts treated with the phyto-hormone GA (Bethke et al., 1999) and the time courseof GA-induced PCD in barley aleurone layers (Fathet al., 2001a).

After aleurone layer cell PCD was characterized byFAD/PI staining, next, wewanted to identify the PCD atthemolecular level. Hexokinase inhibits PCD, and caspase-like proteins are vital marks of PCD (Kim et al., 2006). Toinvestigate how the transcription of these genes changesduring phytohormone-induced PCD, two caspase-likeprotein genes, metacaspase type II (gene identifier 100285605)and putative metacaspase (gene identifier 100191541)(Ahmad et al., 2012), and three PCD inhibition genes,hexokinase (gene identifier 100192075), fdad1 (geneidentifier 541686), and ABP9 (GenBank accession no.GU237073) (Zhang et al., 2011; Repka et al., 2015), wereselected for analysis in this study. Quantitative real-timePCR analysis revealed that the expression of two meta-caspase geneswas increased at the late stageofGA-inducedPCD, and the expression of three PCD inhibition genesincreased initially, which then decreased at the stage ofGA-induced PCD (Supplemental Fig. S2), indicating thatthese genes also may regulate aleurone cell death.

Histones Are Deacetylated during GA-Induced PCD inMaize Aleurone Layers

Previous studies have shown that epigenomes areinvolved in the PCD induced by heat stress in maize

Figure 1. Analysis of the PCD time course in maize aleurone layerstreated with GA by staining with FDA in combination with PI. A, Rep-resentative images from aleurone layers incubated with GA from 3 to9 d and visualized by epifluorescence microscopy. Live cells appeargreen, and dead cells appear red. Bar = 100 mm. B, Quantification ofviability and death in GA-treated maize aleurone layers. Control, Dis-tilled, deionized water. Each assay was repeated three times for everysample in three independent experiments. Error bars indicate the SE inthree independent experiments (n = 3). #, P, 0.05 and *, P, 0.01 versusthe control group according to Student’s t test.

Plant Physiol. Vol. 175, 2017 1485

HDACs Regulate GA-Induced Aleurone PCD

www.plantphysiol.orgon July 22, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/cgi/content/full/pp.17.00953/DC1




seedling leaves (Wang et al., 2015). To analyze whetherand how histone modification enzymes are involved inthe GA-induced PCD process of maize aleurone cells,we examined the expression and activity of histonemodification enzymes. Histone acetylation is regulatedby HATs and HDACs. Fifteen kinds of deacetylaseshave been identified in maize, including 10 RPD3/HDA1 proteins, one SIR2 protein, and four HD2 pro-teins (Demetriou et al., 2009). RPD3/HDA1 familyproteins are closely related to plant development, andHD2 family proteins are shown to be associated withplant tolerance to environmental stress in barley (Zhouet al., 2005; Demetriou et al., 2009). To determine theexpression levels of HATs andHDACs, twoHAT genes(GCN5 and HAT-B) and six HDAC genes (HDAC101,

HDAC102, HDAC103, HDAC106, HDAC108, andHDAC110)were analyzed in this study.GCN5 andHAT-Bgeneswere selected from two types of HATs (HAT-A andHAT-B), and six HDAC genes were chosen from twotypes of HDACs (RPD3-like and HD2-like). The resultsshowed that histone acetylation-related gene expressiondecreased significantly, while histone deacetylation-related gene expression remained stable, in aleuronelayers after treatment for 3 d with GA (Fig. 2A;Supplemental Fig. S3). HAT activity also decreased,whereas HDAC activity remained unchanged after GAtreatment for 3 d, leading to an increase in the relativeHDAC activity within the cell (Fig. 2B). Furthermore,to examine the relative activity of histone modificationenzymes, the histone modification state of chromatin

Figure 2. GA affected H3K9ac, H4K5ac, and H3ac protein levels in the aleurone layers. A, Transcript levels of histone acetylation-related genes. The transcript levels of all genesweremeasured by quantitative real-time PCR usingmRNA prepared fromnormal andtreated maize aleurone layers. The x axis indicates time, and the y axis indicates relative expression values. The relative expressionvalue of the control group (3 d) was defined as 1. The ubiquitin gene was used as an internal control. B, HAT and HDAC enzymeactivities after histone modification enzyme inhibitor treatment in aleurone layers. C, Antibodies specific to H3K9ac, H4K5ac, andH3ac were employed to analyze histone extracts from aleurone layers treated with or without GA for 3, 5, 7, and 9 d. Control,Distilled, deionized water; C, control; G, GA. Quantitative analysis of western blotting was performed using ImageJ. Each assay wasrepeated three times for every sample in three independent experiments. Error bars represent SE (n = 3). #, P, 0.05 and *, P, 0.01versus the control group according to Student’s t test.

1486 Plant Physiol. Vol. 175, 2017

Hou et al.




was detected by western blotting using antibodiesagainst H3K9ac, H4K5ac, and H3ac, which are threeeuchromatin markers. The results showed that thetotal levels of histone H3K9, H4K5, and H3 acetylationdecreased significantly during the PCD process afterGA treatment for 3 d (Fig. 2C). These results suggestedthat HDAC or histone deacetylation was involved inthe GA-induced PCD process of maize aleurones.

Histone acetylation-related gene expression remainedstable, while histone deacetylation-related gene ex-pression decreased significantly, in ABA-treated al-eurone layers (Supplemental Fig. S4A). After ABAtreatment, the relative HAT activity was increased,accompanied by elevated total levels of histone H3K9,H4K5, and H3 acetylation (Supplemental Fig. S4,B and C).

Figure 3. Time course of PCD in maize aleurone layers determined by staining with FDA and PI. A, Representative images fromaleurone layers incubated in histone deacetylation inhibitors (TSA), HAT inhibitors (C646), TSA + GA, and C646 + ABA from 3 to9 d and visualized by epifluorescence microscopy. Live cells appear green, and dead cells appear red. Bar = 100 mm. B,Quantification of viability and death in different treated maize aleurone layers. C, Histone acetylation inhibitors affect H3K9ac,H4K5ac, and H3ac protein levels in the aleurone layers. Antibodies specific to H3K9ac, H4K5ac, and H3ac were employed toanalyze histone extracts from aleurone layers treated with or without histone acetylation inhibitors for 3, 5, 7, and 9 d. Control,1 mM dimethyl sulfoxide (DMSO); C, control; T, TSA; GT, GA + TSA; C-, C648; AC, ABA + C656. Each assay was repeated threetimes for every sample in three independent experiments. Error bars represent SE (n = 3). #, P , 0.05 and *, P , 0.01 versus thecontrol group according to Student’s t test.

