Expression of Voltage-Gated Potassium Channels in …...Expression of Voltage-Gated Potassium Channels in Human and Rhesus Pancreatic Islets Lizhen Yan,1 David J. Figueroa,2 Christopher

Expression of Voltage-Gated Potassium Channels inHuman and Rhesus Pancreatic IsletsLizhen Yan,

1David J. Figueroa,

2Christopher P. Austin,

3,4Yuan Liu,

5Randal M. Bugianesi,

1

Robert S. Slaughter,1

Gregory J. Kaczorowski,1

and Martin G. Kohler1

Voltage-gated potassium channels (Kv channels) areinvolved in repolarization of excitable cells. In pancre-atic �-cells, prolongation of the action potential byblock of delayed rectifier potassium channels would beexpected to increase intracellular free calcium and topromote insulin release in a glucose-dependent manner.However, the specific Kv channel subtypes responsiblefor repolarization in �-cells, most importantly in hu-mans, are not completely resolved. In this study, wehave investigated the expression of 26 subtypes from Kvsubfamilies in human islet mRNA. The results of theRT-PCR analysis were extended by in situ hybridizationand/or immunohistochemical analysis on sections fromhuman or Rhesus pancreas. Cell-specific markers wereused to show that Kv2.1, Kv3.2, Kv6.2, and Kv9.3 areexpressed in �-cells, that Kv3.1 and Kv6.1 are expressedin �-cells , and that Kv2.2 is expressed in �-cells. Thisstudy suggests that more than one Kv channel subtypemight contribute to the �-cell delayed rectifier currentand that this current could be formed by heterotetra-mers of active and silent subunits. Diabetes 53:597–607, 2004

The role of potassium channels in excitation-secretion coupling is well established (1). Inpancreatic �-cells, insulin secretion is modulatedby the activity of different ionic currents. Among

these are the three main potassium currents found in�-cells: the ATP-sensitive (KATP), calcium-activated (KCa),and voltage-gated (Kv) currents. Each has a functional roleat different stages in the process of glucose-induced insu-lin secretion (2).

KATP, consisting of inward rectifier Kir6.2 and sulfonyl-

urea receptor SUR1, sets the �-cell resting membranepotentials (Em) under low plasma glucose conditions (3,4).Elevated plasma glucose concentration results in an in-crease in metabolic activity, which leads to closure of KATPchannels and to membrane depolarization (5,6). Voltage-gated calcium channels (Ca channels) then become acti-vated, and the resultant rise in intracellular Ca2� triggersinsulin secretion. Sulfonylureas, widely used insulin secre-tagogues, bind to the SUR1 receptor and block the KATPchannel, causing insulin secretion in the absence of glu-cose metabolism (7,8).

KCa in �-cells consists of at least two different compo-nents. There is a large conductance KCa channel in �-cells,with no obvious physiological function (9). In nondissoci-ated �-cells, a second type of KCa current has beendescribed (10). This current is linked to depolarization-induced rhythmic electrical activity of �-cells, importantfor insulin secretion (11).

The remaining potassium current is generated by Kvchannels that produce either a fast transient current, IA, ora slow inactivating, delayed rectifying current, IDR (12–14).Both currents exist in �-cells, with IDR being the majorcontributor to the repolarization of these cells. Thus,blockage of IDR should enhance Ca influx and thereforelead to an increase in insulin secretion as has beenpreviously reported (15–17). Because IDR does not openuntil the membrane is depolarized above a threshold levelof ca �20 mV, its activation would be glucose dependent.Therefore, pharmacological interference with this mecha-nism may provide a novel way to treat type 2 diabeteswithout causing the hypoglycemic adverse effect of sulfo-nylureas (18,19). IDR has also been shown to be part of thesignaling pathway of glucagon-like peptide-1–induced glu-cose-dependent insulin secretion (20). The function of IDRcurrents in �-cells may be similar to that of �-cells becauseaction potential initiation is dependent on depolarizationthrough metabolism-dependent blockage of KATP. In�-cells, the opening of Na channels apparently initiates theaction potential, but the IDR may still be involved inrepolarization (21).

Kv channels belong to the six-transmembrane (TM)family of K channels, where Kv1 to Kv11 subfamilies exist,although Kv7 is only found in Aplysia (22,23). Members ofthe Kv1 to Kv4 subfamilies form tetrameric functionalchannels, homomultimers or heteromultimers, usuallywith members from the same subfamily. Members of theKv5 to Kv11 families code for “silent subunits” that do notexpress as functional homomultimers. In heterologousexpression systems, silent subunits can coassemble with

From the 1Department of Ion Channels, Merck Research Laboratories, Rah-way, New Jersey; the 2Department of Molecular and Investigative Toxicology,Merck Research Laboratories, West Point, Pennsylvania; the 3Department ofNeuroscience, Merck Research Laboratories, West Point, Pennsylvania;the 4National Human Genome Research Institute, Bethesda, Maryland; and the5Department of Bioinformatics, Merck Research Laboratories, West Point,Pennsylvania.

Address correspondence and reprint requests to Dr. Lizhen Yan or Dr.Martin G. Kohler, RY80N-C31, Department of Ion Channels, Merck ResearchLaboratories, Rahway, NJ 07065. E-mail: [email protected] or [email protected].

Received for publication 13 April 2003 and accepted in revised form 14November 2003.

L.Y. and D.J.F. contributed equally to this article.DAPI, 4,6-diamidino-2-phenylindole; Em, membrane potential; IA, fast tran-

sient current; IDR, delayed rectifying current; IHC, immunohistochemistry;ISH, in situ hybridization; KATP current, ATP-sensitive potassium current; KCacurrent, calcium-activated potassium current; Kv current, voltage-gated po-tassium current; TM, transmembrane.

© 2004 by the American Diabetes Association.

DIABETES, VOL. 53, MARCH 2004 597

Kv2 and Kv3 subunits and modulate the biophysical char-acteristics of the latter subunits (24–27). There are severaldifficulties that obscure the correlation of any particularKv subunit with a specific physiological function: the highdegree of sequence homology results in many Kv channelshaving similar pharmacological and biophysical proper-ties, and most excitable cells express more than one Kvchannel gene.

Previous studies have identified Kv2.1 and Kv3.2 inrodent �-cells and insulinoma cells (16,28–30), and blockof Kv2.1 has been implicated in eliciting glucose-depen-dent insulin secretion (16,31,32). While Kv2.1 has beendetected in human islets (33), no studies have yet beenattempted in human or primate �-cells to define themolecular components of IDR. Although a molecular basisfor the A-type current has been reported in �- and �-cells(21), there is no information on the IDR in these cells.

