Effects of simultaneous knockdown of HER2 and PTK6 on … › content › molcanres › early › ... · In addition to surgery and hormonal and chemo- or radiation-therapy, an antibody-based

1

Effects of simultaneous knockdown of HER2 and PTK6 on malignancy and

tumor progression in human breast cancer cells

Natalie Ludygaa, Natasa Anastasovb, Michael Rosemannb, Jana Seilera, Nadine

Lohmanna, Herbert Braselmannc, Karin Mengeled, Manfred Schmittd, Heinz Höflera,e,

Michaela Aubelea

Authors’ affiliations

a Institute of Pathology, b Institute of Radiation Biology, c Department of Radiation

Cytogenetics, Helmholtz Zentrum München, German Research Center for

Environmental Health, 85764 Neuherberg, Germany; d Clinical Research Unit,

Department of Obstetrics and Gynecology, Technische Universität München, 81675

München, Germany; e Institute of Pathology, Klinikum rechts der Isar, Technische

Universität München, 81675 München, Germany

Running title: Combined HER2 and PTK6 RNAi reduce breast cancer progression

Key words: ErbB-2, Brk, trastuzumab resistance, JIMT-1, invasion

Financial support: This work was supported by the Deutsche

Forschungsgemeinschaft (DFG, grant No 1671/1-1, NLu).

Corresponding author: Michaela Aubele, Helmholtz Zentrum München, Institut für

Pathologie, Ingolstaedter Landstrasse 1, 85764 Neuherberg, Germany, Fax: +49-89-

3187-3360, Tel: +49-89-3187-4132, E-mail: [email protected]

Disclosure of potential conflicts of interest: The authors declare no conflicts of

interest.

Word count: 5236

Total number of tables and figures: 7 figures

on July 4, 2020. © 2013 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on January 30, 2013; DOI: 10.1158/1541-7786.MCR-12-0378

http://mcr.aacrjournals.org/

2

Abstract

Breast cancer is the most common malignancy in women of the Western world. One

prominent feature of breast cancer is the co- and overexpression of human epidermal

growth factor receptor 2 (HER2) and protein tyrosine kinase 6 (PTK6). According to

the current clinical cancer therapy guidelines, HER2-overexpressing tumors are

routinely treated with trastuzumab, a humanized monoclonal antibody targeting

HER2. Approximately 30 % of HER2-overexpressing breast tumors at least initially

respond to the anti-HER2 therapy, but a subgroup of these tumors develops

resistance shortly after the administration of trastuzumab. A PTK6-targeted therapy

does not yet exist. Here, we show for the first time that the simultaneous knockdown

in vitro, compared with the single knockdown of HER2 and PTK6, in particular in the

trastuzumab-resistant JIMT-1 cells leads to a significantly decreased phosphorylation

of crucial signaling proteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK

1/2) and p38 MAPK, and (phosphatase and tensin homologue deleted on

chromosome ten) PTEN that are involved in tumorigenesis. Additionally, dual

knockdown stronger reduced the migration and invasion of the JIMT-1 cells.

Moreover, the downregulation of HER2 and PTK6 led to an induction of p27 and the

dual knockdown significantly diminished cell proliferation in JIMT-1 and T47D cells. In

vivo experiments showed significantly reduced levels of tumor growth following HER2

or PTK6 knockdown. Our results indicate a novel strategy also for the treatment of

trastuzumab resistance in tumors. Thus, the inhibition of these two signaling proteins

may lead to a more effective control of breast cancer.




3

Introduction

HER2 is a member of the HER (EGFR/ErbB) receptor family encompassing the four

HER receptors (HER1-HER4) that are involved in signal transduction (1). Each of

these receptors contains an extracellular, a trans-membrane and an intracellular

domain. In response to extracellular stimuli, the HER receptors form a homo- or

heterodimer via autophosphorylation of the intracellular domains of the receptors (2).

Subsequently, the HERs activate many signaling proteins that are linked to cell

proliferation and tumor malignancy. The HER receptors are highly involved in breast

cancer progression, and for HER2 in particular, there is a large body of experimental

and clinical data underlining its significance. Regarding its clinical relevance, HER2 is

overexpressed in 25 % to 30 % of breast cancer patients and is associated with a

poor prognosis (3). In addition to surgery and hormonal and chemo- or radiation-

therapy, an antibody-based immunotherapy for HER2-positive tumors has been

successfully administered in the last decade (4, 5). However, only a third of breast

tumors highly overexpress HER2 and therefore may be considered for the anti-

HER2-targeted antibody (trastuzumab). Moreover, trastuzumab therapy causes side

effects (cardiotoxicity) (6), and after approximately one year of application, the

development of resistance is not uncommon (7, 8). Combinations of trastuzumab with

the small molecule tyrosine kinase inhibitor lapatinib targeting EGFR and HER2

seem to provide remedy to some extent. Still, also lapatinib, either as a single agent,

or in combination with various chemotherapeutic agents, or trastuzumab, could not

fulfill the high expectations as initially hoped for (5). HER2 knockdown in vitro led to

reduced proliferation and induced apoptosis of HER2-overexpressing breast cancer

cell lines (9). In addition, the simultaneous knockdown of HER2 and uPAR (urokinase

plasminogen activator receptor) resulted in a higher induction of apoptosis and a




4

stronger inhibition of cell proliferation than the single knockdown of either HER2 or

uPAR (10).

Another factor with relevance in tumor progression is PTK6, also known as Brk

(breast tumor kinase). This non-receptor Src-related tyrosine kinase is highly

expressed in up to 80 % of breast cancers, as well as in colon and prostate tumors

(11, 12). PTK6 was also shown to be expressed in several cancer cell lines (11-13).

In the last decade, our group and others have identified several interaction partners

of PTK6, such as signal transducer and activator of transcription (STAT3), (p38)

MAPK, Paxillin and PTEN (14-17). Therefore, PTK6 seems to be involved in several

cellular processes, such as proliferation, migration and invasion. PTK6 was also

shown to regulate the cell cycle (18). PTK6 knockdown led to a diminished

phosphorylation of STAT3, (p38) MAPK and PTEN, as well as to a reduced migration

of breast cancer cells (15, 19).

