Er

JG

a

ARA

KPCSG

1

refesd1dmcMi(attiCa

l

0d

Postharvest Biology and Technology 55 (2010) 91–96

Contents lists available at ScienceDirect

Postharvest Biology and Technology

journa l homepage: www.e lsev ier .com/ locate /postharvbio

xpression of sHSP genes as affected by heat shock and cold acclimation inelation to chilling tolerance in plum fruit

i-hao Sun1, Jian-ye Chen1, Jian-fei Kuang, Wei-xin Chen, Wang-jin Lu ∗

uangdong Key Laboratory for Postharvest Science, College of Horticultural Science, South China Agricultural University, Guangzhou 510642, People’s Republic of China

r t i c l e i n f o

rticle history:eceived 30 June 2009ccepted 5 September 2009

a b s t r a c t

Three full-length cytosol small heat shock protein (sHSP) genes, including two class I sHSP (CI sHSP) andone class II sHSP (CII sHSP) cDNAs, termed Ps-CI sHSP1, Ps-CI sHSP2 and Ps-CII sHSP1 respectively, wereisolated and characterized from plum fruit at harvest. Their expression in relation to heat shock and cold

eywords:lum fruithilling injurymall heat shock proteinene expression

acclimation-induced chilling tolerance were investigated. Heat shock treatment by dipping the fruit inwater at 55 ◦C hot for 2 min and cold acclimation by conditioning the fruit at 8 ◦C for 5 d prior to storage at2 ◦C could effectively reduce malondialdehyde (MDA) content and alleviate chilling injury. Furthermore,accumulation of Ps-CII sHSP1 mRNA transcripts in the fruit during the subsequent storage at 2 ◦C wasremarkably enhanced by heat shock and cold acclimation treatments. These data suggest that heat shockand cold acclimation treatments induced the expression of Ps-CII sHSP1, which may be involved in chilling

ed by

tolerance of the fruit caus

. Introduction

Plums are highly perishable due to their rapid rate of ripening atoom temperature and storage at low temperature is used widely toxtend postharvest fruit life and maintain quality. However, plumruit are particularly susceptible to chilling injury (CI) (Manganarist al., 2008). Flesh browning and translucency are two of the main CIymptoms observed and the susceptibility of fruit to chilling mainlyepends on the cultivar and storage temperature (Crisosto et al.,999). Flesh browning (internal breakdown) appears as a browniscolouration of the flesh and flesh translucency (gel breakdown)anifests itself as a translucent gelatinous breakdown of the meso-

arp tissue around the stone (Taylor et al., 1993; Candan et al., 2008;anganaris et al., 2008). Chilling symptoms mainly develop dur-

ng shelf-life after removal of fruit from low temperature storageCrisosto et al., 1999). Therefore, it is important to develop ways tolleviate CI of fruit stored at low temperature and to understandhe underlying CI molecular mechanisms. Ethylene contributes tohe development of CI, and application of hot-water dips or 1-MCPn combination with modified atmosphere packaging can prevent

I in plum fruit (Abu-Kpawoh et al., 2002; Candan et al., 2008; Khannd Singh, 2008; Manganaris et al., 2008).

It has been suggested that exposure to high or intermediateow temperatures can be used as effective postharvest methods for

∗ Corresponding author. Tel.: +86 20 85280229; fax: +86 20 85282107.E-mail address: wjlu@scau.edu.cn (W.-j. Lu).

1 These authors contributed equally to this work.

925-5214/$ – see front matter © 2009 Elsevier B.V. All rights reserved.oi:10.1016/j.postharvbio.2009.09.001

these treatments.© 2009 Elsevier B.V. All rights reserved.

alleviating CI at subsequent low temperatures. Heat pretreatmentshave been shown to be effective in controlling decay in citrus (Poratet al., 2000a), reducing chilling injury in tomato fruit (McDonaldet al., 2000), mangoes (Pesis et al., 1997), grapefruit (Porat et al.,2000b), avocados (Woolf et al., 1995) and grape berries (Zhanget al., 2005), and maintaining cold storage quality of strawberries(Vicente et al., 2002), peaches (Zhou et al., 2002) and pears (Abreuet al., 2003).

Plant organisms respond to thermal stress with inducted syn-thesis of heat shock proteins (HSPs) (Brodl, 1989; Vierling, 1991).HSPs comprise a diverse group of proteins, ranging in molecularweight from 15 to 115 kDa, which are believed to play a major rolein thermotolerance (Howarth and Ougham, 1993). Among theseproteins, small HSPs (sHSPs) represent the major family of HSPsinduced by heat stress in plants (Waters et al., 1996). The molecularmass of these sHSPs ranges from 15 to 30 kDa, and plant sHSPs canbe divided into six classes based on amino acid sequence, immuno-logical cross-reactivity, and intracellular localization (Waters etal., 1996). Three classes (classes I, II and III) are localized in thecytosol or nucleus, and the other three in the plastids (Vierling,1991), endoplasmic reticulum (Helm et al., 1995) and mitochondria(Lenne et al., 1995; LaFayette et al., 1996).