Figure 4. Concentration of ROS-relatedmolecules and enzyme activities afterGA treatment in aleurone layers. Eachassay was repeated three times for everysample in three independent experi-ments. Control, Distilled, deionizedwater; FW, fresh weight. Error bars repre-sent SE (n = 3). #, P, 0.05 and *, P, 0.01versus the control group according toStudent’s t test.








Figure 5. Time course of PCD in maize aleuronelayers treated with H2O2 or H2O2 plus TSA or ABAdetermined by staining with FDA and PI. A, Repre-sentative images from aleurone layers incubated withH2O2, H2O2 + TSA, andH2O2 + ABA from 3 to 9 d andvisualized by epifluorescence microscopy. Live cellsappear green, and dead cells appear red. Bar = 100mm.B, Quantification of viability and death in differenttreated maize aleurone layers. Control, 1 mM DMSO.Each assaywas repeated three times for every sample inthree independent experiments. Error bars represent SE(n = 3). *, P, 0.01 versus the control group accordingto Student’s t test.

Figure 6. A, Transcript levels of histone modification-related enzyme genes after treatment with H2O2. The transcriptlevels of all genes were measured by quantitative real-time PCR using mRNA prepared from normal and H2O2-treatedmaize aleurone layers. The x axis indicates time, and the y axis indicates relative expression values. The relative expressionvalue of the control group (3 d) was defined as 1. The ubiquitin gene was used as an internal control. B, H2O2 did not affectH3K9ac, H4K5ac, and H3ac protein levels in the aleurone layers. Antibodies specific to H3K9ac, H4K5ac, and H3ac wereemployed to analyze histone extracts from aleurone layers treated with or without H2O2 for 3, 5, 7, and 9 d. Control,Distilled, deionized water; C, control; H, H2O2. Quantitative analysis of western blotting was performed usingImageJ. Error bars represent SE (n = 3). No significant differences was observed, as compared with the Control groupaccording to Student’s t test.


Hou et al.



HDACs Regulate the PCD Process of MaizeAleurone Layers

Histone acetylation/deacetylation is important forboth animal and plant physiology and development(Marks et al., 2001; Shahbazian and Grunstein, 2007).Trichostatin A (TSA), CUDC-101, C646, and anacardicacid (AA) are four widely used epigenetic enzyme in-hibitors with clear functional mechanisms (Wang et al.,2016). To investigate how these epigenetic enzymesaffected the hormone-induced PCD process in maizealeurone layers, we further treated maize aleuronelayers with the HDAC inhibitor TSA and the HATinhibitor C646. Almost all cells were still alive aftertreatment with TSA for up to 9 d, even in the presenceof GA (Fig. 3, A and B). In contrast, the cells in C646-treated aleurone layers started to die after 5 d, and allcells died after 8 d of incubation. Even ABA could notprevent PCD induced by C646 (Fig. 3, A and B). Wealso performed western blotting using antibodies againstH3K9ac, H4K5ac, and H3ac. As expected, the total levelsof histone H3K9, H4K5, and H3 acetylation increasedsignificantly after treatment with TSA or TSA plus GA(Fig. 3C). However, the total levels of histone H3K9,H4K5, and H3 acetylation remained lower in live cellstreated with C646 or C646 plus ABA (Fig. 3C). Theseresults indicated that histone deacetylase is necessaryfor the GA-mediated PCD process of maize aleuronelayers. To exclude the possibility that drug treatmentnonspecifically induced PCD, we treated maize seed-lings with another histone deacetylase inhibitor, CUDC-101, and another HAT inhibitor, AA, and observed thesame effects (Supplemental Fig. S5). C646 or AA treat-ment decreased HAT activity but had no effect onHDAC activity, similar to GA treatment (SupplementalFig. S6). In contrast, HDAC activity was decreased,whereas HAT activity remained unchanged, after TSA,CUDC-101, or ABA treatment (Supplemental Fig. S6).We also found that treatment with DMSO or watershowed no difference in gene expression levels and en-zyme activity (Supplemental Fig. S7).

HDAC Is Located Upstream of the ROS Signaling in theGA-Mediated PCD Pathway

ROS such as H2O2 have been demonstrated to be keyplayers in stress and PCD signaling pathways (Wanget al., 2015). Thus, we measured the concentrations ofH2O2 and the activities of ROS-related enzymes, in-cluding superoxide dismutase (SOD), peroxidase (POD),and catalase (CAT), in maize aleurone layers during theGA-induced PCD process. The results showed that H2O2accumulated and remained at a high level during theGA-induced PCD process, whereas H2O2 levels remainedrelatively low in the live cells of the untreated maize al-eurone layers (Fig. 4). GA-treated maize aleurone layersshowed increased SOD activity and decreased CAT andPOD activity during PCD (Fig. 4). Because SOD is re-sponsible for producing H2O2, while POD and CAT cat-alyze the decomposition of H2O2, our results indicated

that GA initiated the PCD process in maize aleuronelayers by modulating ROS-related enzymes to produceH2O2. We also examined cell death and viability in H2O2-treated maize aleurone layers. H2O2-treated aleuronecells showed a decrease in the number of living cellsand an increase in the number of dead cells (Fig. 5A).The extent of cell death at several time points wasquantified by counting the number of living and deadcells. Virtually all cells in the H2O2-treated aleuronelayers died after 8 d of incubation (Fig. 5B). Treatmentwith ROS scavengers (thiourea or butyl hydroxyanisole)plus GA can delay the PCD process in aleurone layers,showing that H2O2 also is necessary for aleurone PCD(Supplemental Fig. S8). These results indicated that ROSand ROS-related enzymes regulated the PCD process ofmaize aleurone layers.