In this study, we used RT-PCR to analyze the expressionof 26 Kv channel genes in human islets. Cell-type specificexpression of 11 Kv subtypes was further determined by insitu hybridization or immunohistochemistry. All data,taken together, suggest that closely related Kv channelsubtypes are distributed among different cell types inprimate islets. In addition, we provide evidence thatpancreatic �-cells express both silent and functionallyactive Kv channel subtypes. Some heteromeric combina-tion of these subtypes might be the underlying molecularcorrelate of IDR.

RESEARCH DESIGN AND METHODS

Design and optimization of RT-PCR primers for Kv1 to Kv11 family

subtypes. To establish the profile of Kv channel subtypes in islets, weperformed RT-PCR amplification on RNA extracted from human islets using a

subtype-specific primer pair for each of the 26 members of the Kv1–Kv11families.

To obtain efficient and specific primer pairs, we used the Vector NTIprogram (Informax, Frederick, MD) to select sequences. Each primer se-quence then was submitted to a basic local alignment search tool searchagainst GenBank to ensure specificity of the selected sequence. Specificprimer pairs were then used to amplify Kv channel subtypes from human fetalbrain cDNA. Finally, the most effective primer pairs for each subtype wereused to study the expression of Kv channels in human islets (Table 1).Antibodies. A rabbit polyclonal antibody for Kv1.6 was raised against thepeptide RRSSYLPTPHRAYAEKRM, corresponding to residue 509–526 of therat Kv1.6 (34). Human Kv1.6 shares 17 of 18 amino acid residues with the ratchannel in this region. Rabbit polyclonal antibodies against Kv2.1 and Kv3.2proteins were purchased from Alomone Labs (Jerusalem, Israel). The Kv2.1antibody was raised against the peptide HMLPGGGAHGSTRDQSI, corre-sponding to residue 837–853 of rat Kv2.1. Human Kv2.1 shares 15 of 17 aminoacids with this region of the rat channel. The Kv3.2 antibody was raisedagainst the peptide DLGGKRLGIEDAAGLGGPDGK(C), corresponding to res-idues 184–204 of rat Kv3.2. The human and rat Kv3.2 have 19 identical aminoacids in this peptide sequence. Antibodies for Kv2.1 and Kv3.2 detected onlya single band in Western blots of the cognate channels expressed in HEK 293cells.RT-PCR. Human pancreatic islets were obtained from the University ofAlberta (Edmonton, AB, Canada). The islets were purified based on stainingwith the �-cell–specific dye diphenylthiocarbazone (Sigma), as previouslydescribed (35). The total RNA was isolated using TRI Reagent (MolecularResearch Center, Cincinnati, OH) according to the manufacturer’s instruction.Because most of the human Kv channel genes are intronless, we treated thetotal RNA with DNaseI (Ambion, Austin, TX) to eliminate traces of genomicDNA. A control PCR reaction was performed with �-actin primers (forward:5�-GCCCTTTCTCACTGGTTCTC-3�; reverse: 5�-CTTTACACCAGCCTCATGGC-3�) located on an intron region to verify the absence of genomic DNA.

The DNaseI-digested RNA was transcribed into cDNA using SensiScriptReverse Transcriptase from Qiagen (Valencia, CA), per the manufacturer’sinstruction. Human fetal brain poly A� RNA was purchased from BDBiosciences Clontech (Palo Alto, CA). The RNA was transcribed into cDNAwith the Omniscript Reverse Transcriptase Kit from Qiagen following themanufacturer’s instructions. The cDNA was used as templates for the ampli-fication of individual channel subtypes. Approximately 100 ng of total RNA

TABLE 1PCR primers used for RT-PCR amplification of Kv channels

Subtype Accession no. Sense primer (5� to 3�) Antisense primer (5� to 3�)

Kv1.1 L02750 CATCTGGTTCTCCTTCGAGC GTTAGGGGAACTGACGTGGAKv1.2 L02752 TCCGGGATGAGAATGAAGAC TTGGACAGCTTGTCACTTGCKv1.3 M55515 GTTCTCCTTCGAACTGCTGG CTGAAGAGGAGAGGTGCTGGKv1.4 M55514 CCCCAGCTTTGATGCCATCTTG TGAGGATGGCAAAGGACATGGCKv1.5 M55513 TGCGTCATCTGGTTCACCTTCG TGTTCAGCAAGCCTCCCATTCCKv1.6 X17622 TCAACAGGATGGAAACCAGCCC CTGCCATCTGCAACACGATTCCKv1.7 AJ310479 TGCCCTTCAATGACCCGTTCTTC AAGACACGCACCAATCGGATGACKv2.1 L02840 TACAGCCTCGACGACAACG ACCACGCGGCGGACATTCTGKv2.2 U69962 AACGAAGAACTGAGGCGAGAG ACTCCGCCTAAGGGTGAAACKv3.1 S56770 AACCCCATCGTGAACAAGACGG TCATGGTGACCACGGCCCAKv3.2 AI363404 CTGCTGCTGGATGACCTACC TGTGCCATTGATGACTGGTTKv3.3 AF055989 TTCTGCCTGGAAACCCATGAGG TGTTGACAATGACGGGCACAGGKv3.4 M64676 TTCAAGCTCACACGCCACTTCG TGCCAAATCCCAAGGTCTGAGGKv4.1 AJ005898 ATCTCGAGGAGATGAGGTTC TTCTTTCGGTCCCGATACKv4.3 AF048712 TGGCTTCTTCATCGCTGTCTCG CCGAAGATCTTCCCTGCAATCGKv4.4 NM_012283 AGCCAAGAAGAACAAGCTG AGGAAGTTTAGGACATGCCKv5.1 AF033382 TCCACATGAAGAAGGGCATCTGC TCACGTAGAAGGGGAGGATGKv6.1 AF033383 TGCACCAACTTCGACGACATCC GGAACTCCAGGGAGAACCAGCCKv6.2 AJ0111021 AAGCTCTTCGCCTGCGTGTC CAGCAGCAGCGACACGTAGAACKv6.3 NM_172347 ATGCCCATGCCTTCCAGAGA AGAGCTGCACGATCTCCTCGKv8.1 AF167082 TTCCACAGCTGCCCGTATCTTTG TTTTGCCTGTGGTGGTGTCTGGKv9.1 AF043473 TTTGAGGACTTGCTGAGCAGCG TTGCTCCAGGCACACCAACAAGKv9.2 XM_043106 GTACTGGGGCATCAACGAGT CCACGGAGAGGTAGAGCAAGKv9.3 AF043472 CTCTGTGGGCATTTCCATTT AGAAACAGGCACAAACACCCKv10.1 AF348982 GCTTGCCCGTCACTTCATTGGTC TTCTTCCAGGCACTGTGATAGGAKv11.1 AF348983 AGCCATGCTCAAACAGAGTG CTCCTCGTAGTCGTCGCACA