Studies by our group and others showed that HER2 and PTK6 are co-expressed and

co-localized, and they directly interact with each other in breast cancer tissue.

Furthermore, the HER2 and PTK6 mRNA and protein levels are positively correlated,

emphasizing their role as crucial molecules in breast cancer (17, 20-22). In 2004,

Tanner and colleagues identified a novel HER2-overexpressing cell line that is

intrinsically resistant to trastuzumab and named it JIMT-1 (23). Since then, an

appropriate experimental model system has been established to study the possible

causes of intrinsic and acquired trastuzumab resistance. In the meantime, several

mechanisms for trastuzumab resistance have been hypothesized, among others

including truncation of extracellular HER2, activation of alternative pathways, loss of

the tumor suppressor PTEN, or an interaction with Mucin-4 that potentially inhibits the

binding of trastuzumab to HER2 (8, 24, 25). A recent study described survivin (an

inhibitor of apoptosis) as indispensable for the survival of HER2-overexpressing and




5

trastuzumab-resistant breast cancer cells (26). However, the underlying mechanisms

for the development of resistance are not yet exactly known, and additional

therapeutic approaches in breast cancer are strongly needed. To date, no

information exists concerning the effects of the simultaneous inhibition of HER2 and

PTK6 on tumor cell biology and tumor progression. Additionally, in trastuzumab-

resistant JIMT-1 cells, this information could give valuable hints towards strategies

suited to circumvent the resistance to the clinical trastuzumab-based regimens.

In our present study, we demonstrate for the first time the cell line-dependent effects

on the deactivation of key proteins and a reduction in migration, invasion and cell

proliferation in vitro following the simultaneous knockdown of HER2 and PTK6 in

breast cancer cells. Subsequent xenograft experiments revealed the effectiveness of

silencing these signaling proteins in vivo. Therefore, the inhibition of HER2 and/or

PTK6 may offer an attractive tool for targeted breast cancer therapy, specifically in a

subgroup of patients who develop a resistance to trastuzumab during the course of

treatment.




6

Materials and methods

Cell culture and transient transfections

The following two permanent human breast cancer cell lines were used: T47D and

JIMT-1. The trastuzumab-sensitive T47D cell line (HTB-133) was acquired from

American Type Culture Collection. It was maintained in RPMI 1640 with GlutaMAX

(Roswell Park Memorial Institute, Life Technologies GmbH, Darmstadt, DE) and

trastuzumab-resistant cell line JIMT-1 (ACC 589) was acquired from the German

Collection of Microorganisms and Cell Cultures. The last cell line authentication was

performed in spring 2012. Therefore, genetic profiles were generated by the

company Eurofins (MWG Operon, Ebersberg, DE). For this, the PowerPlex® 16

System, a multiplex STR system, was performed. Subsequently, the obtained profiles

were introduced into the online STR matching analysis database that is provided by

the DSMZ. The cells were maintained in DMEM with GlutaMAX (Dulbecco´s modified

eagles medium, Life Technologies GmbH, Darmstadt, DE). Both media were

supplemented with human insulin (10 µg/ml, St. Louis, MO, USA), 10 % fetal bovine

serum (FBS, Life Technologies GmbH, Darmstadt, DE), 0.25 % each of penicillin

and streptomycin (Life Technologies GmbH, Darmstadt, DE), and also with 0.1 %

FBS when the serum-independent effects (in the migration, invasion assays, and

MMP activation, as described below) were analyzed and the cells were maintained at

37°C in 5 % CO2. The medium for JIMT-1 cells was supplemented with trastuzumab

(10 µg/ml, Roche Diagnostics, Indianapolis, IN, USA).

For transient transfections, 1 x 106 breast cancer cells were transfected with small

interfering RNAs (siRNAs) (200 pmol) for PTK6 and HER2 knockdown and control

siRNAs (positive control: siRNAs for GAPDH silencing, and negative control: a non-

targeting siRNA) as described (19). All siRNAs were purchased from Thermo




7

Scientific Dharmacon, Chicago, IL, USA. Two independent transfections were

performed.

Generation of lentiviral constructs for PTK6 and HER2 knockdown

Previously tested siRNAs leading to specific and efficient knockdown of PTK6 and

HER2 were used as templates for the generation of corresponding shRNAs. The 5’-3’

sequence of the forward primer for shRNA_PTK6 is: GATCCCCCCATTAAGGTGAT

TTCTCGTTCAAGAGACGAGAAATCACCTTAATGGTTTTTGGAAA, and the

sequence of the respective reverse primer is: AGCTTTTCCAAAAACCATTAAGGTG

ATTTCTCGTCTCTTGAACGAGAAATCACCTTAATGGGGG. The 5’-3’ sequence of

the forward primer for shRNA_HER2 is: GATCCCCGCTCATCGCTCACAACCAATT

CAAGAGATTGGTTGTGAGCGATGAGCTTTTTGGAAA, the sequence and of the

respective reverse primer: is: AGCTTTTCCAAAAAGCTCATCGCTCACAACCAATC

TCTTGAATTGGTTGTGAGCGATGAGCGGG. The construction of lentiviral vectors

was performed as published previously (27). In addition to specific shRNAs, all of the

vectors encoded the GFP gene for visualization and quantification of infections.

Lentiviral transductions of breast cancer cells

A total of 2.5 x 105 T47D and JIMT-1 breast cancer cells were infected with lentiviral

vectors encoding small hairpin RNAs: shRNA_PTK6, shRNA_HER2, the

shRNA_control (lacking the sequence for shRNA), and polybrene (Invitrogen,

Carlsbad, CA, USA) as described (27). The supernatants were removed 24 h after

infection. Fresh medium was added, and the cells were further maintained for several

weeks. The infected JIMT-1 cells were cultivated in parallel with or without the

addition of trastuzumab (10 µg/ml, Roche Diagnostics, Indianapolis, IN, USA) to

ensure the maintenance of resistance. Once per week, a defined fraction of infected




8

cells was used for Western blot analysis to control for knockdown efficiency, whereas

the residual fraction was further cultivated. As controls, cells were infected only with

the transduction reagents (mock) or with the lentiviral vectors lacking an shRNA

sequence, but containing the GFP gene (control vector). The infections were

performed in triplicates. The infection efficiency of T47D and JIMT-1 cells was

measured by FACS (fluorescence activated cell sorting) as described previously (19).