As described above, histone modification enzyme in-hibitors and H2O2 both affected the GA-mediated PCDprocess of maize aleurone layers; hence, we decided toexplore their effects on a series of events triggered byGA. Interestingly, when aleurone layers were treatedsimultaneously with H2O2 and epigenetic enzyme in-hibitors, the number of living cells decreased and thenumber of dead cells increased, as with treatment withH2O2 alone, regardless of HDAC or HAT inhibition(Fig. 5). We further measured the concentrations ofROS and the activities of the aforementioned ROS-related enzymes in maize aleurone layers treatedwith histone modification enzyme inhibitors duringthe PCD process. Our results showed an increase in

Figure 7. Quantitative real-time PCR analysis of ROS-related genes atdifferent time points in maize aleurone layers during the PCD processwith or without GA. The relative expression value of the control group(3 d) was defined as 1. The ubiquitin gene was used as an internalcontrol. Control, Distilled, deionized water. Each assay was repeatedthree times for every sample in three independent experiments. Errorbars represent SE (n = 3). #, P , 0.05 and *, P , 0.01 versus the controlgroup according to Student’s t test.











SOD activity and a decrease in CAT and POD activityin dissected aleurone layers treated with HAT in-hibitors (C646 or AA; Supplemental Fig. S9). H2O2also accumulated and remained elevated as a resultof the high level of histone acetylation after HATinhibitor (C646 or AA) treatment during the PCDprocess, whereas H2O2 levels remained relatively lowin the live aleurone layers after HDAC inhibitor (TSAor CUDC-101) treatment (Supplemental Fig. S9).Meanwhile, we monitored cell death and viability inaleurone cells in maize aleurone layers treated withH2O2 plus HDAC inhibitor (TSA or CUDC-101) orABA. Aleurone cells showed a decrease in the num-ber of living cells and an increase in the number ofdead cells, just as with H2O2 alone, although HDACinhibition and ABA each inhibited cell death in maizealeurone layers (Fig. 5; Supplemental Fig. S10, A andB). Quantitative real-time PCR analysis revealed thatthe expression of eight histone-modifying enzymegenes was not changed after H2O2 treatment (Fig.6A). Western blotting showed that the total acetyla-tion levels of histones H3K9, H4K5, and H3 wereunchanged under H2O2 treatment (Fig. 6B). These

data showed that histone deacetylase regulated theGA-mediated PCD by modulating ROS production.

GA Regulates the PCD Process in Maize AleuroneLayers via HDAC-Mediated Changes in ROS-RelatedGene Expression

HATs/HDACs have been shown to regulate geneexpression by being recruited to target genes and al-tering histone acetylation (Kurdistani and Grunstein,2003; Minucci and Pelicci, 2006). In plants, a number ofROS-related genes were found to be involved in theregulation of PCD (Wang et al., 2009), and our previ-ous results showed that histone acetylation was in-volved in GA-regulated sodCp gene expression inmaize aleurone layers during 3 d of germination (Houet al., 2015). First, we analyzed the expression of thesegenes during the GA-regulated PCD in maize aleu-rones. Dissected aleurone layers were cultured with orwithout GA, and RNAwas then prepared at each timepoint. Quantitative real-time PCR results indicated thatsodCp gene expression was up-regulated, whereas theCat-1 and Pod genes were down-regulated, in GA-treated

Figure 8. Chromatin immunoprecipitation (ChIP) results of sodCp. A, H3ac and H4K5ac levels in the promoter regions (sets A–E)and the exon (set F) of the sodCp gene after GA treatment in maize aleurone layers during the PCD process. The x axis indicatestime, and the y axis indicates relative expression values. The relative expression value of the control group (set A) was defined as 1.The ubiquitin gene was used as an internal control. B, Schematic representation of the sodCp gene from 22,802 to +242 bp.Control, Distilled, deionizedwater. Each assay was repeated three times for every sample in three independent experiments. Errorbars represent SE (n = 3). #, P , 0.05 and *, P , 0.01 versus the control group according to Student’s t test.


Hou et al.







maize aleurone layers from 3 to 9 d (Fig. 7). Next, weperformed chromatin immunoprecipitation to com-pare H4K5 and H3 acetylation levels at the promoterregions of these ROS-related genes in aleurone layerswith or without GA treatment. Our results showedthat hyperacetylation occurred in the promoter re-gions (regions A, D, and E) and the first exon (region F)of the sodCp gene in GA-treated aleurone layers. How-ever, therewas no significant decrease in regions B andCafter GA treatment compared with untreated aleuronelayers (Fig. 8A). GA-treated aleurone layers showedrelatively low acetylation in the promoter regions and anexon region of the Cat-1 gene, corresponding to the re-duced expression of this gene (Fig. 9A).

DISCUSSION

HDACs Are Necessary for Inducing the GA-Initiated PCD ofMaize Aleurone Layers

Cereal aleurone cells are known to undergo PCDinitiated by the phytohormone GA during seed ger-mination. The embryos of germinated grains produce

GA, and GA is transferred to aleurone cells, which donot synthesize GA themselves. GA has been reportedto promote cell death in barley aleurone protoplastsand aleurone layers (Bethke et al., 1999). Phytohormoneshave been shown to regulate plant growth and devel-opment, as well as responses to exogenous stress, bymediating epigenetic processes (Chinnusamy et al.,2008). Many studies have indicated that the epigenomeis involved in many cellular functions. HDAC inhibi-tors induce growth arrest, cell differentiation, and cellapoptosis, while HAT inhibitors also have been shownto inhibit proliferation and induce apoptosis in cancercells (Marks et al., 2000, 2001; Landreville et al., 2012).Simultaneous FDA and PI staining showed that maizeembryoless aleurone cells underwent PCD induced byGA, which was characterized by the up-regulation ofPCD-related gene expression. Following GA treat-ment, a rapid increase in the relative activity of HDACsoccurs during the developmental stage at which cellsshow typical, apoptosis-like morphological features,suggesting that GA elevated the relative activity ofHDACs by inhibiting HATs, leading to global deace-tylation of histones H3 and H4, and that HDACs were

Figure 9. ChIP results of Cat-1. A, H3ac and H4K5ac levels in the promoter regions (sets A–E) and the exon (set F) of the Cat-1gene after GA treatment in maize aleurone layers during the PCD process. The x axis indicates time, and the y axis indicatesrelative expression values. The relative expression value of the control group (set A) was defined as 1. The ubiquitin genewas usedas an internal control. B, Schematic representation of theCat-1 gene from22,245 to +258 bp. Control, Distilled, deionizedwater.Each assay was repeated three times for every sample in three independent experiments. Error bars represent SE (n = 3). #, P, 0.05and *, P , 0.01 versus the control group according to Student’s t test.





involved in the GA-triggered PCD of aleurone layers.In the presence of HDAC inhibitors, aleurone cell deathwas blocked, and the lifespan of the cells was extended.