Kv CHANNELS IN PRIMATE ISLETS

598 DIABETES, VOL. 53, MARCH 2004

was used in each reaction. A blank reaction was used as a control. Thereaction conditions were as follows: start with 95°C for 15 min to activate theHotStarTaq DNA Polymerase (Qiagen), then denature at 94°C for 30 s,annealing at 56°C for 30 s, followed by an extension at 72°C for 1 min. Thetotal number of cycles was 35. The amplification was followed by a 10-minextension at 72°C. The primers for each Kv channel subtype are listed in Table1. The sequences for the insulin primers are the following: sense primer5�-CCAGCCGCAGCCTTTGTGA-3�, antisense primer 5�-GCTGGTAGAGGGAGCAGAT-3�. The sequences for the trypsin II primers are the following: senseprimer 5�-GCCCCCTTTGATGATGATG-3�, antisense primer 5�-ACACGCGGGAATTGATGAC-3�. The sequences for the Kir6.2 primers are the following:sense primer 5�-AAGAAGTGAAGTGGGACC-3�, antisense primer 5�-GTTGCCTTTCTTGGACAC-3�.In situ hybridization, immunohistochemistry, and double-label com-

bined in situ hybridization/immunohistochemistry. For in situ hybridiza-tion (ISH), oligonucleotide probes specific for human Kv2.1, Kv2.2, Kv3.1,Kv6.1, Kv6.2, and Kv9.3 (Table 2) were end labeled with biotin-16-dUTP(Roche Molecular Biochemicals, Indianapolis, IN). The digoxigenin oligonu-cleotide tailing kit (Roche Molecular Biochemicals) was used according to themanufacturer’s protocol, except for replacement of digoxigenin-dUTP withbiotin-16-dUTP. For Kv3.3 and Kv9.2, riboprobes instead of oligo probes wereused for ISH. A 298-bp fragment from the 3�-untranslated region of the humanKv3.3 cDNA insert was prepared by RT-PCR amplification from human fetalbrain cDNA, using a Kv3.3-specific primer pair (Table 1). Similarly, a 543-bpfragment from the 3�-untranslated region of the human Kv9.2 cDNA wasamplified, using a Kv9.2-specific primer pair (Table 1). The reaction conditionswere the same as described above for subtype RT-PCR. The PCR fragmentswere subcloned into the plasmid vector pCRII-TOPO (Invitrogen, Carlsbad,

CA) and sequenced to verify their identity. To prepare riboprobes for ISH, theKv3.3 and Kv9.2 containing vectors were linearized with the restrictionenzymes SpeI and NotI, respectively, to create template DNA. Biotinylatedsense and antisense riboprobes were then generated by in vitro transcriptionusing Biotin RNA Labeling Mix (Roche Molecular Biochemicals).

Cryostat sections (8 �m) of human pancreas (the National DiseaseResearch Interchange) and rhesus pancreas tissue, obtained under the ap-proval of the Merck Research Laboratories Institutional Animal Care and UseCommittee, were thaw mounted on SuperFrost plus slides (Fisher Scientific)and fixed with 4% paraformaldehyde. To improve the signal strength, acocktail mixture of two labeled oligonucleotide probes (listed in Table 2)specific for a particular Kv channel subunit was used at a final concentrationof 2 pmol/ml each. The ISH conditions were the same as those previouslydescribed (36). Bound probes were detected using the TSA direct red FISHtyramide amplification kit (PerkinElmer Life Sciences, Boston, MA) accordingto the manufacturer’s instructions. ISH using mRNA probes, immunohisto-chemistry (IHC) using antibodies, and combined double-label ISH/IHC wereperformed as previously described (37). ISH and IHC expression experimentswere carried out on human and Rhesus pancreatic sections. The expression ofKv2.1, 2.2, 3.1, 3.2, 3.3, 6.1, 6.2, 9.2, and 9.3 subunits were examined in sectionsfrom both species, and in all cases, expression patterns in Rhesus and humanwere consistent. Double-staining cell identification experiments were carriedout on the specimens that gave the best signal. Kv1.6 and Kv4.1 were onlymonitored in Rhesus.

Cell identification markers were antibodies specific for glucagon (Dako,Carpinteria, CA), insulin (Zymed Laboratories, South San Francisco, CA), andsomatostatin (Dako). Matched preimmune sera or nonimmune control serawere used as negative controls for IHC. All antibodies were used at the

TABLE 2DNA probes used for ISH

Subtype Sequence (5� to 3�)

