Expression analysis of turkey (Meleagris gallopavo) toll-likereceptors and molecular characterization of avian specific TLR15

Kannaki T. Ramasamy • Maddula R. Reddy •

Prem C. Verma • Shanmugam Murugesan

Received: 18 February 2012 / Accepted: 6 June 2012 / Published online: 15 June 2012

� Springer Science+Business Media B.V. 2012

Abstract Toll-like receptors (TLRs) constitute a multi-

gene family, which plays a pivotal role in sensing invading

pathogens by virtue of conserved microbial patterns. TLR

repertoire of chicken and zebra finch has been well studied.

However TLR family of other avian species is yet to be

characterized. In the present study, we identified TLR

repertoire of turkey, characterized avian specific receptor

TLR15 in turkey and profiled the TLRs expressions in a

range of tissues of turkey poults. All ten TLR genes

orthologous to chicken TLR repertoire were found in tur-

key. Turkey TLR genes showed 81–93 % similarity at

amino acid level to their chicken counter parts. Phyloge-

netic analysis confirmed the orthologous relationship of

turkey TLRs with chicken and zebra finch TLRs. Open

reading frame of turkey TLR15 was 2,607 bp long encod-

ing 868 amino acids similar to that of broiler chicken and

showed 92.4, 91.1 and 69.5 % identity at amino acid levels

with chicken, Japanese quail and zebra finch TLR15

sequences respectively. Overall TLR expression was

highest for TLR4 and lowest for TLR21. TLR1A, 2A, 2B and

21 were significantly higher in liver than other tissues

investigated (P \ 0.01). TLR3 expression was significantly

higher in bone marrow (BM) and spleen in comparison to

other tissues studied (P \ 0.01). Furthermore, no signifi-

cant differences in the expression levels of TLR1B, 4, 5, 7

and 15 genes were detected among the tissues studied. Our

findings contribute to the characterization of innate

immune system of birds and show the innate preparedness

of young turkey poults to a range of pathogens.

Keywords Toll-like receptor � TLR15 � Turkey �Expression analysis � Innate immunity

Abbreviations

TLR Toll-like receptor

PAMP Pathogen associated molecular patterns

Introduction

Innate immunity, once considered as non-specific immune

response of meager role is now considered as a funda-

mental orchester of overall immune response. Toll-like

receptors (TLRs) constitute a multi gene family in verte-

brates whose members have diversified functionally to

recognize distinctive pathogen associated molecular pat-

terns (PAMPs), which are unique to microbes and induce

pro-inflammatory and anti-microbial responses [1–3].

TLRs recognize PAMPs in an efficient and non-self-reac-

tive manner to initiate pro-inflammatory mediators which

finally culminate in the initiation of adaptive immune

response [4].

Advances in whole genome sequencing and annotation

in recent times have led to the identification of TLRs in

several vertebrates including fish [5], amphibian [6], birds

[7–9] and mammals [10]. However the present knowledge

of avian TLR family is mainly based on chicken studies

and few reports on duck, turkey and zebra finch. Chicken

TLR repertoire consists of ten genes (TLR1LA, ILB, 2A,

2B, 3, 4, 5, 7, 15 and 21) [8, 9, 11]. Out of these five

(TLR2A, 2B, 3, 4, 5 and 7) genes are directly orthologous to

K. T. Ramasamy (&) � P. C. Verma

Indian Veterinary Research Institute, Bareilly 243122, Uttar

Pradesh, India

e-mail: trkannaki@gmail.com

M. R. Reddy � S. Murugesan

Project Directorate on Poultry, Hyderabad 500030, India

123

Mol Biol Rep (2012) 39:8539–8549

DOI 10.1007/s11033-012-1709-6

mammals [9]. Chicken TLR21 is an ortholog of fish and

amphibian TLR21. It appears that TLRs 1LA, ILB and 15 are

unique to birds [7, 12]. Recently TLR repertoire has been

identified by in silico analysis in singing bird’s (zebra finch)

genome [13]. Despite being distantly related to the chicken,

analysis of zebra finch genome showed overall conformity of

TLR family and downstream signalling components [13].

Recently whole genome of turkey has been sequenced, and

available in public domain that has analyzed immune genes

including TLRs and antimicrobial peptides [14].

TLR15 is considered as avian specific TLR with no

homologue in other species. To date, TLR15 has been

characterized only in chicken [12], Japanese quail and in

zebra finch genome [13]. Basal TLR mRNA expression

profiles in different tissues are suggestive of an individual’s

preparedness and ability to respond to pathogen assault.

The expression pattern and distribution of the TLRs have

been shown to be characteristic of each species [15–19].

There is relative dearth of information on other avian TLR

gene repertoire and tissue expression profiles.

In this study, we annotated turkey TLR genes in turkey

genome draft by in silico analysis and determined the

mRNA expression in various tissues of turkey poults by

real time PCR analysis. We also sequenced and charac-

terized the full-length coding region of turkey (Meleagris

gallopavo) TLR15.