It has also been reported that mRNA levels of various sHSPs mayincrease following exposure to low temperatures; thus sHSPs may

have chaperone activity under low-temperature stress (Sung et al.,2003; Wang et al., 2004; Mamedov and Shono, 2008). In tomatofruit, grape berries and grapefruit, there is increasing evidence sug-gesting that sHSPs could be involved in the ability of heat shockto increase cross-resistance in harvested fruit to chilling tolerance

9 ogy an

(Htt

ictTttei

2

2

wGtuS1

2

pc(2ffwapet5e

2

co1(tp

2

dFefamtaiM

2 J.-h. Sun et al. / Postharvest Biol

Sabehat et al., 1998; Zhang et al., 2005; Sapitnitskaya et al., 2006).owever, information is needed on the mechanisms underlying

his alleviation of chilling injury and of chilling tolerance in relationo sHSP expression.

In the present study, three full-length cytosol sHSP genes,ncluding two class I sHSP (CI sHSP) and one class II sHSP (CII sHSP)DNAs, termed Ps-CI sHSP1, Ps-CI sHSP2 and Ps-CII sHSP1 respec-ively, were isolated and characterized from plum fruit at harvest.heir expression as affected by heat shock and cold acclimationreatments, and their relation to chilling tolerance were also inves-igated. Our results suggest that expression of Ps-CII sHSP1 genenhanced by heat shock and cold acclimation treatments may benvolved in chilling tolerance in harvested plum fruit.

. Materials and methods

.1. Plant materials

Preclimacteric fruit of plum (Prunus salicina L. cv. Sanhua)ere harvested from a commercial orchard in Weng-yuan County,uangdong province, China. Fruit were transported to the labora-

ory within 6 h, selected for freedom from visual defects and forniformity of weight, shape and maturity, washed in 500 mg L−1

portak (a.i. prochloraz) fungicide solution to control disease formin and then air-dried at 25 ◦C for 2 h.

.2. Treatments

The fruit were divided at random into three groups of 800 fruiter group for the following treatments: group 1 (control, non-onditioned group) fruit were placed into unsealed plastic bags0.04 mm thick) and then stored at 2 ◦C for 50 d. Fruit for group

(heat shock pretreatment) were dipped into hot water at 55 ◦Cor 2 min, then placed into unsealed plastic bags and stored at 2 ◦Cor 50 d, while fruit for group 3 (cold acclimation pretreatment)ere firstly stored at 8 ◦C for 5 d in unsealed plastic bags for cold

cclimation, and then transferred to 2 ◦C for 50 d. During low tem-erature storage, sub-samples of these three groups were takenvery 10 d for analyses. For chilling injury evaluation, fruit fromhe three different treatment groups were transferred to 22 ◦C after0 d of storage at 2 ◦C, and stored at 22 ◦C for 4 d. Chilling injury wasvaluated every day.

.3. Chilling injury evaluation

The incidence of chilling injury was assessed on three fruit repli-ates (with each replicate contained 20 individual fruit) after 50 df storage at 2 ◦C, immediately after removal from storage, and after, 2, 3 and 4 d of shelf-life at 22 ◦C, by the method of Candan et al.2008). Symptoms of chilling injury were visually assessed by cut-ing each fruit in half along its equatorial axis and determining theercentage of fruit affected by chilling.

.4. Determinations of membrane oxidation

Membrane oxidation was assessed by determining the malon-ialdehyde (MDA) concentration according to Chen et al. (2008).lesh tissue samples (1.0 g) from three individual fruit were homog-nized in 4 mL of 10% trichloroacetic acid and then centrifugedor 15 min at 10,000 × g. The supernatant phase was collectednd 1 mL was mixed with 3 mL of 0.6% thiobarbituric acid. The

ixture was heated to 100 ◦C for 20 min, quickly cooled and cen-

rifuged at 10,000 × g for 10 min. The supernatant was collectednd absorbances at 532, 600 and 450 nm were then measuredn a Shimadzu UV spectrophotometer (Shimadzu UV-2450). The

DA concentration was calculated according to the formula:

d Technology 55 (2010) 91–96

6.45 × (A532 − A600) − 0.56 × A450. Each assessment was repeatedthree times.

