Forensic DNA Analysis Yuzhen Gao University of Soochow
University [email protected] Slide 2 Summary What is DNA? Where
is DNA found in the body? How does DNA differ among individuals?
Forensic DNA Analysis DNA and Statistics Slide 3 What is DNA? Slide
4 What does DNA stand for? What does DNA do? DNA contains genetic
information. DNA codes for the proteins our bodies make that are
necessary for survival. Deoxyribose Nucleic Acid or
Deoxyribonucleic Acid Slide 5 What is DNA? DNA is a code for making
proteins AGC TAG CTT ATA CTC TAT CTC TTT Amino Acid Amino Acid
Amino Acid Amino Acid Amino Acid Amino Acid The order of amino
acids determines what type of protein is made. Slide 6 What is DNA?
Some common proteins are: Hemoglobin - carries oxygen from lungs to
cells Insulin - regulates metabolism Many types of enzymes -
catalyze reactions in the body, such as the breakdown of sugar for
energy DNA also determines how much of these proteins each cell
makes. Slide 7 What is DNA? What does DNA look like? Double Helix
Like a Twisted Ladder Slide 8 What is DNA? What does DNA look like?
Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs
of Ladder) Slide 9 What is DNA? The DNA ladder is made up of
building blocks called nucleotides. What is a nucleotide? Phosphate
Group Deoxyribose sugar Base Adenine Cytosine Guanine Thymine Slide
10 The 4 Bases A Adenine G Guanine C Cytosine T Thymine Slide 11
The 4 Bases G C T A Slide 12 A pairs with T G pairs with C The
bases pair up to form the rungs of the ladder. Slide 13 What is
DNA? DNA is written as the sequence of these bases:
AAGTCGATCGATCATCGATCATACGT In humans, there are three billion
(3,000,000,000) base pairs (letters) in the DNA within each cell.
Only one side of the ladder is written. Slide 14 What is DNA? Among
humans, most of the 3 billion bases in the DNA sequence are exactly
the same. Our Human DNA is 99.8% similar to each other, but the
0.2% difference is more than enough to distinguish us from one
another. Human DNA is even 98% similar to chimpanzees. NO TWO
PEOPLE HAVE IDENTICAL DNA* *except identical twins Slide 15 What is
DNA? Stupid Facts: If two different people started reciting their
individual genetic code at a rate of one letter per second, it
would take almost eight and a half minutes before they reached a
difference. If unwound and tied together, the strands of DNA in one
cell would stretch almost six feet but would be only 50 trillionths
of an inch wide. If all the DNA in your body was put end to end, it
would reach to the sun and back over 600 times (100 trillion times
six feet divided by 92 million miles). Slide 16 Where is DNA? Slide
17 DNA is found in the cells in our body. Nucleus (Brain of the
cell) Mitochondria (more later) Slide 18 Where is DNA? All types of
cells in our body contain a copy of the same DNA. Some cells
important to forensic science are: White Blood Cell Sperm CellCheek
Cell Slide 19 Where is DNA? DNA in the nucleus is packaged into
Chromosomes Slide 20 Where is DNA? (one from Mother) (one from
Father) Chromosomes come in pairs There are 46 chromosomes in each
cell. (23 pairs) Slide 21 Where is DNA? What are sources of DNA at
a crime scene? Blood Semen Saliva Tissue Bone Teeth Hair Maggot
Crops DNA can be recovered from any substance that contains cells.
Slide 22 Maggot Crop Slide 23 How does DNA differ among Humans?