Materials and methods

In silico identification of TLR genes in turkey genome

and phylogenetic analysis

A dataset of all known TLR proteins of chicken [9] and zebra

finch [13] was created by downloading the sequences from

NCBI (http://www.ncbi.nlm.gov) and Ensembl (http://ens

embl.org/Taeniopygia_guttata/info/index) databases respec-

tively. The draft version of sequenced and assembled turkey

(UMD 2.0) genome available at (http://ensembl.org/Melea

gris_gallopavo/Info/Index) and NCBI nucleotide database

were searched with BLASTP program for the orthologous

gene members of assembled TLR gene data set. Genes

showing high degree of similarity to avian counterparts were

selected and their corresponding nucleotide and amino acid

sequences were retrieved and analyzed. Domain structures of

the turkey TLR proteins were analyzed by the SMART pro-

gram (http://smart.embl-heidelberg.de). An unrooted phylo-

genetic tree based on the amino acid sequences was

constructed by the Neighbor-joining (NJ) method in the Clu-

stalX version 2 program [20] and the MEGA version 4 pro-

gram [21]. The distance matrix was obtained by calculating

p-distances for all pairs of sequences. Sites containing gaps

were excluded from the analysis using the pair wise deletion

option. The reliability of branching patterns was assessed by

bootstrap analysis (1,000 replications). The accession numbers

of the sequences used for gene-searching and phylogenetic

analysis are listed in Table 1. The most stringent method to

identify selection pressure at protein level is to compare the

rate of synonymous substitution (dS) and non synonymous

substitution (dN). The nucleotide sequences coding the extra-

cellular domains were aligned with ClustalW. Comparisons

between orthologous TLR genes of chicken and turkey were

performed. Positive (dS \ dN) or purifying (dS [ dN) selec-

tion was tested with codon based z-test using the Nei-Gojobori

method (P-distance) at 5 % significance level.

Molecular characterization of turkey TLR15

To amplify the full length ORF of turkey TLR15 overlap-

ping primer sets were designed based on publicly available

broiler chicken TLR15 mRNA sequence (DQ267901) [12]

and annotated turkey TLR15 sequence (ENSMGAG000

00015891). The primer sets (Primer 1: F1, 50-ATGAGGA

TCCTTATTGGGAG-3; R1, 50-GCTGTCAGCTCTTCA

TTAGA-30; Primer 2: F2, 50-TGACTTGTGTGGAGCAC

CGAT-30; R2, 50-TGGAGCAGTTGGACACTT-30; primer

Table 1 The accession

numbers of TLR genes used for

BLAST and phylogenetic

analyses

The accession numbers of NCBI

protein database are listeda TLR7-1, TLR7 gene is

duplicated in zebra finch

genome

TLR genes Chicken Zebra finch Duck Japanese quail

TLR1LA BAD67422 ENSTGUP00000009313 ACS92621 –

TLR1LB ABF67957 XP_0021897591 ACS92622 –

TLR2A NP_989609 XP_002196402 ACS92627 –

TLR2B BAB16842 XP_002198506 ACS92628 –

TLR3 NP_001011691 XP_002190888 – –

TLR4 AAL49971 NP_001135926 – –

TLR5 CAF25167 XP_002188762 – –

TLR7 NP_001011688 XP_002194911

XP_002194932a

DQ888645 –

TLR15 NP_001032924 XP_0021971051 – ADL14379

TLR21 NP_001025729 Pseudogene – –

8540 Mol Biol Rep (2012) 39:8539–8549

123

3: F3, 50-TACACCCATCGAAAGCCT-30; R3, 50-GATGG

CGTTGTCGCTAATGT-30; primer 4: F4, 50-ATCAGGGA

ATAAGATCTC-30; R4, 50-TACAGTTCATACTGACA

CCA-30; primer 5: F5, 50-GGAAACTGATGGATTCA

AGATA-30; R5, 50-TCATTCCATCTCAATTACATCC-30)were designed to amplify the fragments exactly covering

full length ORF from spleen cDNA sample. The reaction

conditions for amplification in PCR were same for all the

fragments. The 50 ll PCR reaction mixture contained

50 pmol of each forward and reverse primers, 1 ll tem-

plate cDNA, 200 lM of dNTP mix, 1.0 mM MgCl2 and

2.5 U Taq DNA polymerase (MBI Fermentas, USA) in 19

Taq buffer. Amplification conditions were as follows: an

initial denaturation at 94 �C for 5 min, followed by 36

cycles of denaturation at 94 �C for 1 min, annealing at

58 �C for 1 min and extension at 72 �C for 1 min, followed

by final extension at 72 �C for 10 min. PCR amplicons

verified by 1 % agarose gel electrophoresis were purified

and sequenced by using an automated DNA sequencer

(ABI prism, model 377, version 3.0) (Table. 2).

The sequences of the fragments were aligned using

MegAlign of DNA star software (Lasergene, USA) and

complete coding sequences was identified and translated to

amino acid sequence. The sequence was submitted to

NCBI Genbank (HQ456924.1). The signal peptide of the

sequence was identified by SignalP program (www.

cbs.dtu.dk/service/SinalP). The domain structure, LRRs

and transmembrane region were identified by SMART [22]

(http://www.smartembl-heidelberg.de/) and TMHMM [23]

(http://www.cbs.dtu.dk/service/TMHMM/) respectively.