Western blot analysis

For SDS-PAGE and the subsequent Western blot analysis, T47D and JIMT-1 breast

cancer cells were treated as described previously (19). The proteins were detected

with primary antibodies targeting PTK6 (sc-1188), GAPDH (sc-25778) (Santa Cruz,

Biotechnology, Heidelberg, DE), HER2 (A0485) (DAKO, Glostrup, DK), (phospho,

9554) PTEN (9559), (phospho 4051) Akt (9272), (phospho, 4376) MAPK 1/3, (ERK

1/2) (4695), (phospho 9211) p38MAPK (9212), MMP9 (3852), phospho-STAT3

(9134), PARP (9532) (Cell Signaling Technology, Beverly, MA, USA), STAT3

(610190), p27 (610242) (BD Transduction Laboratories, Lexington, KY, USA), and

tubulin as a loading control (T5168, Sigma, St. Louis, MO, USA). The following

peroxidase-conjugated secondary antibodies were used: anti-rabbit (NA934V) and

anti-mouse (NA931V) (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). All

of the bands showing changed intensities were quantified relative to the control

bands using the Molecular Imager ChemiDocTM XRS and the analysis software

Quantity One® (Bio-Rad Laboratories, Hercules, CA, USA).

WST-1 cell proliferation assay

Cell proliferation was determined using the water-soluble tetrazolium WST-1 (4-[3-(4-

Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate) for the




9

spectrophotometric assay according to the manufacturer’s protocol (05015944001,

Roche Diagnostics, Mannheim, DE). T47D and JIMT-1 cells were seeded at a

concentration of 1 x 104 cells per well in a 96-well tissue culture plate. After 48 h, the

WST-1 reagent was added and the cells were incubated for 0.5 h to 4 h at 37°C. The

absorbance of the infected and the control cells was measured against a background

control using a microplate ELISA reader (Bio-Rad, München, DE) at 450 nm

(reference wavelength at 655 nm). Five independent experiments were performed.

For statistical analysis the Student’s t-test was used.

Wound scratch migration assay

The migration assay was performed in triplicates under serum-reduced conditions to

reduce proliferation (28) as described previously (19) with minor modifications. The

wound was scratched into a confluent monolayer 5 weeks post-infection and then

documented once a day with phase contrast microscopy on an inverted microscope

Evos (AMG, Bothell, WA, USA). The quantification was performed using TScratch

software (29). All open areas at time point 0 h were set to 100 %, and the open areas

at the later time points were calculated in relation to the respective value at 0 h. For

statistical analysis the Student’s t-test was used.

Matrigel invasion assay

Control or infected JIMT-1 breast cancer cells were seeded at a concentration of 5 x

104 in serum-reduced medium onto BD BioCoat Matrigel Invasion Chambers

(354480, BD Biosciences, Bedford, MA, USA), inserted in 24-well cell culture plates

and incubated for 24 h at 37°C. FBS (10 %) was used as chemoattractant in the

lower chamber, and the invasion assay was performed according to the

manufacturer’s instructions. After the incubation, non-invading cells were removed




10

with a cotton swab from the apical side of the membrane, and then the invading cells

were fixed with methanol and stained with toluidine blue. The invading cells were

counted microscopically (Olympus, Hicksville, NY, USA). The assay was performed

after two independent infections.

In vivo experiments in female nude mice

The animal studies were performed in accordance with the German and European

laws on animal welfare. The treatments were approved by the Bavarian authorities on

veterinary issues (file no. 55.2-1-54-2531-118-10). The female athymic nude mice

(Crl:NU-Foxn1 nu) (originating from Charles River Laboratories, Sulzfeld, DE) were

maintained in a pathogen-free environment. Five-week-old female nude mice were

inoculated once into the mammary fat pad (m.f.p.) with 1 x 106 T47D or JIMT-1 cells

in 50 µl. The cells were suspended in PBS and mixed with an equal volume of

Matrigel (354234, BD Matrigel, BD Biosciences, Bedford, MA, USA). The tumor size

was estimated as the product of the length and width of the xenograft measured once

a week with a caliper. The data were collected between day 16 post-injection (p.i.)

and day 56 p.i. eight weeks p.i., or when the xenograft reached approximately 1 cm3,

the mice were euthanized. The increases in the tumor size over time were estimated

by ANOVA, and the individual size measurements from each day were normalized to

the average size on day 23 p.i. for the JIMT-1 cell xenografts or on day 56. p.i. for the

T47D cell xenografts. These normalized tumor sizes were tested for differences

between the four injected cell line approaches using the Mann Whitney U-test. P-

values that were less than 0.05 were considered to be statistically significant. The

median and standard errors of the normalized tumor sizes were calculated.




11

Results

The simultaneous knockdown of PTK6 and HER2 in breast cancer cells led to

stronger effects in the HER receptor signaling pathway

Before stably downregulating HER2 and PTK6, their expression was transiently

downregulated with siRNAs in the T47D and JIMT-1 cell lines to investigate the effect

of simultaneous knockdown. As recently shown by us, specific and efficient siRNAs

for PTK6 knockdown were identified as described (19). The siRNAs for HER2

knockdown led to a specific and effective downregulation (Fig. 1A). The simultaneous

knockdown of PTK6 and HER2 after 72 h (using the most efficient siRNAs,

respectively) shows that the phosphorylation of MAPK 1/3 (ERK 1/2) at

Thr202/Tyr204 and of STAT3 at Ser727 is further reduced compared with the

phosphorylation status following single HER2 or PTK6 downregulation (Fig. 1B).

Based on these results, for stable and simultaneous knockdown of HER2 and PTK6,

the T47D and JIMT-1 cell lines were efficiently infected with lentiviral particles

encoding sequences for shRNAs. Due to the stable integration of the sequences into

the host genome, the infections led to a stable downregulation of the target proteins.