hKv2.1 CTCAAAGTTGAACGCTATTGCTGTGTGTTTCTCAGGAGACCTGACCAATCATTCCCTGTAGCTGTCTAACAGTGGAATCCATCC

hKv2.2 GGACTGTCGGTGGCATTGTCAGACTGCAAAGGACTATGTAGCCCATCCCTGGCAGCAGGTCCTTTCTCTCTGGATAGAGTTAG

hKv3.1 TCGGCGTCCGCGTCGTCGGCGCTGTTGTCCAGAGGAGCTCCCGGTAGTAGCGCACTTGCGTGCCATTGCGAACG

hKv3.2 GCCAGGCGTGTTCCAGGCAGGGTCTTGAGGGTGTTCGAAGACCCCTACTCGTCCAGAGCCGCCAGGTTTA

hKv4.1 CCTGGGTCACCGTCTTGTTGCTAATATGGATGAAGCCGTCGGTGAGGAGGAAGCAGGCTCGGTCCCGGCTATA

hKv6.1 GTGAAGGCATCTCGAGGAGATGAGGTTCGAAGGAATTCTTCTACGATGCTGACTCA

hKv6.2 TGAGGATGTCGTCGAAGTTGGTGCAGGCCTTGAGCTGGATGAGGAACTGCGCCCTCCGGAACATCACCCTCT

hKv9.2 ACTGGGCCACAAGCACTAGAATAGCGTACACGATGGACGGCTGCCCATCGAACTTGGAGGCGTCGTTGTAGAAGGC

hKv9.3 GAGGAAACCGCAGGAGGGTGCTTTGGTCAACAGACTGCGGAGCTGACCAAATCGCAGTGTGTCAAACTTCTCCAGC

FIG. 1. RT-PCR amplification of Kv channelsubtypes from RNA of human fetal brain andpancreatic islets. A: Human fetal brain poly A�RNA was subjected to RT-PCR amplificationusing primers shown in Table 1 as described inRESEARCH DESIGN AND METHODS. B: RNA extrac-tion from pancreatic islets was performed andtotal RNA was reverse transcribed into cDNA.PCR amplifications of Kv channel subtypes inislets were performed under the same condi-tions as described in A. Results from the elec-trophoresis of the PCR products that wereseparated on 1% agarose gels and stained withethidium bromide are presented. On the leftside of each image are the DNA markers (800ng/lane; Bio-Rad Laboratories, Hercules, CA)of different sizes (bp). The top of each imagelabels the subtype of Kv channel representedby each lane. All PCR products showed theexpected molecular sizes; some were cloned inbacterial vectors and sequenced to verify iden-tity (data not shown). PCR reactions withwater instead of cDNA were performed as acontrol (data not shown.)

L. YAN AND ASSOCIATES


FIG. 2. Kv2.1 channel is expressed in pancreatic �-cells and Kv2.2 channel is expressed in �-cells. In all sections, cell nuclei were stained withDAPI and are shown in blue. A: ISH for Kv2.1 mRNA-positive cells (red) can be seen within an islet from Rhesus pancreas. B: IHC with insulindetects �-cells (green) within the same islet as seen in panel A. C: Colocalization (yellow) of Kv2.1 mRNA and insulin within the same section.D: Results from a double-staining ISH/IHC experiment including Kv2.1 mRNA (red) and glucagon protein (green) in a human islet. The lack ofyellow indicates no coexpression of Kv2.1 mRNA with glucagon. E: IHC of Kv2.1 protein visualized with Texas red (red) labels cells within aRhesus islet. F: Kv2.2 mRNA-containing cells (red) are present within a Rhesus islet. G: Insulin label of �-cells (green) in the same region of theislet. H: Lack of colocalization (yellow) of Kv2.2 mRNA and insulin protein. I: Kv2.2 mRNA-positive cells (red) are present within a region of aRhesus islet. J: Somatostatin-containing pancreatic �-cells (green) within the same section of the islet as in panel I. K: Kv2.2 mRNA colocalizes(yellow) with somatostatin.



manufacturer’s specified dilutions and incubated on the sections for 2 h atroom temperature following the ISH procedures. Bound antibodies weredetected using fluorescein isothiocyanate–conjugated donkey (MultipleLabel)IgG (Jackson Immunoresearch, West Grove, PA). Nuclei were counterstained

with 4,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR).Digital acquisition and image reassembly were carried out using a MicroMaxCCD camera (Princeton Instruments, Princeton, NJ) and Metamorph imagingsoftware (Universal Imaging, West Chester, PA).

FIG. 3. Expression of Kv3.1 and Kv3.2 channels in pancreatic �- and �-cells, respectively. In all sections, cell nuclei were stained with DAPI andare illustrated in blue. A: Kv3.1 mRNA-containing cells (red) in a section of a human islet. B: Insulin protein-containing cells (green) in the samesection used in panel A. C: Lack of colocalization (no yellow color) of Kv3.1 mRNA and insulin protein. D: Kv3.1 mRNA-positive cells (red) withina Rhesus islet. E: Glucagon-positive �-cells (green) are present within the same islet. F: Kv3.1 mRNA colocalizes with glucagon (yellow). G: Kv3.2mRNA-containing cells (red) highlight an islet in a section from a Rhesus pancreas. H: Insulin immunoreactive cells (green) shown in the sameislet. I: Colocalization of Kv3.2 mRNA and insulin protein (yellow). J: IHC of Kv3.2 protein visualized with fluorescein isothiocyanate (green)labels cells within a Rhesus islet. K: Kv2.1 mRNA-positive cells (red) shown within the same islet. L: Kv3.2 protein colocalizes with Kv2.1 mRNAin the same cells (yellow).



RESULTS

There are 17 channel subtypes detected in human

islets by RT-PCR. The level of effectiveness of the Kvchannel subtype-specific primers was tested by PCR usinghuman fetal brain cDNA as templates. In all cases, a PCRproduct was visible on a 1% agarose gel (Fig. 1A). Theexpression profile for Kv channels was determined in atleast two different human islet cDNA preparations. PCRfragments for Kv1.3, 1.6, 1.7, 2.1, 2.2, 3.1, 3.2, 3.3, 4.1, 4.4,6.1, 6.2, 9.1 9.2, 9.3, 10.1, and 11.1 are identified as beingpresent in the pancreatic islet preparation (Fig. 1B andTable 3). Probes for Kir6.2, representative of islet RNA,and trypsin, representative of acinar tissue RNA, indicatethat there is some nonislet RNA present in the human isletpreparation used for Fig. 1.

Kv3.4, Kv4.4, and Kv9.1 were only found in one of threehuman islet preparations. Kv4.4 and Kv9.1 appear as faintbands compared with brain and may be due to nonislettissue in the one preparation. However, Kv3.4 was alsofound in only one of three human islet cDNA preparations,but as a more prominent band. This channel is usuallyresponsible for an A-type potassium current and has beenreported to be in �- and �-cells from rat (21). Thisexpression profile could be a natural variation within thehuman population or a marker for a possible disease state.

The expression of Kv1.7 was found in all three humanpreparations, but the band was weaker than the signal inbrain and the signal of the other Kv channels in islets.These results were confirmed in a separate experimentwhere Kv1.7 and Kv1.6 were tested in a tissue panel

FIG. 4. Kv6.1 channel is expressed in islet �-cells, and Kv6.2 channel is expressed in islet �-cells. In all sections, cell nuclei were stained with DAPIand are illustrated in blue. A: Kv6.1 mRNA-containing cells (red) are found within a human islet. B: Insulin-positive cells (green) in the samesection as in panel A highlight different islet cells. C and D: Microscopic analysis reveals lack of colocalization (no yellow color) between Kv6.1mRNA and insulin. E: Kv6.1 mRNA-containing cells (red) in a section of a human islet. F: Glucagon protein-containing cells (green) in the samesection used in E. G and H: Colocalization (yellow) of Kv6.1 mRNA and glucagon protein was detected. I: Kv6.2 mRNA-containing cells (red) ina section of a Rhesus islet. J: Insulin protein-containing cells (green) in the same section used in I. K and L: Colocalization (yellow) of Kv6.2mRNA and insulin protein.



including islets, brain, and skeletal muscle among others,where Kv1.7 was most prominent in skeletal muscle,confirming a previous report (38). While RT-PCR is notquantitative, these experiments suggest that the expres-sion of Kv1.7 is lower in islets than for other Kv channelsobserved in this tissue.Kv2.1 and Kv3.2 colocalize with insulin in �-cells.