Expression analysis of TLRs in turkey tissues by real

time PCR

Six day-old turkey poults (Meleagris gallopavo) were used

to analyze the differential expression of TLR mRNAs in

various tissues such as heart, liver, intestine, bursa, bone

marrow (BM), muscle and spleen. For the analysis, 100 mg

of each frozen tissues were homogenized and total RNA

extracted using TriZol (Qiagen) by following manufac-

turer’s instruction. Two lg of total RNA was treated with

RNase-free DNase (MBI fermentas, USA) and reverse

transcribed with M-MLV reverse transcriptase (MBI Fer-

mentas, USA) using oligo (dT) primers. Primers used in

real time PCR were designed by using Primer3 online free

software using annotated turkey TLR gene sequences.

All reactions were performed in duplicates in a total

volume of 25 ll reaction containing 19 QuantiTect SYBR

Green PCR master mix (SYBR Green I dye, ROX passive

reference dye, HotStartTaq DNA polymerase and dNTPs

with dUTPs in optimized buffer, Qiagen GmBH, Ger-

many), 10 pmol of each primer and 0.5 ll of cDNA tem-

plate. Thermal profile consisted of an initial denaturation at

94 �C for 10 min, followed by 40 cycles of denaturation at

94 �C for 30 s; annealing at 60 �C for 30 s and extension at

72 �C for 30 s. For each sample dissociation curve was

generated after the completion of amplification and ana-

lyzed to confirm the specificity of amplicon. In each PCR

reaction no template control was included to check con-

tamination of master mix. Non-reverse transcribed RNA

(10 ng) of each sample was used instead of cDNA to check

contamination of samples with genomic DNA, failure of

amplification confirms the purity of sample. To assess the

efficiency of primers, standard curves for each primer pair

were generated using serially diluted transcribed RNA

sample. PCR efficiency was calculated from the slope of

standard curves. All primer pairs were found to have gene

amplification efficiencies close to 100 % based on the

slope of Ct values obtained from serially diluted cDNA.

Gene efficiencies ranged from 92 to 100 %. For each tissue

sample, the difference between the mean Ct value for b-

actin and the target gene was determined and subtracted

Table 2 Primer sequences used in the present study

Gene name Forward primer (50–30) Reverse primer (50–30) Product size

TLR1LA TGTGCATCTACCTGGATGTGCTGT AACGAATCGCGCTCTCTGTACGAT 148

TLR1LB TGTGCATCTACCTGGATGTGCTGT ATGAAGGCGTGAAACTGCAGAACG 124

TLR2A AGAACGACTCCAACTGGGTGGAAA AGAGCGTCTTGTGGCTCTTCTCAA 156

TLR2B AGAACGACTCCAACTGGGTGGAAA AGAGCGTCTTGTGGCTCTTCTCAA 156

TLR3 ACCCGGATTGCAGTCTCAGTACAT AAATGGAGCGCTATCTTTGCAGGC 103

TLR4 AGACGCCTCCGCATCTTGGATATT TGTAAGGGCTTGGAGTGGCTTGTA 155

TLR5 TGAACTCCAGCAGACACTCAGGTT TGCTGGTGGATGGCTTCCTATCAA 160

TLR7 TGATGCAGTGTGGTTTGTTGGGTG AACCAAGCTCCTTCCTTTGTGTGC 112

TLR15 AGCGTCCAACTGCTCCATTGTAGA GCATGGAAATCCGATTGCTGCTGA 98

TLR21 ACAGCTGCACAACATTTCCTTCCG TGTAAAGGTCGGTCAGCAGGTTGT 194

b actina AGACATCAGGGTGTGATGGTTGGT TGGTGACAATGCCGTGTTCAATGG 118

a ENSMGAG00000003960

Mol Biol Rep (2012) 39:8539–8549 8541

123

Table 3 TLR gene repertoires in turkey (Meleagris gallapova) genome

Gene name Accession

no/gene ID

Chromosome

location

Length of

transcript (bp)

Length (aa) % ida

TLR1A FJ477857 4 2,457 818 92.7

TLR1B FJ477858 4 1,959 652 92.6

TLR2A FJ477860 4 2,382 793 91.7

TLR2B FJ477861 4 2,346 781 93.1

TLR3 ENSMGAG00000011425 4 2,969b 897 81.1

TLR4 ENSMGAG0000005422 19 2,529b 842 92.4

TLR5 ENSMGAG00000015929 2 2,583 860 93.4

TLR7 ENSMGAG00000014706 1 3,331b 1,047 91.8

TLR15 ENSMGAG00000015891 2 2,607 868 92.4

TLR21 ENSMGAG00000015581 13 2,919 973 89.8

The accession numbers of NCBI or gene ID of ensemble turkey genome draft are listeda % id-Percentage identity of turkey TLR genes with corresponding chicken ortholog at amino acid levelb Splice variants are found in the genome

Fig. 1 Structures of the

predicted turkey TLR proteins.