We show the effects of the stable and simultaneous knockdown of PTK6 and HER2

on selected signaling proteins downstream of HER2 and PTK6 (Fig. 2 and Fig. 3).

Because the results from JIMT-1 cells that were incubated with and without

trastuzumab were comparable, we only show the results obtained from cells

cultivated with trastuzumab (Fig. 2). In JIMT-1 and T47D cells the protein expression

levels of HER1, HER3, HER4, were not changed (data not shown) following the

knockdown of HER2 and PTK6 but the phosphorylation of HER receptor-dependent

signaling proteins was affected. Compared with the mock and vector controls, the

phosphorylation of MAPK 1/3 (ERK 1/2) at Thr202/Tyr204 in the JIMT-1 cell line was




12

significantly reduced after HER2 (p < 0.001) or PTK6 (p < 0.001) silencing, and in

both cell lines it was significantly decreased due to the combined downregulation

(Fig. 2B and Fig. 3B). Phosphorylated, and therefore activated, MAPK mediates

cellular processes such as proliferation, differentiation and migration by

phosphorylation of its substrates (15). In contrast, p38 MAPK is activated due to

environmental stress and is involved in regulating cell death (15). The

phosphorylation of p38 MAPK at Thr180/Tyr182 leads to the activation of other

MAPK and transcription factors. In T47D and JIMT-1 cells, the simultaneous

downregulation of HER2 and PTK6 resulted in a further reduced phosphorylation of

this kinase than single knockdown alone (Fig. 2A and Fig. 3A). However in JIMT-1

cells the dual knockdown significantly reduced the phosphorylation compared with

single knockdowns (Fig. 2B). Consequently anti-apoptotic signaling via p38 MAPK

may be reduced.

In addition, Akt is activated by phosphorylation at Thr308 and Ser473, regulating

survival and apoptosis by inhibiting the target proteins (30). The single and the

simultaneous knockdowns of HER2 and PTK6 led to a reduced phosphorylation of

Akt at Ser473 in both cell lines (Fig. 2 and Fig. 3). In particular, in T47D cells,

compared with PTK6-depleted cells, the dual knockdown significantly reduced the

phosphorylation (Fig. 3B). The phosphorylation status at Thr308 was not changed

(data not shown).

STAT3 is an additional signaling protein that mediates cell growth, survival,

differentiation and gene expression via phosphorylation at Tyr705 followed by

dimerization, translocation to the nucleus and DNA binding (31). STAT3 that is

phosphorylated at Ser727 promotes gene expression. Following combined

downregulation in JIMT-1 cells, we observed a slightly diminished phosphorylation of

STAT3 at Ser727 (Fig. 2). In T47D cells the phosphorylation at this site was




13

significantly reduced in HER2-depleted cells (p = 0.002) and also significantly

decreased in cells depleted of both compared with the PTK6 knockdown alone (Fig.

3B). The phosphorylation of STAT3 at Tyr705 was not analyzed because this

phosphorylation site was marginal detectable in the cells.

The phosphatase PTEN is a tumor suppressor that negatively regulates the PI3K/Akt

pathway, and PTEN phosphorylation at Ser380/Thr382/383 lessens its activity as a

tumor suppressor (32). In both cell lines, only the simultaneous silencing of HER2

and PTK6 significantly reduced the phosphorylation of PTEN in comparison with

controls and single knockdowns (Fig. 2 and Fig. 3).

The simultaneous knockdown of PTK6 and HER2 enhanced p27 expression

and significantly reduced cell proliferation

The induction of apoptosis as a consequence of HER2 and PTK6 knockdown was

investigated based on PARP (poly-ADP-ribose polymerase) cleavage using Western

blot analysis. PARP was only cleaved when the breast cancer cells were incubated

for 24 h with staurosporine, an unspecific kinase inhibitor that induces apoptosis

(positive control), and not after PTK6 and HER2 downregulation (Fig. 4A).

We also analyzed the expression of cell cycle proteins depending on HER2 and

PTK6 protein levels. The protein expression of cyclins and cdk2 following single and

simultaneous knockdown of HER2 and PTK6 was not affected in T47D and JIMT-1

cells (data not shown). However, compared with the mock and vector controls, in

both cell lines an induction of the cell cycle inhibitor p27 was observed due to HER2

and PTK6 knockdown (Fig. 4B).

We examined the proliferation of T47D and JIMT-1 cells by analyzing the enzymatic

cleavage of tetrazolium salts into formazan (WST-1 assay). This reaction can be

proceeded in metabolically active cells, and the amount of formazan dye is directly




14

associated with the amount of viable cells (33). Compared with control cells (mock),

the number of cells following HER2 knockdown is significantly reduced (T47D cells: p

< 0.008, JIMT-1 cells: p = 0.004) (Fig. 4C). It is also reduced when PTK6 is silenced

(T47D and JIMT-1 cells: p < 0.001, respectively), and following simultaneous

knockdown, the number of metabolically active cells is additively diminished (T47D

cells and JIMT-1 cells: p < 0.001, respectively). The differences between HER2-

depleted cells and cells depleted of both proteins (T47D and JIMT-1 cells: p < 0.001,

respectively), or between PTK6-depleted cells and cells depleted of both proteins

(T47D cells: p < 0.001, JIMT-1 cells: p = 0.04), were also statistically significant (Fig.

4C).