The ability of HAT inhibition to induce aleuronecell death in the absence of GAwas due to a change inthe HDAC/HAT balance, which led to higher HDACactivity relative to HAT activity, as confirmed by globaldeacetylation of the genome. Collectively, these data in-dicated that HDACswere required for GA to induce PCDin aleurone layers. Maize HDACs included 10 maizeRPD3/HDA1 genes, one SIR2 gene, and four HD2-likegenes (Demetriou et al., 2009). RPD3-type HDAC ex-pression is required for plant development, and HD2genes were found to be associated with plant resistance toplant biotic and abiotic stress (Zhou et al., 2005). Thus,precisely which of the multiple HDACs is involved needsto be investigated in the future. Similarly, HDACs havebeen shown to act as a positive signaling molecule thatselectively mediates cold-responsive gene expression inplants (Miura and Furumoto, 2013). In fact, the balance ofhistone acetylation and deacetylation plays a critical rolein regulating gene expression, and the altered expressionof HDAC genes has been linked to tumor development(Ropero and Esteller, 2007). Global histone deacetylation

is always associated with the condensed chromatin that isa cytological feature of PCD. Thus, reduced acetyla-tion might be implicated in the cytological changes ofaleurone cell death. DNA methylation and histonemonoubiquitination have been shown to play an im-portant role in regulating PCD in tapetum (Solís et al.,2014; Cao et al., 2015).

HDACs Cause PCD of Maize Aleurone Layers byIncreasing the Content of H2O2 in Aleurone Cells

H2O2 has been suggested to act as a signal moleculein regulating PCD in aleurone cells (Gechev and Hille,2005). Epigenetic modifications occur in response toexogenous oxidative stress, and thus, it is also likely thatROS, as signalingmolecules, are implicated in epigeneticmodulation (Rahman and Adcock, 2006; Franco et al.,2008). However, ABA and HDAC inhibition preventedan increase in H2O2 concentrations, whereas GA andHAT inhibition provoked epigenetic modification changesand elevated H2O2, suggesting that histone acetylation/deacetylation regulated the expression of ROS-relatedgenes, resulting in changes in H2O2 levels. Several en-zymatic systems may contribute to this overproductionof H2O2. In contrast, the addition of H2O2 induced PCDin aleurone layers in the absence of GA and regardless ofHDAC or HAT inhibition, which indicated that HDACsare located upstream of H2O2 in the GA-triggered sig-naling cascade. The epigenomealso has been shown toplaya role in heat stress-induced apoptosis by inducing ROSproduction (Brunet et al., 2004). Cat-1 gene transcription

Table I. Primers used for quantitative real-time PCR

Primer Sequence (59–39) Efficiency

ZmUbiquitin ATCTTTGTGAAGACCCTCAC 98%CCTAAGGCGCAGCACCAAGT

Hexokinase AATGCCGAGGACCGTAGTTG 101%GTCATCAACTACCTGGGCAC

MetacaspasetypeII

GGCATCAACTACCTGGGCAC 98%GCCAACATCCGGCTGGAGCT

Putativemetacaspase

CTCCTCTTCTTCCACTACAG 96%GGCTGTCTCTTTACCATAGT

GCN5 GGACGGCTGAAGTTTCTCTG 97%GCTTGCATAAGGGCGATAAG

HAT-B CAGCTGACCTGATGGAGACT 96%TTGGCATCTGCAACAGACGC

HDAC101 GCCATACTCGAGCTGCTCAA 102%TAGAGGGACATTCAGGGAGT

HDAC102 TCATTGGCGAGGGATCGTTT 99%TCTCATTTGGGAGTTCTGTG

HDAC106 AGATAGTTCCGATGAAGAGC 104%GAGTCATCTTCCTCAGACAT

HDAC108 GCTTTAACGTCGGTGAGGAC 96%GGCGAGGACGATGTCGTTGA

ZmsodCp ATAACAACGCAGCACAGGTG 101%CGTGCTCCCACAAGTCTAGG

ZmCat-1 GAACAACTTCAAGCAGCCCG 98%CGTTCAGTTCAGCGAGCAAA

Figure 10. Model for the role of local histone acetylation in ROSsignaling in maize aleurone cells during PCD.


Hou et al.



was down-regulated because of hypoacetylation of thepromoters. Our previous ChIP data showed a higheracetylation level of H3K9 and H4K5 at the promoterregions of the sodCp gene in aleurone layers treatedwith GA for 24 and 48 h, which is associated with thehigh transcription level of the sodCp gene in aleuronelayers during seed germination or in GA-treated al-eurone layers (Hou et al., 2015). Histone acetylationlevels started to decrease after treatment with GA for3 d due to a gradual increase in relative HDAC/HATactivity, but the acetylation level of the sodCp genedecreased slightly after GA treatment, and the sodCpgene expression level still was higher.Actually, dual functions of HDACs have been re-

ported in plants and animals (Robert et al., 2004; Tanakaet al., 2008). HDACs have been demonstrated to repressgene expression by the removal of acetyl groups fromhistones (Peterson and Laniel, 2004). However, recentstudies have identified genes that also need HDACs forefficient activation via different mechanisms. For exam-ple, HDACs may induce proinflammatory gene ex-pression by enabling transcription factor recruitment(Bode et al., 2007). HDACs regulate cold-tolerance geneexpression by preventing the binding of transcriptionalrepressors (Zhu et al., 2008). Rpd3p up-regulatestelomeric genes in yeast through the deacetylation ofhistones that inhibited the binding of SIR repressors(Robert et al., 2004). Thus, based on these data andprevious results, we propose a model of HDAC functionas shown in Figure 10. HDACs are integral regulators ofGA-induced PCD in maize aleurone layers, wherein GA

first induces the relative activity of HDACs/HATsthrough an unknownmechanism,which then activates orsuppresses the expression of downstream ROS-relatedgenes that, in turn, regulate H2O2 production (Houet al., 2015). H2O2 might regulate the induction of thetranscription factor GAMyb and then promote theexpression of the a-amylase gene (Ishibashi et al., 2012)and PCD of aleurone cells (Guo and David, 2008).There exists another GA signaling pathway that acti-vates GAMyb through the degradation of a repressorSLN1 (Guo and David, 2008; Aoki et al., 2014).