Pancreatic islets are composed primarily of three celltypes (i.e., �-, �-, and �-cells); however, vascular endothe-lial cells (39) and interneurons (40) are found in islets aswell. To identify the presence of channel subtypes in isletcells and to obviate the possibility of contamination fromsurrounding tissues, each of the most prominent islet Kvchannel subtypes identified by PCR were tested by eitheror both ISH and IHC and compared with cell markers insections of either Rhesus or human pancreatic tissue.

Because Kv2.1 and Kv3.2 have been reported to exist in�-cells and in insulin-secreting cell lines (16,28), the cellu-lar presence of these two channel subtypes was deter-mined first. Pancreatic sections were probed for Kv2.1mRNA with labeled antisense oligonucleotides by ISH(Table 2) and with an insulin-specific antibody by IHC in adouble-staining experiment. Kv2.1 mRNA-positive cellslocated within an islet (Fig. 2A) exclusively colocalize withthe insulin-containing cells, which confirms the expressionof Kv2.1 in �-cells (Fig. 2B and C). Consistent with thisfinding, there is no colocalization of Kv2.1 and the gluca-gon signals (Fig. 2D). The presence of Kv2.1 protein inislets, but not in surrounding pancreatic tissue, was con-firmed by immunostaining (Fig. 2E). Taken together, ourresults are consistent with the expression of Kv2.1 inpancreatic �-cells.

FIG. 5. Expression of Kv9.3, but not Kv9.2, channels in pancreatic �-cells. In all sections, cell nuclei were stained with DAPI and are illustratedin blue. A: Kv9.2 mRNA-containing cells (red) in a section of a human islet. B: Insulin immunoreactive cells (green) in the same section used inpanel A. C: Lack of colocalization (no yellow color) of Kv9.2 mRNA and insulin protein. D: Kv9.3 mRNA-containing cells (red) within a Rhesusislet. E: Insulin-positive cells (green) in the same section used in D. F: Significant colocalization (yellow) of Kv9.3 mRNA and insulin protein wasdetected. G: Kv9.3 mRNA-containing cells (red) within an islet. H: Glucagon protein-containing cells (green) in the same section used in G. I: Lackof colocalization (no yellow color) of Kv9.3 mRNA and glucagon protein was detected.



Expression of Kv3.2 was studied with the same double-labeling protocol used for Kv2.1. Kv3.2 antisense oligo-nucleotides (Fig. 3G) and insulin antibody (Fig. 3H)labeled the same population of islet cells (Fig. 3I), sug-gesting that Kv3.2 is expressed in �-cells.

Because both Kv2.1 and Kv3.2 are expressed in �-cells,we tested for their colocalization in pancreatic sections.Accordingly, we probed with a Kv3.2 antibody (Fig. 3J)and with Kv2.1 antisense oligonucleotides (Fig. 3K). Asexpected, both positive cell populations overlap com-pletely, further confirming that Kv2.1 and Kv3.2 are coex-pressed in �-cells, based on colocalization with insulin andeach other (Fig. 3L).Kv2.2 and Kv3.1 are found in �- and �-cells, respec-

tively, but not in �-cells. Pancreatic tissue was probedfor Kv2.2 mRNA and insulin, using the same protocol asfor Kv2.1 (Fig. 2F and G). In marked contrast to Kv2.1,colocalization of Kv2.2 with insulin was not observed (Fig.2H). Subsequently, a section was probed with Kv2.2 anti-sense oligonucleotides and a somatostatin antibody. Bothprobes labeled the same cell population (Fig. 2I–K),indicating that Kv2.2 is expressed in the �-cells of the islet.

The double staining of Kv3.1 mRNA (Fig. 3A) and insulin(Fig. 3B) did not overlap, suggesting that Kv3.1 is notexpressed in �-cells (Fig. 3C). Subsequently, a section wasprobed with Kv3.1 antisense oligonucleotides (Fig. 3D)and a glucagon antibody (Fig. 3E). Both probes labeled thesame cell population (Fig. 3F), indicating that Kv3.1, incontrast to Kv3.2, is expressed in pancreatic �-cells.Distribution of “electrically silent” subunits in pan-

creatic sections. Several silent subunits were found to bepresent in human islet cDNA by RT-PCR (see above).Human pancreatic sections were probed for Kv6.1 andKv6.2 channels with labeled antisense oligonucleotides(Table 2) and with cell marker–specific antibodies in adouble-staining experiment. The results shown in Fig.4A–H demonstrate that Kv6.1 is colocalized with glucagon,but not with insulin. In Figs. 4I–L, Kv6.2 appears tocolocalize with all of the insulin-containing cells. However,in a number of islets, Kv6.2 labels only a major fraction ofthe insulin-containing cells (data not shown). This distri-bution could indicate the existence of a subset of �-cellswithin some islets.

To determine whether Kv9.2 is expressed in pancreatic

�-cells, we first performed an ISH experiment using Kv9.2-specific oligonucleotide probes, but could not detect asignificant signal over background levels (data notshown). We then used a Kv9.2 riboprobe for ISH and theinsulin antibody for IHC experiments. The results in Fig.5A–C show that the Kv9.2 mRNA is expressed in islets, butdoes not colocalize with insulin.

The double-staining protocol with insulin antibody wasused to determine the cell distribution of Kv9.3 mRNA.Kv9.3-positive cells completely overlap with insulin-con-taining cells (Fig. 5D–F), but not with those cells contain-ing glucagon (Fig. 5I). These data suggest that Kv9.3mRNA is exclusively expressed in �-cells. Although Kv10.1and Kv11.1 are found in human islets by RT-PCR (seeabove), we did not attempt to further characterize the celldistribution of these two silent subunits.Kv subunits not found in the islet. Other subunits, suchas Kv1.6, Kv3.3, and Kv4.1, were identified by RT-PCR inhuman islets. In ISH/IHC protocols, the three subtypesappear to be located outside of the islet, and no colocal-ization with insulin was observed for any of them (Fig.6A–I). Morphologically, the tubular configuration of theKv1.6-expressing cells suggests that these cells could beacinar, Schwann, or nerve cells (41–43).