Stronger reduced migration and invasion of breast cancer cells due to the

simultaneous knockdown of PTK6 and HER2

To further determine the effects of HER2 and PTK6 silencing in breast cancer cells,

the migration and invasion of the cells were analyzed in vitro. JIMT-1 cells were

seeded into six-well plates, then a wound was scratched into the confluent monolayer

and the cells were observed for the following 72 h under serum-reduced conditions,

as exemplarily shown (Fig. 5A). Whereas the control JIMT-1 cells almost overgrow

the open area (mock (6 %) and control vector (5 %), Fig. 5B), the open area of

HER2-depleted cells was at 39 % (p = 0.037), of PTK6-depleted cells was at 42 % (p

= 0.008) indicating a significantly reduced migration. Moreover, the simultaneous

HER2 and PTK6 knockdown further reduced the cell migration, as indicated by an

area that remained over 52 % opened (p = 0.003, Fig. 5B) but it is not significant

compared with single knockdowns. Due to a very strong HER2-knockdown effect in

the T47D cell line, these cells (approaches with HER2-depleted and cells depleted of

both: HER2 and PTK6) did not became confluent and since this is a prerequisite for




15

the scratch assay the cells could not be used for the migration assay. Furthermore,

the invasion of JIMT-1 cells was also reduced in vitro due to the combined silencing

of HER2 and PTK6 when compared with single downregulation of the respective

proteins (Fig. 6A). Indeed, the values were statistically not significant but a clear

tendency was observed. In the control experiments, the amount of invasive cells was

approximately 100 % (mock) or 90 % (empty vector), respectively. Following HER2,

PTK6 or simultaneous silencing, the amount of invasive cells was approximately 60

%, 40 % and 20 %, respectively (Fig. 6A).

To confirm the outcome of reduced invasion, we analyzed the cleavage, and

therefore the activation, of MMP9 (matrix metalloproteinase 9) by immunoblotting

using supernatants of JIMT-1 cells that were cultivated in serum-reduced medium.

MMPs mediate the digestion of the extracellular matrix and play an important role in

wound healing, tumor invasion, angiogenesis and carcinogenesis (34). The cleavage

of the precursor protein into the active MMP is required for invasion (34). In

comparison with controls (mock and control vector), the cleavage and thus the

activation of MMP9 (illustrated by the band at 84 kDa) is diminished when PTK6 and

both proteins are downregulated (Fig. 6B). Here, we only show the results obtained

with JIMT-1 cells because T47D cells are less invasive and express lower levels of

MMP9.

Significantly reduced in vivo tumor growth following HER2 and PTK6

knockdown

Female nude mice were inoculated with control cells (T47D cells and JIMT-1 cells

infected with the control vector), and with T47D or JIMT-1 cells that were depleted of

HER2, PTK6 and with cells containing the combined knockdown. The median tumor

size (normalized to the average on day 23 p.i.) in JIMT-1 xenografts was significantly




16

reduced following PTK6 knockdown (32.7 mm2 to 25.9 mm2 = -21 %; p = 0.0003),

HER2 knockdown (32.7 mm2 to 29.4 mm2 = -10.2 %; p = 0.0008), and the combined

PTK6 and HER2 knockdown (32.7 mm2 to 29.3 mm2 = -10.4 %, p = 0.0007) (Fig. 7).

Concerning T47D cell xenografts, the median tumor size was estimated at the end of

the experiment (day 56 p.i.) due to a slower proliferation of the T47D cells. In all

approaches, the reduction of xenograft size of HER2- and PTK6-depleted T47D cells

was statistically significant (p ≤ 0.0001) (Fig. 7). In comparison with control

xenografts (10.2 mm2), the size of HER2-depleted xenografts was reduced to

approximately 5.2 mm2 (-49 %), of PTK6-depleted xenografts to approximately 8.7

mm2 (-15 %) and the size of xenografts depleted of both were reduced to

approximately 6.4 mm2 (- 37 %).




17

Discussion

A possible approach for a targeted therapy for breast cancer is the anti-HER2

treatment by means of employing the humanized antibody trastuzumab in HER2-

overexpressing tumors. However, a percentage of them become resistant within a

year of administration of the antibody (7, 8). Therefore, novel biomarkers and targets

are needed for additional tailored therapies in breast cancer. One expedient concept

to circumvent the development of resistance to breast cancer therapy would be

simultaneous targeting of different, but physiologically related, targets within already

validated cancer-related signaling pathways. Nevertheless, to date, studies that

examine and confirm the advantageous effects of simultaneous knockdown of such

target pairs are still scarce, although some groups have reported stronger or

synergistic effects following the simultaneous knockdown of uPAR and HER2, uPAR

and MMP9, or uPA and uPAR (10, 35, 36).

In previous studies, we have demonstrated the association of HER2 with PTK6 in

breast cancer (19, 20, 22). These studies led us to investigate the effects of

simultaneous knockdown of HER2 and PTK6. To demonstrate stronger effects in

regards to the reduction of tumor progression, we simultaneously knocked down

HER2 and PTK6 in T47D cells and in trastuzumab-resistant JIMT-1 cells. This

inhibition may offer an attractive approach for directed therapy of resistant breast

tumors.

Prompted by preliminary results in which the transient and simultaneous

downregulation of HER2 and PTK6 revealed to be more efficient involving the

reduced phosphorylation of HER2-associated signaling proteins, we stably silenced

HER2 and PTK6 in two human breast cancer cell lines. MAPKs, STAT3, Akt, and

PTEN are involved in tumorigenic processes, and reduced phosphorylations of these

signaling proteins may more strongly inhibit cell proliferation, migration and anti-




18

apoptotic pathways (14, 15, 30, 32). Consequently, the tumor cell growth regulated

by these proteins may be reduced. In the JIMT-1 cell line the effects concerning

reduced phosphorylation of MAPK 1/3 (ERK 1/2) were the most extensive and

compared with single knockdowns, the simultaneous silencing of both proteins

resulted in a further statistically significant reduction of phosphorylation. Our results

are in agreement with previous studies showing decreased phosphorylations of (p38)

MAPK (MAPK 1/3, ERK 1/2) following PTK6 knockdown (15).