2.5. RNA extraction, isolation of plum sHSP full-length cDNAs

Total RNA from plum flesh tissue was extracted using thehot borate method of Wan and Wilkins (1994). Frozen tissues(10 g) were ground to a fine powder in a mortar using a pes-tle in the presence of liquid nitrogen. The extracted total RNAwas used as templates for RT-PCR. The product (the first-strandcDNA) was subjected to PCR amplification. Degenerate primersof CI sHSPs (i.e. sense: 5′-AGCAACRTNTTCGAYCCNTTYTC-3′ andantisense: 5′-CTNCK YTCCAYRCGRTGCCA-3′) and CII sHSPs (i.e.sense: 5′-CCACGGTCACCTTCAGC ACNCCRTCYTG-3′ and antisense:5′-GCGATCTTCACGTCGATGGTYTTNGGYTT-3′) were designed withreference to the conserved amino acid sequences of sHSPs. Reac-tions for the RT-PCR were subjected to one cycle of 94 ◦C for 3 min,35 cycles each at 94 ◦C for 1 min, 45 ◦C for 2 min and 72 ◦C for 2 min,and then one cycle of 72 ◦C for 10 min. PCR products of the predictedsize (about 400 bp in length for both CI sHSP and CII sHSP) werepurified and cloned into pGEM-T easy vector (Promega, USA). Thenucleotide sequences of the cDNA inserts were determined usingthe thermo sequenase dye terminator cycle sequencing kit and a3730 DNA sequencer (PerkinElmer Applied Biosystems).

Consequently, 3′- or 5′-rapid amplification of cDNA ends(3′- or 5′-RACE-PCR) was performed using cDNA amplificationkits (Takara, Shiga, Japan) according to the manufacturer’s pro-tocol. In order to amplify 3′-end and 5′-end fragments, thespecific primers for Ps-CI sHSP1 (3′-RACE: outer, AGAAGAG-GTGAAGGTGGAGG and inner, GCGGAGAGAGGAAAATAGAG; and5′-RACE: outer, TGACACTCAAAACCCCATTCTCC, middle, TCTGTGC-CACTGGTCGTTCTTGT, and inner, TCAACCTCCACCTTCACCTCTTC),Ps-CI sHSP2 (3′-RACE: outer, GACATCTGGGACCCCTTTGA and inner,GAGGAGGTGAAAGTTGAGGT; and 5′-RACE: outer, CCTCCCGT-CATCAACCTCAACTT, middle, ATGTGGGCTTCTGGGGTCTCTTT, andinner, AGTCAATGCGAGTGTTGGCGATG), and Ps-CII sHSP1 (3′-RACE:outer, GAGACATCAAGGTCCAGGTG and inner, AGGAAGAGGGAG-GAGGAGAA; and 5′-RACE: outer, AGTCACAGTCAGGACCCCATCTT,middle, TTCTCAGGCAGCACAAACTTCCA, and inner, AGAAGCA-CATTGTCGTCCTCCAC) were designed based on the nucleotidesequences of the cDNA fragments already cloned by RT-PCR. The 3′-and 5′-RACE-PCR products were cloned and sequenced as describedabove.

2.6. DNA sequence analysis, alignment, and comparisons

Identification of nucleotide sequences from RT-PCR cloneswas established using the NCBI Blast program [http://www.ncbi.nlm.nih.gov/BLAST]. Alignment and comparison ofsequence were made using the ClustalW program (http://www.ebi.ac.uk/clustalw). Open reading frame and protein pre-diction were made using NCBI ORF Finder [http://www.ncbi.nlm.nih.gov/gorf/gorf.html]. The theoretical isoelectricpoint (pI) and mass values for mature peptides were cal-culated using the PeptideMass program [http://us.expasy.org/tools/peptide-mass.html].

2.7. Northern blot analysis

Total RNA (10 �g) was separated on a 1.2% agarose-formadehyde gel and capillary blotted onto positively charged

nylon membrane (Biodyne® B, 0.45 �m, PALL Co. Sarasota, FL). TheRNA was fixed to the membrane by baking for 2 h at 80 ◦C andthen cross-linked to the membranes using an ultraviolet cross-linker (Amersham Biosciences, Piscataway, NJ). The membraneswere prehybridized for more than 3 h in SDS buffer [50% deionized

J.-h. Sun et al. / Postharvest Biology and Technology 55 (2010) 91–96 93

Table 1The sequences of specific primers used for the syntheses of three DIG-labeled Ps-sHSPs probes.

Name DIG-For primers (5′–3′) DIG-Rev primers (5′–3′)

Ps-CI sHSP1 TCCCTTCGTCCTCATCACTC CACTCAAAACCCCATTCTCC

fnafdDmwFwts(cw

2

dtmwS

3

3

flsssiamesCci2scs(e2

3

aaa

Fig. 1. Changes in the incidence of chilling injury (flesh browning) in ‘Sanhua’ plumfruit during 4 d of shelf-life at 22 ◦C. Prior to low temperature storage, fruit weresubjected to heat shock or cold acclimation. Fruit were kept in cold storage for 50 d,then removed from 2 ◦C to 22 ◦C to assess the incidence of chilling injury after 0, 1, 2,3 and 4 days of shelf-life at 22 ◦C. Values represent the means of 3 replicate samples