CONCLUSION

The main goal of this work was to analyze thepossible relationship between the epigenome andPCD in aleurone layers. For this purpose, the dy-namics of the epigenome during the PCD of aleuronelayers was characterized by a multidisciplinary ap-proach. The results showed that the relative activity ofHDACs was increased in GA-treated aleurone cells,leading to PCD. HDAC inhibition suppressed the in-duction of PCD in the presence ofGA,whereas embryolessaleurone layers underwent PCD followingHAT inhibition,which resulted in the deacetylation of chromatin. Fur-thermore, treating dissected aleurones with GA or HATinhibitors increased H2O2 levels, whereas exogenous H2O2did not affect HAT or HDAC expression. These dataidentified HDACs as key players that lie between GAand H2O2 in the GA-mediated signal transduction cas-cade leading to PCD in maize aleurone layers (Fig. 10).

MATERIALS AND METHODS

Plant Materials and Chemicals

Seedlings of the maize (Zea mays) hybrid line Huayu5 were grown onMurashige and Skoogmedium under controlled conditions: 25°C, dark regime,and 70% humidity. Embryoless aleurone layers were isolated from intact maizeseeds as described by Hou et al. (2015). TSA, CUDC-101, C646, and AA are fourwidely used epigenetic enzyme inhibitors with clear functional mechanisms,which were produced by Selleck Chemicals. TSA is an HDAC inhibitor (purity,99.03%). CUDC-101 is a specific inhibitor of the type I and type II HDAC familythat cannot inhibit the third class of HDACs. CUDC-101 also has a weak in-hibitory activity against other protein kinases, including KDR/VEGFR2, Lyn,Lck, Abl-1, FGFR-2, Flt-3, and Ret (purity, 99.36%; Wang et al., 2016). C646 is aHAT inhibitor that can lower histone H3 and H4 acetylation levels in cells andalso can abolish TSA-induced acetylation (purity, 99.66%; Kurita et al., 2017).AA is found to be a HAT inhibitor (purity, 99.36%; Sukumari-Ramesh et al.,2011). These inhibitors were dissolved in DMSO to a concentration of 1 mM.Thiourea and butyl hydroxyanisole are two ROS scavengers. Isolated aleuronelayers were collected and processed in various assays. Aleurone layers weretreated with distilled water or DMSO and different reagents: 100 mM GA, 10 mM

ABA, 10 mM TSA, 10 mM CUDC-101, 10 mM C646, 10 mM AA, and 10 mM H2O2.Since H2O2 is not stable and will decompose instantly, the separated aleuronelayers were treated in gauze soaked with 10 mM H2O2 and the aleurone layerswere transferred to a new gauze with 10 mM H2O2 every day.

FDA/PI Staining

Aleurone layers were washed with phosphate buffer (0.04575 mol L21

Na2HPO4 and 0.00425 mol L21 NaH2PO4, pH 7.8) and mounted on microscopeslides. Cell death and viability in maize aleurone layers were determined by

Table II. Primers used for ChIP

Primer Sequence (59–39) Efficiency

ZmsodCp Set A AGCCCCTCTCATGGATCTGT 101%ACCCAGAGGGGAATGCCATA

ZmsodCp Set B TCCATGCATGCAGCTAACCT 99%CTTGGATCCACCGACACCTC

ZmsodCp Set C TCGAGAGCTAGCGGGTGATA 102%AGTTTTTCGACGGCGTTTGG

ZmsodCp Set D CCTAGAAACCAAACACCCCCT 97%AGGACAGGTACAACCGTACA

ZmsodCp Set E CCTGCAATAATCAGTGTCGCC 96%CGAGCTACATGCTTGGTCGT

ZmsodCp Set F ATAACAACGCAGCACAGGTG 101%CGTGCTCCCACAAGTCTAGG

ZmCat-1 Set A CGAGATCAGGACCATCTGGC 98%TCCGGCCATTGCACATGTAT

ZmCat-1 Set B ATACATGTGCAATGGCCGGA 97%CGCCATTTTGATGGCCCAAA

ZmCat-1 Set C CTGAACGAGCTGCACTCTGA 96%AGAGCTTGTCCGGCCATTG

ZmCat-1 Set D CCAATACATGTGCAATGGCCG 101%ACAGATGCGCTGCTGATGTA

ZmCat-1 Set E CTGTCTGCTTTCGCTCATGC 99%CAGAGCTTGTCCGGCCATTG

ZmCat-1 Set F GGACCATCTGGCTCTCCAAC 97%TCCGGCCATTGCACATGTATT

ZmUbiquitin ATCTTTGTGAAGACCCTCAC 98%CCTAAGGCGCAGCACCAAGT





simultaneous staining with FDA (100 mgmL21) and PI (60 mgmL21) for 15 min.Aleurone cells were observed on an Olympus BX-60 fluorescence microscope,and fluorescence images were capturedwith a Sensys 1401Emonochrome CCDcamera using MetaMorph 4.6.3 software (Universal Imaging). Randomly se-lected fields from at least three different aleurone layers were counted pertreatment to determine the percentage of live cells.

Antibodies

Avarietyof antibodieswereused forwesternblotting.Anti-H3K9ac (07-352),anti-H4K5ac (07-327), and anti-H3ac (06-599) antibodies were produced byMillipore. Anti-H3 (ab1791) and AP-conjugated goat anti-rabbit IgG (A4187)antibodies were produced by Abcam. Anti-H3ac antibody recognizes histoneH3 acetylation at the N terminus, anti-H3K9ac antibody recognizes histone H3acetylatedonLys-9, andanti-H4K5ac antibody recognizes histoneH4acetylatedon Lys-5. These antibodies have been shown to work for ChIP using chromatinfrom different cells.

Western Blotting

Proteins were isolated by grinding maize aleurone layers in liquid nitrogenand resuspended in extraction buffer (100 mM Tris-HCl, pH 7.4, 50 mM NaCl,5 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride). The supernatant aftercentrifugation was collected for the experiment. Western blotting was carriedout as described previously (Nieswandt et al., 2000). Histone H3 was used asa loading control. Three independent experiments were performed for eachsample.