Regarding the STAT3 activation at Ser727, we observed a slightly reduced

phosphorylation after simultaneous knockdown in JIMT-1 cells whereas in T47D cells

a HER2-knockdown dependent phosphorylation was observed. Usually, PTK6 is

involved in the phosphorylation of STAT3 at Tyr705 (31), but phosphorylation at this

site was not detectable in JIMT-1 and T47D cells. Because the phosphorylation of

STAT3 at Ser727 is affected by the MAPK pathway (37), we assume that there is an

indirect regulation of STAT3 at Ser727 via the MAPK that was explicitly reduced

following the combined silencing. Interestingly, due to siRNA-mediated

downregulation, the phosphorylation of STAT3 at Ser727 was already reduced

following the single HER2 or PTK6 knockdown. We hypothesize that the long-term

downregulation causes a time-dependent adaptation of the cells and compensates

for the absent phosphorylation at Ser727 by activation of alternative kinases. The

reduced phosphorylation of Akt at Ser473 in particular after HER2 and simultaneous

silencing suggests a HER2-dependent regulation. This result correlates with a study

presented by Knuefermann et al. (38), demonstrating Akt activation through the

HER2/PI-3K pathway in breast adenocarcinoma cells. In addition, Ostrander showed

no change in the phosphorylation of Akt following PTK6 knockdown (15). The

phosphorylation, and therefore the inactivation of the tumor suppressor PTEN was

significantly reduced only when both proteins were silenced in combination. Here, we




19

also assume a time-dependent compensation regulated by other kinases when HER2

or PTK6 were stably knocked down. According to our observations, the effects

following the dual knockdown may be based on the inhibition of HER2-associated

pathways, and additionally by diminished PTK6-regulated signaling involved in EGFR

(epidermal growth factor receptor) and IGF-1R (insulin-like growth factor-1 receptor)

pathways, for example (21, 39).

Although the simultaneous knockdown led to a reduced activation of several

signaling proteins involved in tumorigenesis, an induction of apoptosis was not

observed. It seems that even a combined knockdown of HER2 and PTK6 was not

powerful enough to induce apoptosis neither in T47D nor in JIMT-1 cells. Our results

regarding the additive effects due to simultaneous knockdown are in agreement with

previous studies showing stronger effects following combined silencing of other target

proteins (10, 35, 36, 40). However, RNAi of HER2 and uPAR together, with the

addition of trastuzumab, induced apoptosis in breast cancer cells (10). This outcome

may be explained by the application of different cell lines, e.g., SKBR-3 or BT474,

which are sensitive to trastuzumab in contrast to JIMT-1 cells, and by the fact that the

proliferation in these cell lines is more dependent on HER2 expression levels than in

JIMT-1 cells (9, 10).

While the cell cycle protein expression (cyclin A, cyclin D1, cyclin E and cdk2; data

not shown) was not affected following downregulation, the expression of the cell

cycle inhibitor p27 was clearly elevated in T47D and JIMT-1 cells when HER2, PTK6,

and both were knocked down. This may result in a G1-arrest and therefore in a

reduced cell cycle progression. This outcome corresponds to the significantly

pronounced decrease in the percentage of viable cells following the combined

downregulation of HER2 and PTK6. Our results are in accordance with a previous

study showing regulation of p27 expression by PTK6 in MDA-MB-231 breast cancer




20

cells through the activity of its transcription factor FoxO3a (18). Another study

reported an EGCG (epigallocatechin-3 gallate)-induced inhibition of growth in HER2-

positive breast cancer cells via repression of FoxO3a and induction of p27 (41).

However, PTK6 silencing seemed to influence the trastuzumab-resistant JIMT-1 cell

proliferation more than HER2 knockdown. In T47D cells the HER2 knockdown

impaired the cell proliferation more than the PTK6 downregulation.

The stronger effects due to simultaneous RNAi were also underpinned by reduced

migration and invasion of JIMT-1 cells in vitro, correlated with a reduced activation of

MAPK 1/3 (ERK 1/2) and MMP9. Both proteins are also involved in cell motility,

wound healing and invasion (15, 34). Migration and invasion are complex processes,

and both highly contribute to the malignancy of tumor cells (42). Although each single

silencing statistically reduced JIMT-1 cell migration and the simultaneous approach

further diminished the migration, in comparison with single knockdowns it was not

statistically significant. We suggest that the single silencing effect, in particular the

PTK6 RNAi, was so strong that the dual knockdown leads not any more to significant

changes. However, the migration and invasion of JIMT-1 cells seemed to be more

affected by the depletion of PTK6 than of HER2.

To demonstrate the effect of HER2 and PTK6 silencing in vivo, we performed animal

experiments with female immunosuppressed nude mice. The tumor growth was

significantly reduced following HER2, PTK6 and simultaneous knockdown.

Interestingly, in JIMT-1 cells PTK6 downregulation seemed to have a greater impact

on reducing tumor growth than HER2 RNAi, whereas in T47D cells the HER2

knockdown stronger impaired the cells in vivo. These results partly reflect our

observations from the previously performed in vitro assays. This outcome might be

related to the different genotypic features of the respective cell line, namely that the

survival of the JIMT-1 cells is not as strongly regulated by HER2 protein expression,




21

as it may be in other HER2-overexpressing and HER2-dependent cell lines, e.g.,

SKBR-3 or BT474 (9, 10, 43). In addition, the strong effect of PTK6 knockdown may

also be associated with the fact that PTK6 is expressed in approximately 80 % of

breast tissues (13), and therefore, it may be an additional target in particular

considering the therapy of trastuzumab-resistant breast cancers. Furthermore,

although the HER2 expression in T47D cells is not very high, the HER2 knockdown

in this cell line has a greater impact than the PTK6 RNAi. This indicates a highly

HER2-dependent proliferation which may also be correlated with the trastuzumab-

sensitivity of T47D cells (data not shown). Consistent with our findings, some

research groups showed that overexpression of HER2 and PTK6 in vitro and in vivo

increases breast cancer tumorigenesis (21, 44, 45). Accordingly, when HER2 was

downregulated, the cell proliferation of JIMT-1 breast cancer cells was also reduced

in vivo (9, 46). Concerning PTK6 knockdown in vivo only investigations in the murine

small intestine are described and demonstrate a contrary role compared with its role

in breast cancer (47, 48).

Unexpectedly, although the reduction of tumor growth in vivo following single PTK6

or HER2 knockdown was significantly reduced in both cell line xenografts, the

combined approach led to an intermediate reduction of the tumor size and not to an

additive one. Here, we hypothesize that in contrast to the positively infected cells of

the combined knockdown approach (which significantly reduced the cell proliferation),

the minimal number of non-infected cells which have a survival benefit may stronger

proliferate during the experiment duration of up to eight weeks.