A BLAST search of GenBank revealed that Ps-CI sHSP1 shared 81%identity with that of cytosol CI RcsHSP17.8 (ABK32539) from Chi-nese rose and Ps-CI sHSP2 shared 96% or 90% identity with thatof cytosol CI PpsHSP17.3 (AAR99375) from peach or cytosol CIMdsHSP17.5 (ACC86142) from apple, while Ps-CII sHSP1 shared 96%

Ps-CI sHSP2 ACATCTGGGACCCCTTTGAG TCCTTGGGCACAGTCACGGTPs-CII sHSP1 AACGAGGAGCCTGACAAATC GACCCCATCTTGGCAAACAG

ormamide (v/v), 5× SSC, 7% SDS, 2% blocking reagent (Roche Diag-ostics, Mannheim, Germany), 50 mM sodium-phosphate (pH 7.0)nd 0.1% N-lauroylsarcosine (w/v)] and hybridization was then per-ormed overnight in the same buffer containing the gene-specificigoxin (DIG)-labeled probes at 45 ◦C. Probes were prepared with aIG probe synthesis kit (Roche Applied Science, Mannheim, Ger-any) according to the manufacturer’s instructions. All probesere synthesized from the 3′-untranslated regions of the genes.

ollowing hybridization, membranes were washed twice for 10 minith 2× SSC containing 0.1% SDS at 25 ◦C, followed by washing

wice for 30 min in 0.1× SSC containing 0.1% SDS at 62 ◦C. Theignals were detected with chemiluminescence using CDP-StarTM

Roche Diagnostics) as described by the manufacturer. The spe-ific primers used for synthesis of three Ps-sHSP DIG-labeled probesere listed in Table 1.

.8. Statistics

The experiment was arranged in a completely randomizedesign. Each sample time point for each treatment comprisedhree independent replicates. Data are plotted in figures as

eans ± standard errors (S.E.M.). Least significant differences (LSD)ere calculated to compare significant effects at the 5% level using

PSS software (version 16.0).

. Results and discussion

.1. Changes in incidence of chilling injury

The first symptom of chilling injury observed in the fruit wasesh browning. This first appeared during shelf-life after 30 d oftorage at 2 ◦C and flesh browning increased as low temperaturetorage duration increased, accompanied by the appearance of amall degree of gel breakdown (data not shown). Changes in thencidence of chilling injury during the shelf-life period at 22 ◦Cfter 50 d of storage at 2 ◦C is shown in Fig. 1. Incidence increasedarkedly when fruit were removed from 2 to 22 ◦C (Fig. 1). How-

ver, both heat shock and cold acclimation treatments prior totorage at 2 ◦C significantly reduced the incidence of chilling injury.ompared with the incidence of chilling injury in non-conditionedontrol fruit, heat shock or cold acclimation treatment reduced thencidence of chilling injury by 18 or 29% after 4 d of shelf-life at2 ◦C, respectively (Fig. 1). These data further suggested that expo-ure to high or low temperature prior to low temperature storageould reduce chilling injury at the subsequent low temperature. Aimilar result has also been obtained in other fruit, including tomatoMcDonald et al., 2000), mango (Pesis et al., 1997), grapefruit (Poratt al., 2000b), grape (Zhang et al., 2005) and banana (Chen et al.,008).

.2. Changes in membrane oxidation

The MDA content of heat shock-treated plum fruit increased tolesser degree than that of the control at the beginning of stor-

ge at 2 ◦C (Fig. 2). The MDA content in control, heat shock or coldcclimation-treated fruit remained almost stable during the stor-

of 20 fruit ± S.E.M. No chilling injury symptoms were observed in cold acclimation-treated fruit at day 0. Different letters indicate a statistical difference at 5% levelamong treatments according to Duncan’s multiple range test.

age period of 0–20 d at 2 ◦C (Fig. 2). However, it increased at 30 d ofstorage at 2 ◦C, indicating membrane damage, in accordance withthe observation that the chilling injury symptoms first appearedduring shelf-life after 30 d of storage at 2 ◦C (Fig. 2). Moreover, theMDA content in heat shock or cold acclimation-treated fruit wasconsiderably lower than that in control fruit at a storage time of 40and 50 d at 2 ◦C (Fig. 2). These data clearly indicated that damagecaused by chilling stress could be alleviated by heat shock or coldacclimation treatment.

3.3. Identification of Ps-sHSP genes and sequence analysis

Three fragments of different cytosol Ps-sHSP homologues ofapproximately 400 bp, including two CI sHSP and one CII sHSPcDNAs, were cloned from plum fruit by RT-PCR using degenerateprimers, and their corresponding full-length sequences, desig-nated Ps-CI sHSP1, Ps-CI sHSP2 and Ps-CII sHSP1, were subsequentlyamplified by RACE-PCR and deposited in GenBank (Ps-CI sHSP1,GQ850381; Ps-CI sHSP2, GQ850382 and Ps-CII sHSP1, GQ850383).