Domains in the protein were

predicted by the SMART

program

8542 Mol Biol Rep (2012) 39:8539–8549

123

from 40 to normalize RNA levels between animals and

tissues. The 40-DCt for each tissue sample can be inter-

preted as a higher numerical value indicating greater gene

expression. Relative gene expression of TLRs expressed as

40-DCt mean values were analyzed by one-way ANOVA

with Tukey’s post hoc test using SPSS software (version

10.0). Values were considered significant at P \ 0.01.

Results

Identification and phylogenetic analysis of turkey TLRs

We attempted to identify TLR genes of turkey from NCBI

and genome database of turkey (Ensembl turkey genome

browser) using chicken and zebra finch TLRs as query

sequences (Table 1). We identified all 10 TLR genes

(TLR1LA, 1LB, 2A, 2B, 3, 4, 5, 7, 15 and 21) orthologs of

chicken TLR repertoires in turkey genome (Table 3). To

identify the status of TLR8, 9 and 10 in turkey genome we

used corresponding human sequences for blast search.

Similar to chicken no orthologs of these genes could be

found in turkey genome. Turkey TLR genes showed

81–93 % similarity at amino acid level to their chicken

counterparts. Using the SMART program, typical struc-

tures of turkey TLR proteins were predicted (Fig. 1).

Almost all TLR proteins consisted of multiple LRRs in the

N-terminal region and a single TIR domain in the C-ter-

minus separated by a transmembrane region except for

turkey TLR7 in which transmembrane domains (TM) could

not be detected by the SMART program. Although the

SMART program could not predict the transmembrane

region in turkey TLR7 hydrophobic regions were present

between the LRR region and TIR domain. With the help of

TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/)

program TM domain in the hydrophobic region was pre-

dicted. The number of LRRs and its phasing showed gen-

eral conformity with chicken TLR proteins amidst minor

variations.

To examine the relationship between avian TLRs

(chicken, zebra finch and turkey) a phylogenetic tree was

constructed using MEGA program (Fig. 2). Turkey TLR

genes clustered with chicken and finch TLR orthologs and

their bootstrap probabilities were sufficiently high to indi-

cate that these annotations were reliable. TLR15, an avian

specific TLR, formed a distinct clade, however this is

phylogenetically close to TLR1 family. Examination of

phylogenetic tree suggests a rationale that most of the avian

TLRs correspond to the chicken sequences. Further it

reinforces the differential clustering of these TLR clades

representing ‘‘TLR big-bomb’’ which occurred approxi-

mately 600 million years ago.

Evolutionary analysis of TLR gene sequences from

avian species revealed dS was significantly higher than dN

for all TLR sequences studied except for duplicated TLR2

genes suggesting that these genes were under purifying

selection (P \ 0.01). The duplicated TLR2 genes of avian

are under positive selection.

Molecular characterization of turkey TLR15

Turkey TLR15 had the ORF length of 2,607 bp similar to

that of chicken and Japanese quail that encodes 98.2 kDa

TLR15 protein consisting of 868 amino acids. By ClustalW

analysis, turkey TLR15 showed 92.4, 91.1 and 69.5 %

similarity at amino acid levels with chicken, Japanese quail

and zebra finch TLR15 sequences respectively. In the

deduced amino acid sequence of turkey TLR15, the first 22

amino acids constitute signal peptide region, followed by

ectodomain region covering over 652aa residues, trans-

membrane region (from 654 to position 676) and cyto-

plasmic TIR domain consists of 144 residues (from 706 to

Fig. 2 Unrooted phylogenetic tree of avian TLRs. Neighbor joining

tree of avian TLRs constructed using full length protein sequences

using MEGA version 4.0 (Poisson correction model, 1,000 bootstrap

replicates) cTLR chicken TLR; tTLR turkey TLR; fTLR zebra finch

TLR; qTLR Japanese quail TLR

Mol Biol Rep (2012) 39:8539–8549 8543

123

position 849) similar to chicken sequence. SMART pre-

diction revealed that ectodomain of turkey TLR15 contains

ten leucine-rich repeats (LRRs) similar to broiler chicken

(Fig. 3). Moreover, there are no N-terminal cysteine clus-

ters in TLR15 like other avian TLR15 sequences.

Expression analysis of turkey TLRs

TLR mRNA expressions were detected for all ten genes in

all tissue samples analyzed in the present study. Overall

TLR expression was highest for TLR4 and lowest for

TLR21 in pooled tissue samples. TLR1A, 2A, 2B and 21

were significantly higher in liver than other tissues

investigated (P \ 0.01). TLR3 gene expression was sig-

nificantly higher in marrow (BM) and spleen in comparison

to other tissue samples (P \ 0.01). However, there is no

significant difference in the gene expression of TLR1B, 4,

5, 7 and 15 among the tissues studied (Fig. 4).