The expression of Kv channels in islet cell types otherthan �-, �-, or �-cells might contribute to the observed PCRsignals (Fig. 1). However, this contribution does notappear to be significant because, by ISH, Kv channels thatcoexpress with either insulin, somatostatin, or glucagonare only found in cells that contain that marker. If othercell types were responsible for the PCR signal, at leastsome cells would be expected to show the Kv signalseparate from the marker.

DISCUSSION

The identification of the molecular components for the IDRin human �-cells is critical for the development of aninhibitor of this channel that would function as a glucose-dependent insulin secretagogue for the treatment of type 2diabetes. This study is an attempt to identify the Kvsubunits that are present in human �-cells, with theultimate goal of correlating their biophysical and pharma-cological properties with the currents found in �-cells. The

TABLE 3Summary of expression of Kv channels in primate islets

Subtype PCR ISH/IHC Subtype PCR ISH/IHC

Kv1.1 � ND* Kv4.1 � nonisletKv1.2 � ND Kv4.3 � NDKv1.3 � ND Kv4.4 (�) NDKv1.4 � ND Kv5.1 � NDKv1.5 � ND Kv6.1 � �-cellKv1.6 � nonislet Kv6.2 � �-cellKv1.7 � ND Kv6.3 � NDKv2.1 � �-cell Kv8.1 � NDKv2.2 � �-cell Kv9.1 (�) NDKv3.1 � �-cell Kv9.2 � non–�-cellKv3.2 � �-cell Kv9.3 � �-cellKv3.3 � nonislet Kv10.1 � NDKv3.4 (�)* ND Kv11.1 � ND

*Seen in one of three islet preparations.



initial ISH experiments on both human and Rhesus isletsdemonstrate that expression of the Kv channels underinvestigation exhibit the same pattern in both species. Ourresults combining RT-PCR with ISH and IHC stronglysuggest that Kv2.1 and Kv3.2 are the major subunits in�-cells. In addition, silent subunits Kv6.2 and 9.3 are alsopresent in �-cells (Table 3).

In heterologous expression systems, Kv2.1 and Kv3.2express delayed rectifier-type currents that resemble thosepresent in �-cells (44–46). Therefore, either one or theother or both may contribute to IDR in �-cells. Because thetetraethylammonium ion and hanatoxin sensitivities ofindividually heterologously expressed channels are quitedifferent, it may be possible to use these tools to distin-guish the relative contributions of these channel subtypesto the �-cell IDR (44).

It is interesting that two silent subunits, Kv6.2 andKv9.3, are also expressed in human �-cells. In heterolo-gous expression systems, these subunits are known tocoassemble with subunits from either Kv2 or Kv3 familiesand to modify their function (24,47–49). It remains to bedetermined if this also occurs in �-cells. In addition twoother silent subunits, Kv10.1 and 11.1, previously reportedto be in pancreas and also known to associate withsubunits from Kv2 and Kv3 family (50), are found in islets.Their presence in �-cells and their significance will requirefurther investigation.

It is curious that members from two particular familiesdistribute to different cell types within the islet. Forinstance, Kv2.1 and Kv3.2 distribute to the �-cell, whereasKv2.2 and Kv3.1 are present in �- and �-cells, respectively.This differential distribution has significant implications

FIG. 6. Kv1.6, Kv3.3, and Kv4.1 channels are not expressed in Rhesus pancreatic �-cells. In all sections, cell nuclei were stained with DAPI andare illustrated in blue. All images in this figure were taken from sections of Rhesus pancreas A: Kv1.6 immunoreactive cells, detected with Texasred (red), are located outside of the islet. B: Insulin immunoreactivity labels the same islet as seen in panel A and delineates the �-cells. C:Combination of IHC for Kv1.6 (red) and insulin (green) demonstrate signals on different cells. There is no coexpression as judged by the lackof yellow color. D: Kv3.3 mRNA-containing cells (red) in a section of pancreas. E: Insulin protein-containing cells (green) in the same islet. F:No colocalization (no yellow color) of Kv3.3 mRNA and insulin protein was detected. G: Kv4.1 mRNA-containing cells (red) in a section ofpancreas. H: Insulin protein-containing cells (green) in the same section of the islet. I: No colocalization (no yellow color) of Kv4.1 mRNA andinsulin protein was detected within the islet.



for the development of inhibitors that specifically targetchannels present in �-cells.

There have been reports of Kv1 family channels in islets,�-cells, and insulin-secreting cell lines (16,51,52). In hu-man islets, others (51) have reported that by RT-PCRKv1.1, Kv1.2, and Kv1.4 are not found, while Kv1.5 andKv1.6 were present. In our studies of human islets, onlyKv1.3 and Kv1.6 were identified by RT-PCR, with a veryweak indication for Kv1.7. Kv1.6 is external to the islet, incontrast to the recent report of its presence in rat �-cells(53). While Kv1.4 seems to be absent from human islets byRT-PCR, it appears to be present in rat �-cells by Westernblot and PCR (51), but not in mouse by immunostaining(53). These data could indicate differences in channelcomposition between species and highlights the impor-tance of the identification of the relevant subunits inhuman �-cells.

The identification of different channel types exclusive toeach of the three major cell types found in the isletsuggests that it may be possible to select for cell-type–dependent intervention through block of their respectiveIDRs. All of the Kv subunits tested in islets have been foundin other tissues, but, in general, the exact combination ofsubunits in these tissues is unknown. For the �-cell,determination of IDR composition may aid significantly inthe identification of a glucose-dependent insulin secreta-gogue applicable in type 2 diabetes, without the hypogly-cemic liabilities found with KATP inhibitors.

ACKNOWLEDGMENTS

We would like to thank Drs. Maria Garcia, Jim Herrington,and Owen B. McManus for critical discussion and con-structive comments. We would also like to thank Dr. H.G.Knaus for generously supplying antibodies for Kv1.6 andDr. Jonathan Lakey for supplying human islets.