Fig. 2. Changes in MDA content in ‘Sanhua’ plum fruit during 50 d of storage at 2 ◦C.Prior to chilling storage, fruit were subjected to heat shock or cold acclimation. Eachvalue represents the mean ± S.E.M. of three replicates. Vertical bars indicate theS.E.M. Different letters indicate a statistical difference at 5% level among treatmentsaccording to Duncan’s multiple range test.

94 J.-h. Sun et al. / Postharvest Biology and Technology 55 (2010) 91–96

Fig. 3. Alignment of the three Ps-sHSP predicted proteins with other plant sHSP proteins. Black shading identifies fully conserved residues by ten of the sHSPs. Conservativeamino acid substitutions are represented by gray shading. Gaps were introduced to optimize alignment. Multiple alignments was done by ClustalW and viewed withBOXSHADE program, and manually edited. The two consensus subdomains in sHSPs were boxed. A putative nuclear localization signal and a polyproline motif PPPEPKKP/Sa SPs wa 3045P 94); to

oapar13at116tw

stLn

t the carboxyl end of CII sHSPs proteins were marked with ‘*’ and ‘#’. Shown sHpple, MdsHSP1 (accession no. AAF34133); tomato, LesHSP17.7 (accession no. AADdsHSP17.5 (accession no. AAD41409); papaya, CpsHSP17.7 (accession no. AAP737

r 81% identity with that of cytosol CII PdsHSP17.5 (AAD41409) fromlmond or cytosol CII CpsHSP17.7 (AAP73794) from papaya, at therotein level. Ps-CI sHSP1 cDNA (711 bp), Ps-CI sHSP2 cDNA (774 bp)nd Ps-CII sHSP1 cDNA (795 bp) consisted of a 5′-untranslatedegion of 88 bp, an ORF of 477 bp and a 3′-untranslated region of46 bp, a 5′-untranslated region of 65 bp, an ORF of 465 bp and a′-untranslated region of 244 bp, a 5′-untranslated region of 99 bp,n ORF of 471 bp and a 3′-untranslated region of 225 bp, respec-ively. They encoded the predicted polypeptides of 158, 154 and56 amino acids, with the predicted molecular weights of 18.14,7.48 and 17.53 kDa, respectively. In addition, Ps-CI sHSP1 shared4.6% identity with that of Ps-CI sHSP2, Ps-CI sHSP1 shared 34% iden-ity with that of Ps-CII sHSP1, and Ps-CI sHSP2 shared 33% identityith that of Ps-CII sHSP1.

The optimal multiple sequence alignment in Fig. 3 identifieseveral conserved amino acids among the three Ps-sHSPs andhe other plant cytosolic sHSP. Among these sHSP proteins, onlyesHSP17.7 (accession no. AAD30452) and LesHSP17.8 (accessiono. AAD30453) have been indicated to be related to chilling tol-

ere the cytosol CI sHSPs including peach, PpsHSP17.3 (accession no. AAR99375);2), LesHSP17.8 (accession no. AAD30453) and cytosol CII sHSPs including almond,mato, LesHSP17.4 (accession no. AAC36312).

erance according to the GeneBank database of NCBI (unpublisheddata). The carboxyl end terminus of these three Ps-sHSP deducedpeptides contains the conserved ‘heat shock’ domain. The con-served domain consists of two subdomains I and II separated bya variable length hydrophilic region. The subdomain I contains themotif P-X14-GVL (where X is any amino acid) and the subdomain IIconsists of a similar motif P-X14-N-V/L/I-V/L/I (as signature typ-ical of sHSPs) (Fig. 3) (Waters, 1995; Ramakrishna et al., 2003).In addition, all of the deduced peptides of CII sHSPs including Ps-CII sHSP1 contained a conserved basic amino acid sequence (RKR)(Fig. 3), corresponding to a putative Xenopus type nuclear local-ization signal (NLS), which is responsible for the shuttling of thesHSPs from cytoplasm to the nucleus during stress (Robbins et al.,1991; Kadyrzhanova et al., 1998). These CII sHSP peptides also con-

tained a polyproline motif PPPEPKKP/S at the carboxyl end (Fig. 3),which may be responsible for determining specific signal transduc-tion pathways (Pawson, 1995). These results indicated that thesethree Ps-sHSPs shared common features with sHSPs obtained fromother plants.

J.-h. Sun et al. / Postharvest Biology an

Fig. 4. Changes in mRNA accumulation of three Ps-sHSP genes in control (A), heatssar

3t

oeiaPptasiaomoPt

hock (B) and cold acclimation (C) treated ‘Sanhua’ plum fruit during subsequenttorage at 2 ◦C for 50 d. Total RNA (10 �g per lane) was used for northern blot analysisnd hybridized with gene-specific DIG-labeled probes. Ethidium bromide stainedRNA was shown as the loading control.