Quantitative Real-Time PCR

According to the reported amplification condition and method (Hou et al.,2015), quantitative real-time PCR of total RNA isolated from aleurone layersamples was carried out using the SYBR Green Real-Time PCR Master Mix(Toyobo) on a StepOne Plus real-time PCR system (Applied Biosystems).Relative expression levels were normalized to the maize ubiquitin gene.Quantitative real-time PCR primers that were designed to amplify fragmentsof ;200 bp are listed in Table I. Real-time PCR was repeated three times foreach sample in three independent experiments.

HAT and HDAC Activity Assay

The nuclei were isolated using a nuclear extraction kit (Epigenetic; basecatalog no. 00021). HAT activity was determined using the HAT ActivityColorimetric Assay Kit (BioVision; catalog no. K332-100). The nuclear extractsisolated from aleurone layers were assayed on a 96-well plate. For backgroundreading, add 10 mL of water into the sample instead of HAT substrates I and II;for a positive control, add 10 mL of the cell nuclear extract and 30 mL of water.Add assay mix to each well to start the reaction. Plates were incubated at 37°Cfor 1 to 4 h depending on the color development, and the absorbance was readon a microplate reader at 440 nm. HDAC activity was determined using theEpiQuik HDAC Activity/Inhibition Assay Kit (Epigenetic; base catalog no.P-4002). Nuclear extracts were added to each strip well, except the wells for thecontrol and blank. Strip wells were mixed, covered, and incubated at 37°C for45 to 60 min. For the control and standard curves, add HDAC assay bufferinstead of nuclear extract. For HDAC inhibition, add different amounts of in-hibitors. For the blank, add HDAC assay buffer into the blank wells. The cap-ture antibody was added to each strip well and incubated at room temperaturefor 60 min. Then the detection antibody was added to each strip well and in-cubated at room temperature for 25 to 30 min. The absorbance could be read ona microplate reader at 450 nm within 2 to 15 min.

H2O2 Measurements

H2O2 concentrations were measured according to the method described bySchumbet al. (1955). Briefly, crude extracts fromaleurone layerswere extractedwithacetone and reactedwith 5% (w/v) titanium sulfate to form ayellowprecipitate thatthen was dissolved in H2SO4. Finally, extracts were analyzed at 415 nm.

ROS-Related Enzyme Assays

Aleurone layers were mixed with quartz sand and precooled phosphatebuffer (0.04575 mol L21 Na2HPO4 and 0.00425 mol L21 NaH2PO4, pH 7.8) and

then homogenized on ice and centrifuged at 4°C and 12,000g for 20 min. Thesupernatant enzyme solution was used for the following experiments.

SOD was assayed according to the method reported by Beauchamp andFridovich (1971). POD was measured using a published procedure (Gajewskaand Skłodowska, 2007). CAT assays were carried out following the reportedmethod (Chance and Maehly, 1955).

ChIP-PCR

ChIP-PCR of the promoter region (regions A–E) and the exon region of thesodCp gene and the Cat-1 gene was carried out using H3ac and H4K5ac anti-bodies following the procedure reported by Zhang et al. (2011) andHaring et al.(2007). The primer sets used in this test are listed in Table II. A negative controlwas performed using rabbit serum for mock immunoprecipitation. Briefly, al-eurone layers were ground into powder in liquid nitrogen. Chromatin afterdigestion with 50 units of micrococcal nuclease was combined with salmonsperm DNA/protein A agarose (Upstate) and then incubated with H3ac andH4K5ac antibodies overnight at 4°C. Chromatin-antibody complexes werecollected on protein A agarose beads (Upstate), and then chromatin was elutedand reverse cross-linked. DNAwas recovered by phenol/chloroform extractionand ethanol precipitation. Purified DNA was used for quantitative real-timePCR as described above.

Accession Numbers

Sequence data from this article can be found in the GenBank/EMBL datalibraries under accession numbers metacaspase type II (Gene identifier100285605); putative metacaspase (Gene identifier 100191541); hexokinase(Gene identifier 100192075); fdad1 (Gene identifier 541686); ABP9 (Genebankassession no. GU237073).

Supplemental Data

The following supplemental materials are available.

Supplemental Figure S1. Analysis of the PCD time course in maize aleu-rone layers treated with ABA.

Supplemental Figure S2. Transcript levels of PCD-related genes.

Supplemental Figure S3. Transcript levels of histone acetylation-relatedgenes at 5 d.

Supplemental Figure S4. H3K9ac, H4K5ac, and H3ac protein levels in thealeurone layers after ABA treatment.

Supplemental Figure S5. Time course of PCD in maize aleurone layerstreated with CUDC-101 or AA plus GA or ABA determined by stainingwith FDA and PI.

Supplemental Figure S6. HAT and HDAC enzyme activities after treat-ment in aleurone layers.

Supplemental Figure S7. Gene expression levels and enzyme activity aftertreatment with DMSO or ddH2O.

Supplemental Figure S8. Time course of PCD in maize aleurone layersincubated with GA or ROS scavengers plus GA determined by stainingwith FDA and PI.

Supplemental Figure S9. Concentration of ROS-related molecules and en-zyme activities after histone modification enzyme inhibitor treatment inaleurone layers.

Supplemental Figure S10. Time course of PCD in maize aleurone layersincubated with CUDC-101 or CUDC-101 plus H2O2 determined bystaining with FDA and PI.

ACKNOWLEDGMENTS

We thank Huan Wen, Fei Gao, and Ningjie Ma for helpful discussions; wealso thank the reviewers for their suggestions and constructive remarks.

Received July 14, 2017; accepted September 27, 2017; published September 29,2017.


Hou et al.













LITERATURE CITED

Ahmad R, Zuily-Fodil Y, Passaquet C, Bethenod O, Roche R, Repellin A(2012) Ozone and aging up-regulate type II metacaspase gene expres-sion and global metacaspase activity in the leaves of field-grown maize(Zea mays L.) Chemosphere 87: 789–795.