REFERENCES

1. Hille B: Ion channels of excitable membranes. In Potassium Channels and

Chloride Channels. Sunderland, U.K., Sinauer Associates, 2001, p. 137–1672. Dukes ID, Philipson LH: K� channels: generating excitement in pancreatic

�-cells. Diabetes 45:845–853, 19963. Aguilar-Bryan L, Bryan J: Molecular biology of adenosine triphosphate-

sensitive potassium channels. Endocr Rev 20:101–135, 19994. Miki T, Nagashima K, Seino S: The structure and function of the ATP-

sensitive K� channel in insulin-secreting pancreatic beta-cells. J Mol

Endocrinol 22:113–123, 19995. Ashcroft FM, Gribble FM: Correlating structure and function in ATP-

sensitive K� channels. Trends Neurosci 21:288–294, 19986. Yokoshiki H, Sunagawa M, Seki T, Sperelakis N: ATP-sensitive K� chan-

nels in pancreatic, cardiac, and vascular smooth muscle cells. Am J

Physiol 274:C25–C37, 19987. Ashcroft SJ: The beta-cell KATP channel. J Membr Biol 176:187–206, 20008. Petit P, Loubatieres-Mariani MM: Potassium channels of the insulin-

secreting B cell. Fundam Clin Pharmacol 6:123–134, 19929. Kukuljan M, Goncalves AA, Atwater I: Charybdotoxin-sensitive KCa chan-

nel is not involved in glucose-induced electrical activity in pancreaticbeta-cells. J Membr Biol 119:187–195, 1991

10. Gopel SO, Kanno T, Barg S, Eliasson L, Galvanovskis J, Renstrom E,Rorsman P: Activation of Ca2�-dependent K� channels contributes torhythmic firing of action potentials in mouse pancreatic beta cells. J Gen

Physiol 114:759–770, 199911. Rorsman P, Eliasson L, Renstrom E, Gromada J, Barg S, Gopel S: The cell

physiology of biphasic insulin secretion. News Physiol Sci 15:72–77, 200012. Smith PA, Bokvist K, Arkhammar P, Berggren PO, Rorsman P: Delayed

rectifying and calcium-activated K� channels and their significance foraction potential repolarization in mouse pancreatic beta-cells. J Gen

Physiol 95:1041–1059, 199013. Smith PA, Bokvist K, Rorsman P: Demonstration of A-currents in pancre-

atic islet cells. Pflugers Arch 413:441–443, 1989

14. Zunkler BJ, Trube G, Ohno-Shosaku T: Forskolin-induced block of delayedrectifying K� channels in pancreatic beta-cells is not mediated by cAMP.Pflugers Arch 411:613–619, 1988

15. Philipson LH, Rosenberg MP, Kuznetsov A, Lancaster ME, Worley JF 3rd,Roe MW, Dukes ID: Delayed rectifier K� channel overexpression intransgenic islets and beta-cells associated with impaired glucose respon-siveness. J Biol Chem 269:27787–27790, 1994

16. Roe MW, Worley JF 3rd, Mittal AA, Kuznetsov A, DasGupta S, Mertz RJ,Witherspoon SM 3rd, Blair N, Lancaster ME, McIntyre MS, Shehee WR,Dukes ID, Philipson LH: Expression and function of pancreatic beta-celldelayed rectifier K� channels: role in stimulus-secretion coupling. J Biol

Chem 271:32241–32246, 199617. Eberhardson M, Tengholm A, Grapengiesser E: The role of plasma

membrane K� and Ca2� permeabilities for glucose induction of slowCa2�oscillations in pancreatic beta-cells. Biochim Biophys Acta 1283:67–72, 1996

18. Burge MR, Sood V, Sobhy TA, Rassam AG, Schade DS: Sulphonylurea-induced hypoglycaemia in type 2 diabetes mellitus: a review. Diabetes

Obes Metab 1:199–206, 199919. Del Prato S, Aragona M, Coppelli A, Burge MR, Sood V, Sobhy TA, Rassam

AG, Schade DS: Sulfonylureas and hypoglycaemia: sulphonylurea-inducedhypoglycaemia in type 2 diabetes mellitus: a review. Diabetes Nutr Metab

15: 444–450, 2002 [discussion in 15:450–451, 2002]20. MacDonald PE, Salapatek AM, Wheeler MB: Glucagon-like peptide-1

receptor activation antagonizes voltage-dependent repolarizing K� cur-rents in �-cells: a possible glucose-dependent insulinotropic mechanism.Diabetes 51 (Suppl. 3):S443–S447, 2002

21. Kanno T, Gopel SO, Rorsman P, Wakui M: Cellular function in multicellularsystem for hormone-secretion: electrophysiological aspect of studies onalpha-, beta- and delta-cells of the pancreatic islet. Neurosci Res 42:79–90,2002

22. Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H,Nadal MS, Ozaita A, Pountney D, Saganich M, Vega-Saenz de Miera E, RudyB: Molecular diversity of K� channels. Ann N Y Acad Sci 868:233–285, 1999

23. Zhao B, Rassendren F, Kaang BK, Furukawa Y, Kubo T, Kandel ER: A newclass of noninactivating K� channels from aplysia capable of contributingto the resting potential and firing patterns of neurons. Neuron 13:1205–1213, 1994

24. Stocker M, Hellwig M, Kerschensteiner D: Subunit assembly and domainanalysis of electrically silent K� channel alpha-subunits of the rat Kv9subfamily. J Neurochem 72:1725–1734, 1999

25. Zhu XR, Netzer R, Bohlke K, Liu Q, Pongs O: Structural and functionalcharacterization of Kv6.2 a new gamma-subunit of voltage-gated potassiumchannel. Receptors Channels 6:337–350, 1999

26. Kerschensteiner D, Stocker M: Heteromeric assembly of Kv2.1 with Kv9.3:effect on the state dependence of inactivation. Biophys J 77:248–257, 1999

27. Sano Y, Mochizuki S, Miyake A, Kitada C, Inamura K, Yokoi H, Nozawa K,Matsushime H, Furuichi K: Molecular cloning and characterization ofKv6.3, a novel modulatory subunit for voltage-gated K� channel Kv2.1.FEBS Lett 512:230–234, 2002

28. Su J, Yu H, Lenka N, Hescheler J, Ullrich S: The expression and regulationof depolarization-activated K� channels in the insulin-secreting cell lineINS-1. Pflugers Arch 442:49–56, 2001

29. Betsholtz C, Baumann A, Kenna S, Ashcroft FM, Ashcroft SJ, Berggren PO,Grupe A, Pongs O, Rorsman P, Sandblom J: Expression of voltage-gatedK� channels in insulin-producing cells: analysis by polymerase chainreaction. FEBS Lett 263:121–126, 1990

30. Philipson LH, Hice RE, Schaefer K, LaMendola J, Bell GI, Nelson DJ,Steiner DF: Sequence and functional expression in Xenopus oocytes of ahuman insulinoma and islet potassium channel. Proc Natl Acad Sci U S A