.4. Differential accumulation of Ps-sHSPs mRNAs during lowemperature storage

To try to determine the mechanisms of acquisition of heat shockr cold acclimation-induced chilling tolerance in relation to thexpressions of Ps-sHSP genes, accumulation of each Ps-sHSP mRNAn control, heat shock and cold acclimation-treated plum fruit wasnalyzed by northern blot hybridization. As shown in Fig. 4, threes-sHSPs exhibited different expression patterns during low tem-erature storage. Accumulation of both Ps-CI sHSP1 and Ps-CII sHSP1ranscripts in fruit were enhanced by heat shock (Fig. 4B) and coldcclimation treatments (Fig. 4C) prior to storage at 2 ◦C (at day 0 oftorage) compared with the corresponding controls (Fig. 4A). Dur-ng the subsequent chilling storage period, mRNAs of Ps-CI sHSP1nd Ps-CI sHSP2 in control and cold acclimation-treated fruit obvi-

usly decreased (Fig. 4A and C), while Ps-CI sHSP1 and Ps-CI sHSP2RNAs in heat shock-treated fruit increased at day 1 or day 10

f storage, then gradually decreased thereafter (Fig. 4B). However,s-CII sHSP1 mRNAs in control or cold acclimation and heat shock-reated fruit notably accumulated at day 10, and remained almost

d Technology 55 (2010) 91–96 95

constant over 20–50 d of storage at 2 ◦C. Moreover, greater expres-sion of Ps-CII sHSP1 was also observed in the heat shock or coldacclimation-treated fruit than in control fruit (Fig. 4A–C). Theseresults revealed that both heat shock and cold acclimation treat-ments significantly induced the expression of Ps-CII sHSP1 of fruitduring subsequent low temperature storage. Similar results werealso reported in heat-treated tomato fruit where increased tran-script abundance of HSPs, especially class II sHSPs, was correlatedwith protection against CI (Ding et al., 2001).

Although HSPs are known as a group of evolutionarily conservedproteins synthesized when organisms respond to high tempera-ture, many studies have shown that HSPs are also correlated withthe chilling tolerance (reviewed by Sevillano et al., 2009). Collinset al. (1995) first confirmed the direct relationship between coldtolerance and HSP expression patterns. Accumulations of sHSPgenes in tomato, avocado, grapefruit and apple were induced byhigh temperature and were also detected when the heated fruitwere transferred to low temperature (Kadyrzhanova et al., 1998;Woolf et al., 1999; Porat et al., 2000b; Wang et al., 2001). It hasbeen suggested that the protective effect of sHSPs against stressis due to their chaperone activity and their function as membrane-stabilizing factors (Török et al., 2001; Tsvetkova et al., 2002). Hence,sHSPs might play a specific role in the acquisition of tolerance tochilling stress following heat or cold acclimation pretreatment. Ourresults further confirmed this hypothesis. Heat shock or cold accli-mation pretreatment induced the accumulations of Ps-CII sHSP1mRNA (Fig. 4A–C), and maintained in lower levels of MDA con-tents (Fig. 2) and incidence of chilling injury (Fig. 1) during chillingstorage. It was noteworthy that the expression of these three Ps-sHSP genes were initially higher in the heat shock-treated fruitand mRNAs of Ps-CI sHSP1 and Ps-CI sHSP2 in control and coldacclimation-treated fruit decreased during low temperature stor-age (Fig. 4A and C), indicating that Ps-CI sHSP1 and Ps-CI sHSP2might be involved in other stress responses, other than chillingstress, since there exist many reports that sHSPs are also inducedby other stresses, such as drought, salinity, pathogens, oxidativeand wounding stresses (Wang et al., 2004; Neta-Sharir et al., 2005;Linda-Chang et al., 2007; Maimbo et al., 2007).

In conclusion, our results show that heat shock and cold accli-mation treatments induced chilling tolerance of plum fruit andenhanced the expression of Ps-CII sHSP1 of fruit during subsequentlow temperature storage. Further studies are needed to fully under-stand the protective role of Ps-CI sHSP1 and Ps-CI sHSP2 in otherstresses.

Acknowledgement

This work was supported in part by the National Key Tech-nology R&D Program of China (grant Nos. 2006BAD22B05 and2006BAD22B04).

References

Abreu, M., Beirao-da-Costa, S., Goncalves, E.M., Beirao-da-Costa, M.L., Moldao-Martins, M., 2003. Use of mild heat pre-treatments for quality retention offresh-cut ‘Rocha’ pear. Postharvest Biol. Technol. 30, 153–160.

Abu-Kpawoh, J.C., Xi, Y.F., Zhang, Y.Z., Jin, Y.F., 2002. Polyamine accumulation fol-lowing hot-water dips influences chilling injury and decay in ‘Friar’ plum fruit.J. Food Sci. 67, 2649–2653.

Brodl, M.R., 1989. Regulation of the synthesis of normal cellular proteins during heatshock. Physiol. Plant 75, 439–443.

Candan, A.P., Graell, G., Larrigaudière, C., 2008. Roles of climacteric ethylene in thedevelopment of chilling injury in plums. Postharvest Biol. Technol. 47, 107–112.