Slide 24 How does DNA differ among humans? DNA is a sequence of 4
possible letters GACT Of the 3 billion letters, 99.8% of the
sequence in all humans is identical. There are several ways the
sequence can be different. Slide 25 How does DNA differ among
individuals? 1. One of the bases (letters) can be different. Person
2 AGCTAGATCGTCATTCCGAG Person 1 AGCTAGATCGTTATTCCGAG Slide 26 How
does DNA differ among individuals? 2. Bases (letters) can be added
or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2
AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4
AGCTCCGAG Slide 27 How does DNA differ among individuals? 2. Bases
(letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG
Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person
4 AGCTCCGAG Slide 28 How does DNA differ among individuals? Person
1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 3. Regions of DNA can be
repeated a different # of times Slide 29 How does DNA differ among
individuals? 3. Regions of DNA can be repeated a different # of
times Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6
Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person
3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 1 2 3 4 5 6 7 Slide
30 Forensic DNA Analysis Slide 31 Reading of Chapter 13 Pages
227-237 good Pages 241-243 (mtDNA) good If material is more
complicated than what we cover in class, it likely wont be on a
quiz or exam. Slide 32 Forensic DNA Analysis Collection of Evidence
Types of Unknown Samples: Blood, Semen, Stains, Saliva Hair,
Tissue, Bones, Teeth Types of Known Samples: Blood or buccal swabs
from suspect or victim or other known person Slide 33 Forensic DNA
Analysis Beware of Contamination Contamination occurs when DNA from
another source gets mixed in with the sample being collected. An
investigator touches, sneezes, bleeds on a sample. Wear gloves and
use disposable instruments Package items separately. Especially, do
not mix known samples (from victim or suspect) with unknown
samples. Slide 34 Forensic DNA Analysis Packaging Evidence Package
each item individually. Put evidence into paper bags, not plastic.
Moisture degrades DNA; air dry samples. Keep samples at room
temperature and out of sun. Slide 35 Forensic DNA Analysis Brief
History of DNA- (1985) Multilocus RFLP Detects VNTRs: Variable
Number of Tandem Repeats Slide 36 Forensic DNA Analysis Brief
History of DNA(Late 80s, Early 90s) Single locus RFLP D2S44 probe
Lanes 6 and 10 match Lanes 8 and 11 match Slide 37 Forensic DNA
Analysis Brief History of DNA(Early 90s) PCR Strips (DQ alpha) 6
Alleles: 1.1, 1.2, 1.3 2, 3 or 4 A person can have one or two of
these numbers. Slide 38 Forensic DNA Analysis Short Tandem Repeats
(STRs) Individual identification possible Samples: Blood stains,
semen Mitochondrial DNA Used in cases of severely degraded DNA
Individual identification not possible Samples: Bones, hair shafts
Two main types of analyses (90s - Present) : Slide 39 Forensic DNA
Analysis Short Tandem Repeats (STRs) Currently the most used of all
forensic markers Individual identification possible Type of data
used in the FBI CODIS database People differ in length at these
loci Are located in the nuclear DNA (chromosomes) Slide 40 Forensic
DNA Analysis Short Tandem Repeats (STRs) Regions of DNA can be
repeated a different # of times Person
1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. Person
2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person
3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 6 1 2 3 4 5 1 2 3 4
5 6 7 Slide 41 Forensic DNA Analysis Short Tandem Repeats (STRs)
Locus or Loci: Refers to the location on the chromosome. Allele:
Refers to the type of DNA. For STRs, the allele will be the number
of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Slide 42
Forensic DNA Analysis Locus: D5S818 Alleles: 7,9
CCAGATAGATAGATAGATAGATAGATAGATCC Paternal chromosome 5 Maternal
chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Example Slide
43 Forensic DNA Analysis 13 loci used in CODIS Slide 44 Forensic
DNA Analysis Basic Steps in Analysis Extraction: Separates DNA from
sample Separation: Separates amplified fragments according to size.