Discussion

Although characterization of TLR genes and their expres-

sion analysis have been extensively done in chicken [12,

16, 24–29], their status in other avian species is yet to be

explored. This report is the first study on identification and

Fig. 3 Alignment of TLR15

amino acid sequences of

chicken, Japanese quail, zebra

finch and turkey. LRRs

predicted by SMART are shown

as gray shadow and boxesindicate predicted glycosylation

sites. Bold letters are the

predicted signal sequences and

arrows indicate domains. (Color

figure online)

8544 Mol Biol Rep (2012) 39:8539–8549

123

expression analysis of all the ten TLR transcripts in a range

of turkey tissues and also characterized avian specific

receptor TLR15 from turkey. All ten TLR genes ortholo-

gous to chicken genes are present in turkey genome. TLR1

and 2 genes are duplicated in chicken, duck and zebra finch

to give rise to TLR1LA, TLR1LB, TLR2A and TLR2B [9,

13]. The duplication of TLR1 and TLR2 genes are char-

acteristic of avian lineage as they are found in almost all

the bird species studied till date [13, 14]. The duplicated

TLR2 genes in avian species are under positive selection to

retain both the members. Both positive selection and gene

conversion shape the evolution of the avian specific TLR2

genes [13]. The duplication of TLR2 gene in avian lineage

is not a unique event as other independent duplication of

TLR2 gene have occurred in American alligator (X. trop-

icalis) [30] and in the ancestor of marsupial and eutherian

mammals [31]. However, the timing of these duplications

remains unknown. Interestingly, there are remnants of

second disrupted TLR2 gene like gene in tandem with

functional TLR2 in mice and humans. Hence, the dupli-

cation of TLR2 gene might have occurred prior to the

divergence of mammals and birds and subsequently lost its

functionality in mammalian lineage. In mammals TLR2

has been shown to be the common heterodimer partner for

the members of TLR1 family members (TLR1/6/10) in the

recognition of diacyl and triacyl lipopeptides [32].

Recently it has been demonstrated that chicken TLR1Ls

interact with TLR2s and can recognize agonists identical to

those of mammalian heterodimers [24, 28, 33]. However

the functional characterization of these TLR receptors is

yet to be done in other avian species.

Avian species appear to miss a number of TLRs which

are present in most of the mammals. TLR7, 8 and 9 sub-

family is represented only by TLR7 in chicken, duck and

Fig. 3 continued

Mol Biol Rep (2012) 39:8539–8549 8545

123

zebra finch [9, 13, 34], nevertheless TLR7 is duplicated in

the later. TLR8 gene in birds has been disrupted; whereas

TLR9 gene has been deleted in the course of evolution [9,

27]. Philbin et al. [27] demonstrated that TLR8 is disrupted

by a retroviral, CR1-type insertion element only in galli-

form species and not in anseriform birds including ducks.

However, later it was disproved and duck genome was

shown to have disrupted TLR8 gene [31, 34]. TLR7 and

TLR8 genes are adjacent to each other in the genomes of

fish and mammals [34]. Hence we examined genomic

region downstream to TLR7 region and identified CR1 like

elements in between fragments having homology to

mammalian TLR8 in turkey genome. Complicated overlap

of function between the TLR7/8 in mouse and human has

led to the speculation that mouse TLR8 and human TLR7

are evolving to become pseudogenes [35]. Indeed, the loss

of TLR8 in avian lineage reflects similar evolutionary

pressure.

Similar to chicken no mammalian ortholog of TLR9 and

10 could be found in turkey genome. In spite of TLR9

Fig. 4 Relative transcript

expression levels of TLRs in a

range of tissues of turkey poults.

Data shown are mean 40-DCt

values of four individual birds.

Bars with different superscriptsdiffer significantly (P \ 0.01).

X-axis tissues, BM bone

marrow; Y-axis mean 40-DCt

values

8546 Mol Biol Rep (2012) 39:8539–8549

123

deletion in chicken genome oligodeoxynucleotides (ODN),

a synthetic TLR9 agonist has been shown to be effective in

chicken against bacterial infections [36–39]. Chicken

possess TLR21 orthologous to Fugu and Xenopus TLR21

[9]. We also annotated TLR21 in turkey genome. Recently

it has been demonstrated that chicken TLR21 but not TLR7

or TLR15 as speculated earlier recognizes unmethylated

CpG motifs and acts as functional homolog to mammalian

TLR9 [40, 41]. Comparative sequence analysis of chicken,

turkey and human TLR9 revealed that similar to chicken

TLR21 [41], turkey TLR21 also lack insertion sequence

between LRR15 and LRR16 typical for human TLR7-9,

involved in proteolytic cleavage and implicated in TLR9

like function [42–44].

TLR15 appears to be unique to avian species with no

vertebrate counterpart [9, 12, 14]. From the presence of

TLR15 in zebra finch [13] a passeriform species, it is

evident that TLR15 must have evolved in the common

ancestor approximately 100 Mya well before the galli-

formes-passeriformes split (G-P split). Phylogenetic anal-

ysis revealed TLR15 grouped with TLR1 family with high

bootstrap support reinforcing the results of earlier studies

[9, 12]. Avian TLR1 family is represented by a single

member unlike many members (TLR1/6/10) of mammalian

TLR1 family. From this we can speculate that TLR15

compensate the lack of variability of avian TLR1 family.