Aoki N, Ishibashi Y, Kai K, Tomokiyo R, Yuasa T, Iwaya-Inoue M (2014)Programmed cell death in barley aleurone cells is not directly stimulatedby reactive oxygen species produced in response to gibberellin. J PlantPhysiol 171: 615–618

Beauchamp C, Fridovich I (1971) Superoxide dismutase: improved assaysand an assay applicable to acrylamide gels. Anal Biochem 44: 276–287

Berger SL (2002) Histone modifications in transcriptional regulation. CurrOpin Genet Dev 12: 142–148

Berger SL (2007) The complex language of chromatin regulation duringtranscription. Nature 447: 407–412

Bethke PC, Lonsdale JE, Fath A, Jones RL (1999) Hormonally regulatedprogrammed cell death in barley aleurone cells. Plant Cell 11: 1033–1046

Bissenbaev AK, Altybaeva NA, Kolbaeva GA (2007) Role of reactiveoxygen species and antioxidant enzymes in hormone regulating pro-grammed cell death of wheat aleurone layer. J Cell Mol Biol 6: 41–48

Bode KA, Schroder K, Hume DA, Ravasi T, Heeg K, Sweet MJ, DalpkeAH (2007) Histone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflammatory gene expression by impairingtranscription factor recruitment. Immunology 122: 596–606

Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H,Ross SE, Mostoslavsky R, Cohen HY, et al (2004) Stress-dependentregulation of FOXO transcription factors by the SIRT1 deacetylase.Science 303: 2011–2015

Buckner B, Janick-Buckner D, Gray J, Johal GS (1998) Cell-death mech-anisms in maize. Trends Plant Sci 3: 218–223

Cao H, Li X, Wang Z, Ding M, Sun Y, Dong F, Chen F, Liu L, Doughty J, Li Y,et al (2015) Histone H2B monoubiquitination mediated by HISTONEMONOUBIQUITINATION1 and HISTONE MONOUBIQUITINATION2is involved in anther development by regulating tapetum degradation-related genes in rice. Plant Physiol 168: 1389–1405

Chance B, Maehly A (1955) Assay of catalases and peroxidases. MethodsEnzymol 2: 764–775

Chinnusamy V, Gong Z, Zhu JK (2008) Abscisic acid-mediated epigeneticprocesses in plant development and stress responses. J Integr Plant Biol50: 1187–1195

Demetriou K, Kapazoglou A, Tondelli A, Francia E, Stanca MA, BladenopoulosK, Tsaftaris AS (2009) Epigenetic chromatin modifiers in barley: I. Cloning,mapping and expression analysis of the plant specific HD2 family of histonedeacetylases from barley, during seed development and after hormonal treat-ment. Physiol Plantarum 136: 358–368

Domínguez F, Cejudo FJ (2014) Programmed cell death (PCD): an essentialprocess of cereal seed development and germination. Front Plant Sci 5: 366

Ergen AV, Jeong M, Lin KK, Challen GA, Goodell MA (2013) Isolationand characterization of mouse side population cells. Methods Mol Biol946: 151–162

Fath A, Bethke P, Beligni V, Jones R (2002) Active oxygen and cell death incereal aleurone cells. J Exp Bot 53: 1273–1282

Fath A, Bethke P, Lonsdale J, Meza-Romero R, Jones R (2000) Pro-grammed cell death in cereal aleurone. Plant Mol Biol 44: 255–266

Fath A, Bethke PC, Belligni MV, Spiegel YN, Jones RL (2001a) Signallingin the cereal aleurone: hormones, reactive oxygen and cell death. NewPhytol 151: 99–107

Fath A, Bethke PC, Jones RL (2001b) Enzymes that scavenge reactiveoxygen species are down-regulated prior to gibberellic acid-inducedprogrammed cell death in barley aleurone. Plant Physiol 126: 156–166

Franco R, Schoneveld O, Georgakilas AG, Panayiotidis MI (2008)Oxidative stress, DNA methylation and carcinogenesis. Cancer Lett266: 6–11

Gajewska E, Skłodowska M (2007) Effect of nickel on ROS content andantioxidative enzyme activities in wheat leaves. Biometals 20: 27–36

Gechev TS, Hille J (2005) Hydrogen peroxide as a signal controlling plantprogrammed cell death. J Cell Biol 168: 17–20

Grunstein M (1997) Histone acetylation in chromatin structure and tran-scription. Nature 389: 349–352

Guo WJ, Ho T-HD (2008) An abscisic acid-induced protein, HVA22, in-hibits gibberellin-mediated programmed cell death in cereal aleuronecells. Plant physiol 147: 1710–1722

Haring M, Offermann S, Danker T, Horst I, Peterhansel C, Stam M (2007)Chromatin immunoprecipitation: optimization, quantitative analysisand data normalization. Plant Methods 3: 11

Hou H, Wang P, Zhang H, Wen H, Gao F, Ma N, Wang Q, Li L (2015)Histone acetylation is involved in gibberellin-regulated sodCp geneexpression in maize aleurone layers. Plant Cell Physiol 56: 2139–2149

Ishibashi Y, Tawaratsumida T, Kondo K, Kasa S, Sakamoto M, Aoki N,Zheng SH, Yuasa T, Iwaya-Inoue M (2012) Reactive oxygen species areinvolved in gibberellin/abscisic acid signaling in barley aleurone cells.Plant Physiol 158: 1705–1714

Jones AM (2001) Programmed cell death in development and defense.Plant Physiol 125: 94–97

Karli�c R, Chung HR, Lasserre J, Vlahovi�cek K, Vingron M (2010) Histonemodification levels are predictive for gene expression. Proc Natl AcadSci USA 107: 2926–2931

Kim M, Lim JH, Ahn CS, Park K, Kim GT, Kim WT, Pai HS (2006)Mitochondria-associated hexokinases play a role in the control of pro-grammed cell death in Nicotiana benthamiana. Plant Cell 18: 2341–2355

Kouzarides T (1999) Histone acetylases and deacetylases in cell prolifera-tion. Curr Opin Genet Dev 9: 40–48

Kuo A, Cappelluti S, Cervantes-Cervantes M, Rodriguez M, Bush DS(1996) Okadaic acid, a protein phosphatase inhibitor, blocks calciumchanges, gene expression, and cell death induced by gibberellin in wheataleurone cells. Plant Cell 8: 259–269

Kuo MH, Allis CD (1998) Roles of histone acetyltransferases and deace-tylases in gene regulation. BioEssays 20: 615–626

Kurdistani SK, Grunstein M (2003) Histone acetylation and deacetylationin yeast. Nat Rev Mol Cell Biol 4: 276–284

Kurita K, Sakamoto T, Yagi N, Sakamoto Y, Ito A, Nishino N, Sako K,Yoshida M, Kimura H, Seki M, et al (2017) Live imaging of H3K9acetylation in plant cells. Sci Rep 7: 45894