Amplification or PCR: Amplifies small portions of DNA (STR regions)
Slide 45 PCR Hood Slide 46 Forensic DNA Analysis Basic Steps in
Analysis Extraction: Separates DNA from sample Separation:
Separates amplified fragments according to size. Amplification or
PCR: Amplifies small portions of DNA (STR regions) Slide 47 The
Thermal Cycler Amplifies DNA Slide 48 Forensic DNA Analysis Basic
Steps in Analysis Extraction: Separates DNA from sample Separation:
Separates amplified fragments according to size. Amplification or
PCR: Amplifies small portions of DNA (STR regions) Slide 49 FMBio
Separates Amplified DNA Slide 50 Forensic DNA Analysis Color image
of gel Slide 51 Forensic DNA Analysis Black and white image of STR
gel. Samples will have one or two bands at each loci. Gel
Electrophoresis Slide 52 ABI 310 Genetic Analyzer Separates
Amplified DNA Slide 53 Slide 54 Forensic DNA Analysis Sample will
have one or two peaks at each loci. Capillary Electrophoresis Slide
55 Forensic DNA Analysis Compare to a ladder that has all peaks at
each loci. Slide 56 Forensic DNA Analysis Slide 57 Blood stain 7,9
10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13
8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179
Slide 58 Forensic DNA Analysis Blood stain 7,9 10,13 7,15 8,8
Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12
Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179 Slide 59
Forensic DNA (mitochondria) Mitochondria - The powerhouse of the
cell. Mitochondria Mitochondria have their own DNA Slide 60
Forensic DNA (mitochondria) Mitochondrial DNA Double Helix YES
Chromosomes NO Ring of DNA YES Slide 61 Forensic DNA (mitochondria)
Mitochondrial DNA Mitochondrial DNA is only 16,569 letters long.
There is a 900 base pair region with a 1.7% difference (D loop).
(compared to 3 billion in nuclear DNA) Slide 62 Forensic DNA
(mitochondria) Nuclear DNA vs. Mitochondrial DNA Double Helix One
copy per cell Multiple copies in each mitochondria Multiple
mitochondria in each cell One Ring 46 Chromosomes MtDNA used for
old or degraded samples Slide 63 Forensic DNA (Mitochondria) For
nuclear DNA:Length is measured For mtDNA: Sequence is examined
Different colored peaks correspond to a different base Slide 64
Forensic DNA Analysis Basic Steps in Analysis Extraction: Separates
DNA from sample Sequencing: Sequence is determined by another
reaction and separation of sequenced fragments Amplification or
PCR: Amplifies small portion of mtDNA (D loop) Slide 65 Forensic
DNA (Mitochondria) DNA Sequences are compared to each other.
AGCTAGATCGTTATTCCGAG Hair found on Suspect Victim Conclusion:Hair
may have come from the victim. Slide 66 Forensic DNA (Mitochondria)
DNA Sequences are compared to each other. AGCTAGATTGTTATTCCGAG
AGCTAGATCGTTATTCCGAG Hair found on Suspect Victim Conclusion:Hair
did not come from the victim Slide 67 Forensic DNA (Mitochondria)
AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Cigarette butt at crime
scene Suspect #1 Conclusion:Cigarette could be from Suspects #2, #4
or other person with the same sequence. AGCTAGATTGTTATTCCGAG
Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG
Suspect #4 Slide 68 DNA and Statistics The final result is
presented as a statistic. Do Say: The chance that another person
has this DNA in the bloodstain is 1 in 300 billion. Do not say: The
DNA in the bloodstain is John Does DNA. Slide 69 DNA and Statistics
Where do the statistics come from? First, the frequency of each
allele is estimated using data from a population data base. Locus:
D5S818 Alleles: 7,9 Allele frequency from database 726% 911% Slide
70 DNA and Statistics Where do the statistics come from? Next, the
frequency of the genotype at each locus is calculated. Locus:
D5S818 Alleles: 7,9 7,96% Genotype frequency Slide 71 DNA and
Statistics For total frequency, multiply all of the frequencies
together. D5 = 6% D8 = 12% D18 = 0.5% Total = 0.004% Slide 72 Slide
73 Slide 74 Demonstration Calculating Frequencies