The ligand specificity for TLR15 has not yet been con-

clusively determined, but there are substantial evidences

that TLR15 recognize unique, non-secreted, heat-stable

component of both gram (?) and gram (-) bacteria of

avian specific pathogens more specifically some compo-

nents of Salmonella [12, 45–50]. Further, TLR15 may form

heterodimer with TLR2 similar to that of TLR1 members

as gene expression pattern of both was highly similar in

Salmonella-infected chicken [12, 46]. Therefore TLR15 in

avian lineage may have evolved as novel heterodimeric

partner for TLR2. Proteins with conserved functions might

undergo purifying selection to eliminate deleterious

mutations [51]. In the present study analysis of known

avian TLR sequences revealed that they were under puri-

fying selection.

Expression pattern of TLR genes have been studied for

chicken, duck (TLR7), turkey (TLR5) and zebra finch

(TLR4) [12, 16, 26, 34, 52, 53]. We found measurable

mRNA expression for each TLR in a range of tissues from

turkey poults. However, differences were found in the

expression profile of different TLRs between turkey and

other bird species. This may be an adaptation to encounter

different range of pathogens specific to each species.

Moreover, earlier studies demonstrated the expression of

TLR genes in the tissues of developing chicken embryos

and implicated their role in protecting the embryos from

vertically transmitted infections and other pathogens [54,

55]. He et al. [56] showed differential induction of nitric

oxide in response to microbial agonist stimulations in

monocytes and heterophils from young commercial tur-

keys. This finding together with our results of TLR

expression in young turkey poults demonstrates the innate

preparedness of young birds to encounter pathogens. The

greater initial TLR expression in younger birds indicates

the potential for a stronger innate immune response. The

differential TLR gene expression between chicken and

turkey suggest their role in difference in disease resistance/

susceptibility among these two species. However, detailed

studies are warranted to confirm their role.

In summary, we identified TLR repertoire of turkey,

characterized avian specific receptor TLR15 and profiled

their expression in a range of tissues. All ten TLR genes

orthologous to chicken TLR repertoire were found in tur-

key. Our results suggest the innate preparedness of younger

turkeys against infection. Manipulation of expression lev-

els of TLRs may in future be a mechanism to enhance the

immune status of stocks and control of infections.

References

1. Medzhitov R, Janeway CA Jr (1997) Innate immunity: the virtues

of a nonclonal system of recognition. Cell 91(3):295–298

2. Janeway CA Jr, Medzhitov R (2002) Innate immune recognition.

Annu Rev Immunol 20:197–216

3. Takeda K, Kaisho T, Akira S (2003) Toll-like receptors. Annu

Rev Immunol 21:335–376

Fig. 4 continued

Mol Biol Rep (2012) 39:8539–8549 8547

123

4. West AP, Koblansky AA, Ghosh S (2006) Recognition and sig-

naling by toll-like receptors. Annu Rev Cell Dev Biol

22:409–437

5. Oshiumi H, Sasai M, Shida K, Fujita T, Matsumoto M, Seya T

(2003) TIR-containing adapter molecule (TICAM)-2, a bridging

adapter recruiting to toll-like receptor 4 TICAM-1 that induces

interferon-beta. J Biol Chem 278(50):49751–49762

6. Ishii A, Kawasaki M, Matsumoto M, Tochinai S, Seya T (2007)

Phylogenetic and expression analysis of amphibian Xenopus

Toll-like receptors. Immunogenetics 59(4):281–293

7. Yilmaz A, Shen S, Adelson DL, Xavier S, Zhu JJ (2005) Iden-

tification and sequence analysis of chicken Toll-like receptors.

Immunogenetics 56(10):743–753

8. Boyd A, Philbin VJ, Smith AL (2007) Conserved and distinct

aspects of the avian Toll-like receptor (TLR) system: implica-

tions for transmission and control of bird-borne zoonoses. Bio-

chem Soc Trans 35(Pt 6):1504–1507

9. Temperley ND, Berlin S, Paton IR, Griffin DK, Burt DW (2008)

Evolution of the chicken Toll-like receptor gene family: a story of

gene gain and gene loss. BMC Genomics 9:62

10. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr (1997) A

human homologue of the Drosophila Toll protein signals acti-

vation of adaptive immunity. Nature 388(6640):394–397

11. Smith J, Speed D, Law AS, Glass EJ, Burt DW (2004) In silico

identification of chicken immune-related genes. Immunogenetics

56(2):122–133

12. Higgs R, Cormican P, Cahalane S, Allan B, Lloyd AT, Meade K,

James T, Lynn DJ, Babiuk LA, O’farrelly C (2006) Induction of a

novel chicken Toll-like receptor following Salmonella entericaserovar Typhimurium infection. Infect Immun 74(3):1692–1698

13. Cormican P, Lloyd AT, Downing T, Connell SJ, Bradley D,

O’Farrelly C (2009) The avian Toll-Like receptor pathway-subtle

differences amidst general conformity. Dev Comp Immunol

33(9):967–973

14. Dalloul RA, Long JA, Zimin AV, et al (2010) Multi-platform

next-generation sequencing of the domestic turkey (Meleagrisgallopavo): genome assembly and analysis. PLoS Biol. doi:

10.1371/journal.pbio.1000475

15. Zarember KA, Godowski PJ (2002) Tissue expression of human

Toll-like receptors and differential regulation of Toll-like recep-

tor mRNAs in leukocytes in response to microbes, their products,

and cytokines. J Immunol 168(2):554–561

16. Kogut MH, Iqbal M, He H, Philbin V, Kaiser P, Smith A (2005)

Expression and function of Toll-like receptors in chicken heter-

ophils. Dev Comp Immunol 29(9):791–807

17. Nalubamba KS, Gossner AG, Dalziel RG, Hopkins J (2008)

Differential expression of pattern recognition receptors during the

development of foetal sheep. Dev Comp Immunol 32(7):869–874

18. Vahanan BM, Raj GD, Pawar RMC, Gopinath VP, Raja A,

Thangavelu A (2008) Expression profile of toll like receptors in a

range of water buffalo tissues (Bubalus bubalis). Vet Immunol

Immunopathol 126(1–2):149–155

19. Tirumurugaan KG, Dhanasekaran S, Raj GD, Raja A, Kumanan

K, Ramaswamy V (2010) Differential expression of toll-like

receptor mRNA in selected tissues of goat (Capra hircus). Vet

Immunol Immunopathol 133(2–4):296–301

20. Larkin MA, Blackshields G, Brown NP et al (2007) Clustal W

and Clustal X version 2.0. Bioinformatics 23(21):2947–2948

21. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular

evolutionary genetics analysis (MEGA) software version 4.0.

Mol Biol Evol 24(8):1596–1599

22. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a

simple modular architecture research tool: identification of sig-

naling domains. Proc Nat Acad Sci USA 95(11):5857–5864

23. Letunic I, Copley RR, Schmidt S, Ciccarelli FD, Doerks T,

Schultz J, Ponting CP, Bork P (2004) SMART 4.0: towards

genomic data integration. Nucleic Acids Res 32(Database

issue):D142–D144

24. Fukui A, Inoue N, Matsumoto M, Nomura M, Yamada K, Mat-

suda Y, Toyoshima K, Seya T (2001) Molecular cloning and

functional characterization of chicken toll-like receptors. A single

chicken toll covers multiple molecular patterns. J Biol Chem

276(50):47143–47149

25. Boyd Y, Goodchild M, Morroll S, Bumstead N (2001) Mapping

of the chicken and mouse genes for toll-like receptor 2 (TLR2) to

an evolutionarily conserved chromosomal segment. Immunoge-

netics 52(3–4):294–298

26. Iqbal M, Philbin VJ, Smith AL (2005) Expression patterns of

chicken Toll-like receptor mRNA in tissues, immune cell subsets

and cell lines. Vet Immunol Immunopathol 104(1–2):117–127

27. Philbin VJ, Iqbal M, Boyd Y, Goodchild MJ, Beal RK, Bumstead

N, Young J, Smith AL (2005) Identification and characterization

of a functional, alternatively spliced Toll-like receptor 7 (TLR7)

and genomic disruption of TLR8 in chickens. Immunology

114(4):507–521

28. Keestra AM, de Zoete MR, van Aubel RAMH, van Putten JPM

(2007) The central leucine-rich repeat region of chicken TLR16

dictates unique ligand specificity and species-specific interaction

with TLR2. J Immunol 178(11):7110–7119

29. Ruan W, Wu Y, Zheng SJ (2012) Different genetic patterns in

avian Toll-like receptor (TLR)5 genes. Mol Biol Rep

39(4):3419–3426

30. Beutler B, Rehli M (2002) Evolution of the TIR, tolls and TLRs:

functional inferences from computational biology. Curr Top

Microbiol Immunol 270:1–21

31. Roach JC, Glusman G, Rowen L, Kaur A, Purcell MK, Smith

KD, Hood LE, Aderem A (2005) The evolution of vertebrate

Toll-like receptors. Proc Nat Acad Sci USA 102(27):9577–9582

32. Takeuchi O, Kawai T, Muhlradt PF, Morr M, Radolf JD, Zych-

linsky A, Takeda K, Akira S (2001) Discrimination of bacterial

lipoproteins by Toll-like receptor 6. Int Immunol 13(7):933–940

33. Higuchi M, Matsuo A, Shingai M, Shida K, Ishii A, Funami K,

Suzuki Y, Oshiumi H, Matsumoto M, Seya T (2008) Combina-

tional recognition of bacterial lipoproteins and peptidoglycan by

chicken Toll-like receptor 2 subfamily. Dev Comp Immunol

32(2):147–155

34. MacDonald MRW, Xia J, Smith AL, Magor KE (2008) The duck

toll like receptor 7: genomic organization, expression and func-

tion. Mol Immunol 45(7):2055–2061

35. Crozat K, Beutler B (2004) TLR7: a new sensor of viral infection.

Proc Nat Acad Sci USA 101(18):6835–6836

36. Gomis S, Babiuk L, Godson DL, Allan B, Thrush T, Townsend

H, Willson P, Waters E, Hecker R, Potter A (2003) Protection of

chickens against Escherichia coli infections by DNA containing

CpG motifs. Infect Immun 71(2):857–863

37. Gomis S, Babiuk L, Allan B, Willson P, Waters E, Ambrose N,

Hecker R, Potter A (2004) Protection of neonatal chicks against a

lethal challenge of Escherichia coli using DNA containing

cytosine-phosphodiester-guanine motifs. Avian Dis

48(4):813–822

38. He H, Genovese KJ, Nisbet DJ, Kogut MH (2007) Synergy of

CpG oligodeoxynucleotide and double-stranded RNA (poly I:C)

on nitric oxide induction in chicken peripheral blood monocytes.