Chen, J.Y., He, L.H., Jiang, Y.M., Wang, Y., Joyce, D.C., Ji, Z.L., Lu, W.J., 2008. Role of

phenylalanine ammonia-lyase in heat pretreatment-induced chilling tolerancein banana fruit. Physiol. Plant 132, 318–328.

Collins, G.G., Nie, X.L., Saltveit, M.E., 1995. Heat shock proteins and chilling sensitivityof mung bean hypocotyls. J. Exp. Bot. 46, 795–802.

Crisosto, C.H., Mitchell, F.G., Ju, Z.G., 1999. Susceptibility to chilling injury of peach,nectarine, and plum cultivars grown in California. J. Hortic. Sci. 34, 1116–1118.

9 ogy an

D

H

H

K

K

L

L

L

M

M

M

M

N

PP

P

P

R

R

6 J.-h. Sun et al. / Postharvest Biol

ing, C.K., Wang, C.Y., Gross, K.C., Smith, D.L., 2001. Reduction of chilling injuryand transcript accumulation of heat shock proteins in tomato fruit by methyljasmonate and methyl salicylate. Plant Sci. 161, 1153–1159.

elm, K.W., Schmeits, J., Vierling, E., 1995. An endomembrane-localized small heat-shock protein from Arabidopsis thaliana. Plant Physiol. 107, 287–288.

owarth, C.J., Ougham, H.J., 1993. Gene expression under temperature stresses. NewPhytol. 125, 1–26.

adyrzhanova, D.K., Vlachonasios, K.E., Ververidis, P., Dilley, D.R., 1998. Molecularcloning of a novel heat induced/chilling tolerance related cDNA in tomato fruitby use of mRNA differential display. Plant Mol. Biol. 36, 885–895.

han, A.S., Singh, Z., 2008. 1-Methylcyclopropene application and modified atmo-sphere packaging affect ethylene biosynthesis, fruit softening, and quality of‘Tegan Blue’ Japanese plum during cold storage. J. Am. Soc. Hortic. Sci. 133,290–299.

aFayette, P.R., Nagao, R.T., O’Grady, K., Vierling, E., Key, J.L., 1996. Molecular char-acterization of cDNAs encoding low-molecular-weight heat shock proteins ofsoybean. Plant Mol. Biol. 30, 159–169.

enne, C., Block, M.A., Garin, J., Douce, R., 1995. Sequence and expression of the mRNAencoding HSP22, the mitochondrial small heat-shock protein in pea leaves.Biochem. J. 311, 805–813.

inda-Chang, P.F., Jinn, T.L., Huang, W.K., Chen, Y., Chang, H.M., Wang, C.W., 2007.Induction of a cDNA clone from rice encoding a class II small heat shock proteinby heat stress, mechanical injury, and salicylic acid. Plant Sci. 172, 64–75.

aimbo, M., Ohnishi, K., Hikichi, Y., Yoshioka, H., Kiba, A., 2007. Induction of a smallheat shock protein and its functional roles in Nicotiana plants in the defenseresponse against Ralstonia solanacearum. Plant Physiol. 145, 1588–1599.

amedov, T.G., Shono, M., 2008. Molecular chaperone activity of tomato (Lycop-ersicon esculentum) endoplasmic reticulum-located small heat shock protein. J.Plant Res. 121, 235–243.

anganaris, G.A., Vicente, A.R., Crisosto, C.H., Labavitch, J.M., 2008. Effect of delayedstorage and continuous ethylene exposure on flesh reddening of ‘Royal Dia-mond’ plums. J. Sci. Food Agric. 88, 2180–2185.

cDonald, R.E., McCollum, T.G., Baldwin, E.A., 2000. Temperature of water heattreatments influences tomato fruit quality following low-temperature storage.Postharvest Biol. Technol. 16, 147–155.

eta-Sharir, I., Isaacson, T., Lurie, S., Weiss, D., 2005. Dual role for tomato heat shockprotein 21: protecting photosystem II from oxidative stress and promoting colorchanges during fruit maturation. Plant Cell 17, 1829–1838.

awson, T., 1995. Protein module and signaling networks. Nature 373, 560–573.esis, E., Faure, M., Arie, R.M., 1997. Induction of chilling tolerance in mango by

temperature conditioning, heat, low O2 and ethanol vapours. Acta Hortic. 455,629–634.

orat, R., Daus, A., Cohen, B., Fallik, E., Droby, S., 2000a. Reduction in postharvestdecay in organic citrus fruit by a short hot water brushing treatment. PostharvestBiol. Technol. 18, 151–157.

orat, R., Pavoncello, D., Peretz, J., Ben-Yehoshua, S., Lurie, S., 2000b. Effects of var-ious heat treatments on the induction of cold tolerance and on the postharvestqualities of ‘Star Ruby’ grapefruit. Postharvest Biol. Technol. 18, 159–165.

amakrishna, W., Deng, Z.P., Ding, C.K., Handa, A.K., Ozminkowski, R.H., 2003. A novelsmall heat shock protein gene, vis1, contributes to pectin depolymerization andjuice viscosity in tomato fruit. Plant Physiol. 131, 725–735.

obbins, J., Dilworth, S.M., Laskey, R.A., Dingwall, C., 1991. Two independent basicdomains in nucleoplasmin nuclear targeting sequence: identification of a classof biparticle nuclear targeting sequence. Cell 64, 615–623.

d Technology 55 (2010) 91–96

Sabehat, A., Lurie, S., Weiss, D., 1998. Expression of small heatshock proteins atlow temperatures: a possible role in protecting against chilling injuries. PlantPhysiol. 117, 651–658.