Landreville S, Agapova OA, Matatall KA, Kneass ZT, Onken MD, LeeRS, Bowcock AM, Harbour JW (2012) Histone deacetylase inhibitorsinduce growth arrest and differentiation in uveal melanoma. Clin CancerRes 18: 408–416

Lovegrove A, Hooley R (2000) Gibberellin and abscisic acid signalling inaleurone. Trends Plant Sci 5: 102–110

Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK (2001)Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer1: 194–202

Marks PA, Richon VM, Rifkind RA (2000) Histone deacetylase inhibitors:inducers of differentiation or apoptosis of transformed cells. J NatlCancer Inst 92: 1210–1216

Minucci S, Pelicci PG (2006) Histone deacetylase inhibitors and the promiseof epigenetic (and more) treatments for cancer. Nat Rev Cancer 6: 38–51

Miura K, Furumoto T (2013) Cold signaling and cold response in plants. IntJ Mol Sci 14: 5312–5337

Mozer TJ (1980) Control of protein synthesis in barley aleurone layers bythe plant hormones gibberellic acid and abscisic acid. Cell 20: 479–485

Nieswandt B, Bergmeier W, Schulte V, Rackebrandt K, Gessner JE,Zirngibl H (2000) Expression and function of the mouse collagen re-ceptor glycoprotein VI is strictly dependent on its association with theFcRgamma chain. J Biol Chem 275: 23998–24002

Pawlak S, Deckert J (2007) Histone modifications under environmentalstress. Biol Lett 44: 65–73

Peterson CL, Laniel MA (2004) Histones and histone modifications. CurrBiol 14: R546–R551

Rahman I, Adcock IM (2006) Oxidative stress and redox regulation of lunginflammation in COPD. Eur Respir J 28: 219–242

Repka V, Fiala R, �Ciamporová M, Martinka M, Pavlovkin J (2015) Anti-body microarray expression profiling of maize roots treated with cad-mium and nickel. Agriculture (Polnohospodárstvo) 61: 41–49

Robert F, Pokholok DK, Hannett NM, Rinaldi NJ, Chandy M, Rolfe A,Workman JL, Gifford DK, Young RA (2004) Global position and recruit-ment of HATs and HDACs in the yeast genome. Mol Cell 16: 199–209

Ropero S, Esteller M (2007) The role of histone deacetylases (HDACs) inhuman cancer. Mol Oncol 1: 19–25

Schopfer P, Plachy C, Frahry G (2001) Release of reactive oxygen inter-mediates (superoxide radicals, hydrogen peroxide, and hydroxyl radi-cals) and peroxidase in germinating radish seeds controlled by light,gibberellin, and abscisic acid. Plant Physiol 125: 1591–1602

Schumb WC, Satterfield CN, Wentworth RL (1955) Hydrogen Peroxide.ACS Monograph No. 128. Reinhold Publishing, New York





Schwille P, Haupts U, Maiti S, Webb WW (1999) Molecular dynamics inliving cells observed by fluorescence correlation spectroscopy with one-and two-photon excitation. Biophys J 77: 2251–2265

Shahbazian MD, Grunstein M (2007) Functions of site-specific histoneacetylation and deacetylation. Annu Rev Biochem 76: 75–100

Solís MT, Chakrabarti N, Corredor E, Cortés-Eslava J, Rodríguez-SerranoM, Biggiogera M, Risueño MC, Testillano PS (2014) Epigeneticchanges accompany developmental programmed cell death in tapetumcells. Plant Cell Physiol 55: 16–29

Strahl BD, Allis CD (2000) The language of covalent histone modifications.Nature 403: 41–45

Sukumari-Ramesh S, Singh N, Jensen MA, Dhandapani KM, Vender JR(2011) Anacardic acid induces caspase-independent apoptosis and ra-diosensitizes pituitary adenoma cells. J Neurosurg 114: 1681–1690

Tanaka M, Kikuchi A, Kamada H (2008) The Arabidopsis histone deace-tylases HDA6 and HDA19 contribute to the repression of embryonicproperties after germination. Plant Physiol 146: 149–161

Turner BM (2000) Histone acetylation and an epigenetic code. BioEssays22: 836–845

Wang P, Zhang H, Hou H, Wang Q, Li Y, Huang Y, Xie L, Gao F, He S, LiL (2016) Cell cycle arrest induced by inhibitors of epigenetic modifica-tions in maize (Zea mays) seedling leaves: characterization of the pro-cess and possible mechanisms involved. New Phytol 211: 646–657

Wang P, Zhao L, Hou H, Zhang H, Huang Y, Wang Y, Li H, Gao F, Yan S,Li L (2015) Epigenetic changes are associated with programmed celldeath induced by heat stress in seedling leaves of Zea mays. Plant CellPhysiol 56: 965–976

Wang T, Gu J, Wu PF, Wang F, Xiong Z, Yang YJ, Wu WN, Dong LD,Chen JG (2009) Protection by tetrahydroxystilbene glucoside againstcerebral ischemia: involvement of JNK, SIRT1, and NF-kB pathways andinhibition of intracellular ROS/RNS generation. Free Radical Bio Med47: 229–240

Yang XJ, Seto E (2007) HATs and HDACs: from structure, function andregulation to novel strategies for therapy and prevention. Oncogene 26:5310–5318

Zhang L, Qiu Z, Hu Y, Yang F, Yan S, Zhao L, Li B, He S, Huang M, Li J,et al (2011) ABA treatment of germinating maize seeds induces VP1gene expression and selective promoter-associated histone acetylation.Physiol Plant 143: 287–296

Zhou C, Zhang L, Duan J, Miki B, Wu K (2005) HISTONEDEACETYLASE19 isinvolved in jasmonic acid and ethylene signaling of pathogen response inArabidopsis. Plant Cell 17: 1196–1204

Zhu J, Jeong JC, Zhu Y, Sokolchik I, Miyazaki S, Zhu JK, Hasegawa PM,Bohnert HJ, Shi H, Yun DJ, et al (2008) Involvement of ArabidopsisHOS15 in histone deacetylation and cold tolerance. Proc Natl Acad SciUSA 105: 4945–4950


Hou et al.



Documents

Histone Deacetylase Is Required for GA-Induced · cells increased gradually in aleurone layers, and half of the cells were dead by 6 d after GA treatment (Fig. 1A). When aleurone