Mol Immunol 44(12):3234–3242

39. Taghavi A, Allan B, Mutwiri G, Van Kessel A, Willson P,

Babiuk L, Potter A, Gomis S (2008) Protection of neonatal broiler

chicks against Salmonella Typhimurium septicemia by DNA

containing CpG motifs. Avian Dis 52(3):398–406

40. Brownlie R, Zhu J, Allan B, Mutwiri GK, Babiuk LA, Potter A,

Griebel P (2009) Chicken TLR21 acts as a functional homologue

to mammalian TLR9 in the recognition of CpG oligodeoxynu-

cleotides. Mol Immunol 46(15):3163–3170

8548 Mol Biol Rep (2012) 39:8539–8549

123

41. Keestra AM, de Zoete MR, Bouwman LI, van Putten JPM (2010)

Chicken TLR21 is an innate CpG DNA receptor distinct from

mammalian TLR9. J Immunol 185(1):460–467

42. Latz E, Verma A, Visintin A et al (2007) Ligand-induced con-

formational changes allosterically activate Toll-like receptor 9.

Nat Immunol 8(7):772–779

43. Ewald SE, Lee BL, Lau L, Wickliffe KE, Shi G-P, Chapman HA,

Barton GM (2008) The ectodomain of Toll-like receptor 9 is

cleaved to generate a functional receptor. Nature

456(7222):658–662

44. Peter ME, Kubarenko AV, Weber ANR, Dalpke AH (2009)

Identification of an N-terminal recognition site in TLR9 that

contributes to CpG-DNA-mediated receptor activation. J Immu-

nol 182(12):7690–7697

45. MacKinnon KM, He H, Nerren JR, Swaggerty CL, Genovese KJ,

Kogut MH (2009) Expression profile of toll-like receptors within

the gastrointestinal tract of 2-day-old Salmonella enteritidis-

infected broiler chickens. Vet Microbiol 137(3–4):313–319

46. Nerren JR, Swaggerty CL, MacKinnon KM, Genovese KJ, He H,

Pevzner I, Kogut MH (2009) Differential mRNA expression of

the avian-specific toll-like receptor 15 between heterophils from

Salmonella-susceptible and -resistant chickens. Immunogenetics

61(1):71–77

47. Nerren JR, He H, Genovese K, Kogut MH (2010) Expression of

the avian-specific toll-like receptor 15 in chicken heterophils is

mediated by gram-negative and gram-positive bacteria, but not

TLR agonists. Vet Immunol Immunopathol 136(1–2):151–156

48. Michailidis G, Theodoridis A, Avdi M (2011) Effects of sexual

maturation and Salmonella infection on the expression of Toll-

like receptors in the chicken vagina. Anim Reprod Sci

123(3–4):234–241

49. Michailidis G, Theodoridis A, Avdi M (2010) Transcriptional

profiling of Toll-like receptors in chicken embryos and in the

ovary during sexual maturation and in response to Salmonella

enteritidis infection. Anim Reprod Sci 122(3–4):294–302

50. Anastasiadou M, Theodoridis A, Avdi M, Michailidis G (2011)

Changes in the expression of Toll-like receptors in the chicken

testis during sexual maturation and Salmonella infection. Anim

Reprod Sci 128(1–4):93–99

51. Medzhitov R (2001) Toll-like receptors and innate immunity. Nat

Rev Immunol 1(2):135–145

52. Vinkler M, Bryjova A, Albrecht T, Bryja J (2009) Identification

of the first Toll-like receptor gene in passerine birds: TLR4

orthologue in zebra finch (Taeniopygia guttata). Tissue Antigens

74(1):32–41

53. Gopinath VP, Biswas M, Raj GD, Raja A, Kumanan AK, Elan-

kumaran S (2011) Molecular cloning and tissue-specific expres-

sion of Toll-like receptor 5 gene from turkeys. Avian Dis

55(3):480–485

54. Kannaki TR, Verma PC (2008) Temporal and Spatial expression

pattern of Toll-like receptors during embryonic development in

chicken. In: Proceedings of XXIII World’s Poultry Congress,

Brisbane, Australia 30 June–4 July

55. Meade KG, Higgs R, Lloyd AT, Giles S, O’Farrelly C (2009)

Differential antimicrobial peptide gene expression patterns during

early chicken embryological development. Dev Comp Immunol

33(4):516–524

56. He H, Genovese KJ, Swaggerty CL, Nisbet DJ, Kogut MH (2008)

Differential induction of nitric oxide, degranulation, and oxida-

tive burst activities in response to microbial agonist stimulations

in monocytes and heterophils from young commercial turkeys.

Vet Immunol Immunopathol 123(3–4):177–185

Mol Biol Rep (2012) 39:8539–8549 8549

123