Sapitnitskaya, M., Maul, P., McCollum, G.T., Guy, C.L., Weiss, B., Samach, A., Porat, R.,2006. Postharvest heat and conditioning treatments activate different molec-ular responses and reduce chilling injuries in grapefruit. J. Exp. Bot. 57, 2943–2953.

Sevillano, L., Sanchez-Ballesta, M.T., Romojaro, F., Flores, F.B., 2009. Physiological,hormonal and molecular mechanisms regulating chilling injury in horticulturalspecies. Postharvest technologies applied to reduce its impact. J. Sci. Food Agric.89, 555–573.

Sung, D.Y., Kaplan, F., Lee, K.J., Guy, C.L., 2003. Acquired tolerance to temperatureextremes. Trends Plant Sci. 8, 179–187.

Taylor, M.A., Jacobs, G., Rabe, E., Dodd, M.C., 1993. Physiological factors associatedwith overripeness, internal breakdown and gel breakdown in plums stored atlow-temperature. J. Hortic. Sci. 68, 825–830.

Török, Z., Goloubinoff, P., Horváth, I., Tsvetkova, N.M., Glatz, A., Balogh, G., Var-vasovszki, V., Los, D.A., Vierling, E., Crowe, J.H., Vígh, L., 2001. Synechocystis HSP17is an amphitropic protein that stabilizes heat-stressed membranes and bindsdenatured proteins for subsequent chaperone-mediated refolding. Proc. Natl.Acad. Sci. U.S.A. 98, 3098–3103.

Tsvetkova, N.M., Horváth, I., Török, Z., Wolkers, W.F., Balogi, Z., Shigapova, N., Crowe,L.M., Tablin, F., Vierling, E., Crowe, J.H., Vígh, L., 2002. Small heat-shock pro-teins regulate membrane lipid polymorphism. Proc. Natl. Acad. Sci. U.S.A. 99,13504–13509.

Vicente, A.R., Martinez, G.A., Civello, P.M., Chaves, A.R., 2002. Quality of heat-treated strawberry fruit during refrigerated storage. Postharvest Biol. Technol.25, 59–71.

Vierling, E., 1991. The roles of heat shock proteins in plants. Ann. Rev. Plant Physiol.Plant Mol. Biol. 42, 579–620.

Wan, C.Y., Wilkins, T.A., 1994. A modified hot borate method significantly enhancesthe yield of high quality RNA from cotton (Gossypium hirsutum L.). Anal. Biochem.223, 7–12.

Wang, W.X., Vinocur, B., Shoseyov, O., Altman, A., 2004. Role of heat-shock proteinsand molecular chaperones in the abiotic stress response. Trends Plant Sci. 9,245–251.

Wang, C.Y., Brown, J.H., Weir, I.E., Allan, A.C., Ferguson, I.B., 2001. Heat induced pro-tection against death of suspension cultures of apple fruit cells exposed to lowtemperature. Plant Cell Environ. 24, 1199–1207.

Waters, E.R., Lee, G.J., Vierling, E., 1996. Evolution, structure and function of the smallheat shock proteins in plants. J. Exp. Bot. 47, 325–338.

Waters, E.R., 1995. Molecular evolution of the small heat-shock proteins in plants.Genetics 141, 785–795.

Woolf, A.B., Watkins, C.B., Bowen, J.H., Lay-Lee, M., 1995. Reducing external chillinginjury in stored ‘Hass’ avocados with dry heat treatments. J. Am. Soc. Hortic. Sci.120, 1050–1056.

Woolf, A.B., Bowen, H.J., Ferguson, I.B., 1999. Preharvest exposure to the sun influ-ences postharvest responses of ‘Hass’ avocado fruit. Postharvest Biol. Technol.

15, 143–153.

Zhang, J.H., Huang, W.D., Pan, Q.H., Liu, Y.P., 2005. Improvement of chilling toler-ance and accumulation of heat shock proteins in grape berries (Vitis vinifera cv.Jingxiu) by heat pre-treatment. Postharvest Biol. Technol. 38, 80–90.

Zhou, T., Xu, S., Sun, D.W., Wang, Zh., 2002. Effects of heat treatment on postharvestquality of peaches. J. Food Eng. 54, 17–22.