88:53–57, 199131. Bubacz DG, Dukes ID, McLean EW, Noe RA, Peat AJ, Szewczyk JR,

Thomson SA, Worley JF: Kv2.1 antagonists. WO 99/32487, 1999 (PCT/EP98/08085)

32. MacDonald PE, Sewing S, Wang J, Joseph JW, Smukler SR, Sakellaropou-los G, Saleh MC, Chan CB, Tsushima RG, Salapatek AM, Wheeler MB:Inhibition of Kv2.1 voltage-dependent K� channels in pancreatic beta-cellsenhances glucose-dependent insulin secretion. J Biol Chem 277:44938–44945, 2002

33. MacDonald PE, Wang G, Tsuk S, Dodo C, Kang Y, Tang L, Wheeler MB,Cattral MS, Lakey JR, Salapatek AM, Lotan I, Gaisano HY: Synaptosome-associated protein of 25 kilodaltons modulates Kv2.1 voltage-dependentK� channels in neuroendocrine islet beta-cells through an interaction withthe channel N terminus. Mol Endocrinol 16:2452–2461, 2002

34. Koch RO, Wanner SG, Koschak A, Hanner M, Schwarzer C, KaczorowskiGJ, Slaughter RS, Garcia ML, Knaus HG: Complex subunit assembly of



neuronal voltage-gated K� channels: basis for high-affinity toxin interac-tions and pharmacology. J Biol Chem 272:27577–27581, 1997

35. Fiedor P, Rowinski W, Licinska I, Mazurek AP, Hardy MA: The survivalidentification of pancreatic islets of Langerhans: in vitro and in vivo effectsof two dithizone preparations on staining of rat and human islets ofLangerhans-preliminary study (Part I). Acta Pol Pharm 52:431–436, 1995

36. Lynch KR, O’Neill GP, Liu Q, Im DS, Sawyer N, Metters KM, Coulombe N,Abramovitz M, Figueroa DJ, Zeng Z, Connolly BM, Bai C, Austin CP,Chateauneuf A, Stocco R, Greig GM, Kargman S, Hooks SB, Hosfield E,Williams DL, Jr, Ford-Hutchinson AW, Caskey CT, Evans JF: Character-ization of the human cysteinyl leukotriene CysLT1 receptor. Nature

399:789–793, 199937. Figueroa DJ, Hess JF, Ky B, Brown SD, Sandig V, Hermanowski-Vosatka A,

Twells RC, Todd JA, Austin CP: Expression of the type I diabetes-associated gene LRP5 in macrophages, vitamin A system cells, and theislets of Langerhans suggests multiple potential roles in diabetes. J His-

tochem Cytochem 48:1357–1368, 200038. Kalman K, Nguyen A, Tseng-Crank J, Dukes ID, Chandy G, Hustad CM,

Copeland NG, Jenkins NA, Mohrenweiser H, Brandriff B, Cahalan M,Gutman GA, Chandy KG: Genomic organization, chromosomal localiza-tion, tissue distribution, and biophysical characterization of a novelmammalian Shaker-related voltage-gated potassium channel, Kv1.7. J Biol

Chem 273:5851–5857, 199839. Klein T, Ling Z, Heimberg H, Madsen OD, Heller RS, Serup P: Nestin is

expressed in vascular endothelial cells in the adult human pancreas.J Histochem Cytochem 51:697–706, 2003

40. Baetens D, Vasko M, Unger RH, Orci L: Ultrastructural detection ofgranulated cells in the autonomic ganglia of the rat pancreas. Diabetologia

28:841–846, 198541. Persson-Sjogren S, Zashihin A, Forsgren S, Ushiki T, Watanabe S, Casto-

rina S, Romeo R, Marcello MF: Nerve cells associated with the endocrinepancreas in young mice: an ultrastructural analysis of the neuroinsularcomplex type I. Histochem J 33:373–378, 2001

42. Ushiki T, Watanabe S: Distribution and ultrastructure of the autonomicnerves in the mouse pancreas. Microsc Res Tech 37:399–406, 1997

43. Castorina S, Romeo R, Marcello MF: Immunohistochemical study ofintrinsic innervation in the human pancreas. Boll Soc Ital Biol Sper 72:1–7,1996

44. Swartz KJ, MacKinnon R: An inhibitor of the Kv2.1 potassium channelisolated from the venom of a Chilean tarantula. Neuron 15:941–949, 1995

45. Rudy B, McBain CJ: Kv3 channels: voltage-gated K� channels designed forhigh-frequency repetitive firing. Trends Neurosci 24:517–526, 2001

46. Kelly RP, Sutton R, Ashcroft FM: Voltage-activated calcium and potassiumcurrents in human pancreatic beta-cells. J Physiol 443:175–192, 1991

47. Post MA, Kirsch GE, Brown AM: Kv2.1 and electrically silent Kv6.1potassium channel subunits combine and express a novel current. FEBS

Lett 399:177–182, 199648. Salinas M, Duprat F, Heurteaux C, Hugnot JP, Lazdunski M: New modu-

latory alpha subunits for mammalian Shab K� channels. J Biol Chem

272:24371–24379, 199749. Blaine JT, Ribera AB: Heteromultimeric potassium channels formed by

members of the Kv2 subfamily. J Neurosci 18:9585–9593, 199850. Ottschytsch N, Raes A, Van Hoorick D, Snyders DJ: Obligatory heterotet-

ramerization of three previously uncharacterized Kv channel alpha-sub-units identified in the human genome. Proc Natl Acad Sci U S A

99:7986–7991, 200251. MacDonald PE, Ha XF, Wang J, Smukler SR, Sun AM, Gaisano HY,

Salapatek AM, Backx PH, Wheeler MB: Members of the Kv1 and Kv2voltage-dependent K� channel families regulate insulin secretion. Mol

Endocrinol 15:1423–1435, 200152. MacDonald PE, Wheeler MB: Voltage-dependent K� channels in pancreatic

beta cells: role, regulation and potential as therapeutic targets. Diabetolo-

gia 46:1046–1062, 200353. Gopel SO, Kanno T, Barg S, Rorsman P: Patch-clamp characterisation of

somatostatin-secreting-cells in intact mouse pancreatic islets. J Physiol

528:497–507, 2000



Documents

Expression of Voltage-Gated Potassium Channels in …...Expression of Voltage-Gated Potassium Channels in Human and Rhesus Pancreatic Islets Lizhen Yan,1 David J. Figueroa,2 Christopher