In summary, our experiments for the first time provide evidence that the knockdown

of HER2 and/or PTK6 can stronger inhibit tumor progression through the significantly

reduced activation of key proteins that are linked to tumorigenesis, and via

diminished migration, invasion and cell proliferation leading to significantly decreased




22

tumor growth. Consequently, our results demonstrate that the inhibition of HER2

and/or PTK6 proteins represent an attractive tool in targeted breast cancer therapy.

Acknowledgements

The authors acknowledge the high technical expertise of Michaela Häusler, Katrin

Lindner, and Stefanie Winkler. We also thank Boris Schön for animal care, and

Elenore Samson and Jacqueline Müller for assistance related to animal treatment.




23

References

1. Moasser MM. Targeting the function of the HER2 oncogene in human cancer

therapeutics. Oncogene 2007;26:6577-92.

2. Sergina NV, Moasser MM. The HER family and cancer: emerging molecular

mechanisms and therapeutic targets. Trends Mol Med 2007;13:527-34.

3. Ross JS, Fletcher JA, Bloom KJ, Linette GP, Stec J, Clark E, et al. HER-2/neu

testing in breast cancer. Am J Clin Pathol 2003;120:53-71.

4. Ménard S, Pupa SM, Campiglio M, Tagliabue E. Biologic and therapeutic role of

HER2 in cancer. Oncogene 2003;22:6570-8.

5. Awada A, Bozovic-Spasojevic I, Chow L. New therapies in HER2-positive breast

cancer: A major step towards a cure of the disease? Cancer Treat Rev. 2012

6. Sparano JA. Cardiac toxicity of trastuzumab (Herceptin): implications for the

design of adjuvant trials. Semin Oncol 2001;28:20-7.

7. Kopper L. Lapatinib: a sword with two edges. Pathol Oncol Res 2008;14:1-8.

8. Nagy P, Friedländer E, Tanner M, Kapanen AI, Carraway KL, Isola J, et al.

Decreased accessibility and lack of activation of ErbB2 in JIMT-1, a herceptin-

resistant, MUC4-expressing breast cancer cell line. Cancer Res 2005;65:473-

82.

9. Faltus T, Yuan J, Zimmer B, Krämer A, Loibl S, Kaufmann M, et al. Silencing of

the HER2/neu gene by siRNA inhibits proliferation and induces apoptosis in

HER2/neu-overexpressing breast cancer cells. Neoplasia 2004;6:786-95.

10. Li C, Cao S, Liu Z, Ye X, Chen L, Meng S. RNAi-mediated downregulation of

uPAR synergizes with targeting of HER2 through the ERK pathway in breast

cancer cells. Int J Cancer 2010;127:1507-16.




24

11. Llor X, Serfas W, Bie V, Vasioukhin M, Polonskaia J, Derry J, et al. BRK/Sik

expression in the gastrointestinal tract and in colon tumours, Clin Cancer Res

1999;5:1767-77.

12. Derry J.J, Rins G.S., Ray V, Tyner A.L. Altered localization and activity of the

intracellular tyrosine kinase BRK/Sik in prostate tumour cells. Oncogene

2003;22: 4212-20.

13. Mitchell PJ, Barker KT, Martindale JE, Kamalati T, Lowe PN, Page MJ, et al.

Cloning and characterisation of cDNAs encoding a novel non-receptor tyrosine

kinase, brk, expressed in human breast tumours. Oncogene 1994;9:2383-90.

14. Ikeda O, Miyasaka Y, Sekine Y, Mizushima A, Muromoto R, Nanbo A, et al.

STAP-2 is phosphorylated at tyrosine-250 by Brk and modulates Brk-mediated

STAT3 activation. Biochem Biophys Res Commun 2009;384:71-5.

15. Ostrander JH, Daniel AR, Lofgren K, Kleer CG, Lange CA. Breast tumor kinase

(protein tyrosine kinase 6) regulates heregulin-induced activation of ERK5 and

p38 MAP kinases in breast cancer cells. Cancer Res 2007;67:4199-209.

16. Chen HY, Shen CH, Tsai YT, Lin FC, Huang YP, Chen RH. Brk activates rac1

and promotes cell migration and invasion by phosphorylating paxillin. Mol Cell

Biol 2004;24:10558-72.

17. Aubele M, Walch AK, Ludyga N, Braselmann H, Atkinson MJ, Luber B, et al.

Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of

breast cancer patients. Br J Cancer 2008;99:1089-95.

18. Chan E, Nimnual AS. Deregulation of the cell cycle by breast tumor kinase

(Brk). Int J Cancer 2010;127:2723-31.

19. Ludyga N, Anastasov N, Gonzalez-Vasconcellos I, Ram M, Höfler H, Aubele M.

Impact of protein tyrosine kinase 6 (PTK6) on human epidermal growth factor

receptor (HER) signalling in breast cancer. Mol Biosyst 2011;7:1603-12.




25

20. Born M, Quintanilla-Fend L, Braselmann H, Reich U, Richter M, Hutzler P, et al.

Simultaneous over-expression of the Her2/neu and PTK6 tyrosine kinases in

archival invasive ductal breast carcinomas. J Pathol 2005;205:592-6.

21. Xiang B, Chatti K, Qiu H, Lakshmi B, Krasnitz A, Hicks J, et al. Brk is

coamplified with ErbB2 to promote proliferation in breast cancer Proc Natl Acad

Sci U S A 2008;105:12463-8.

22. Aubele M, Spears M, Ludyga N, Braselmann H, Feuchtinger A, Taylor KJ, et al.

In situ quantification of HER2-protein tyrosine kinase 6 (PTK6) protein-protein

complexes in paraffin sections from breast cancer tissues. Br J Cancer

2010;103:663-7.

23. Tanner M, Kapanen AI, Junttila T, Raheem O, Grenman S, Elo J, et al.

Characterization of a novel cell line established from a patient with Herceptin-

resistant breast cancer. Mol Cancer Ther 2004;3:1585-92.

24. Valabrega G, Montemurro F, Aglietta M. Trastuzumab: mechanism of action,

resistance and future perspectives in HER2-overexpressing breast cancer. Ann

Oncol 2007;18:977-84.

25. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA, et al. PTEN activation

contributes to tumor inhibition by trastuzumab, and loss of PTEN predicts

trastuzumab resistance in patients. Cancer Cell 2004;6:117-27.

26. Oliveras-Ferraros C, Vazquez-Martin A, Cufí S, Torres-Garcia VZ, Sauri-Nadal

T, Barco SD, et al. Inhibitor of Apoptosis (IAP) survivin is indispensable for

survival of HER2 gene-amplified breast cancer cells with primary resistance to

HER1/2-targeted therapies. Biochem Biophys Res Commun 2011;407:412-9.

27. Anastasov N, Klier M, Koch I, Angermeier D, Höfler H, Fend F, et al. Efficient

shRNA delivery into B and T lymphoma cells using lentiviral vector-mediated

transfer. J Hematop 2009;2:9-19.




26

28. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and

inexpensive method for analysis of cell migration in vitro. Nat Protoc

2007;2:329-33.

29. Gebäck T, Schulz MM, Koumoutsakos P, Detmar M. TScratch: a novel and

simple software tool for automated analysis of monolayer wound healing

assays. Biotechniques. 2009 Apr;46(4):265-74.

30. Songyang Z, Baltimore D, Cantley LC, Kaplan DR, Franke TF. Interleukin 3-

dependent survival by the Akt protein kinase. Proc Natl Acad Sci U S A

1997;94:11345-50.

31. Liu L, Gao Y, Qiu H, Miller WT, Poli V, Reich NC. Identification of STAT3 as a

specific substrate of breast tumor kinase. Oncogene 2006;25:4904-12.

32. Vazquez F, Ramaswamy S, Nakamura N, Sellers WR. Phosphorylation of the

PTEN tail regulates protein stability and function. Mol Cell Biol 2000;20:5010-8.

33. Berridge M. V., Tan A. S., McCoy K. D., Wang R. The Biochemical and Cellular

Basis of Cell Proliferation Assays That Use Tetrazolium Salts. Biochemica

1996;4:15-9.

34. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in cancer

progression. Nat Rev Cancer 2002;2:161-74.

35. Kunigal S, Lakka SS, Gondi CS, Estes N, Rao JS. RNAi-mediated

downregulation of urokinase plasminogen activator receptor and matrix

metalloprotease-9 in human breast cancer cells results in decreased tumor

invasion, angiogenesis and growth. Int J Cancer 2007;121:2307-16.

36. Subramanian R, Gondi CS, Lakka SS, Jutla A, Rao JS. siRNA-mediated

simultaneous downregulation of uPA and its receptor inhibits angiogenesis and

invasiveness triggering apoptosis in breast cancer cells. Int J Oncol

2006;28:831-9.




27

37. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by Stat1 and

Stat3 requires both tyrosine and serine phosphorylation. Cell 1995;82:241-50.

38. Knuefermann C, Lu Y, Liu B, Jin W, Liang K, Wu L, et al. HER2/PI-3K/Akt

activation leads to a multidrug resistance in human breast adenocarcinoma

cells. Oncogene 2003;22:3205-12.

39. Irie HY, Shrestha Y, Selfors LM, Frye F, Iida N, Wang Z, et al. PTK6 regulates

IGF-1-induced anchorage-independent survival. PLoS One 2010;5:e11729.

40. Gondi CS, Rao JS. Therapeutic potential of siRNA-mediated targeting of

urokinase plasminogen activator, its receptor, and matrix metalloproteinases.

Methods Mol Biol 2009;487:267-81

41. Eddy SF, Kane SE, Sonenshein GE. Trastuzumab-resistant HER2-driven

breast cancer cells are sensitive to epigallocatechin-3 gallate. Cancer Res

2007;67:9018-23.

42. Stetler-Stevenson WG, Aznavoorian S, Liotta LA. Tumor cell interactions with

the extracellular matrix during invasion and metastasis. Annu Rev Cell Biol

1993;9:541-73.

43. Choudhury A, Charo J, Parapuram SK, Hunt RC, Hunt DM, Seliger B, et al.

Small interfering RNA (siRNA) inhibits the expression of the Her2/neu gene,

upregulates HLA class I and induces apoptosis of Her2/neu positive tumor cell

lines. Int J Cancer 2004;108:71-7.

44. Shen CH, Chen HY, Lin MS, Li FY, Chang CC, Kuo ML, et al. Breast tumor

kinase phosphorylates p190RhoGAP to regulate rho and ras and promote

breast carcinoma growth, migration, and invasion. Cancer Res 2008;68:7779-

87.

45. Lofgren KA, Ostrander JH, Housa D, Hubbard GK, Locatelli A, Bliss RL, et al.

Mammary gland specific expression of Brk/PTK6 promotes delayed involution




28

and tumor formation associated with activation of p38 MAPK. Breast Cancer

Res 2011;13:R89.

46. Hu X, Su F, Qin L, Jia W, Gong C, Yu F, et al. Stable RNA interference of ErbB-

2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and

in vivo. Biochem Biophys Res Commun 2006;346:778-85.

47. Haegebarth A, Bie W, Yang R, Crawford SE, Vasioukhin V, Fuchs E, et al.

Protein tyrosine kinase 6 negatively regulates growth and promotes enterocyte

differentiation in the small intestine. Mol Cell Biol 2006;26:4949-57.

48. Palka-Hamblin HL, Gierut JJ, Bie W, Brauer PM, Zheng Y, Asara JM, et al.

Identification of beta-catenin as a target of the intracellular tyrosine kinase

PTK6. J Cell Sci 2010;123:236-45.




29

Figure legends

Figure 1: The effective transient downregulation of HER2 and PTK6 in T47D and

JIMT-1 breast cancer cells by siRNA. A: The protein expression levels of T47D cells

after transfection with siRNA_HER2, si_GAPDH (positive control), a non-targeting

siRNA (negative control), and mock (cells transfected with transfection reagents

without siRNA) B: The protein expression levels of JIMT-1 and T47D cells after

transfections with siRNA_HER2, siRNA_PTK6 and a combination of siRNAs against

HER2, PTK6 and mock. The protein extracts were analyzed by immunoblotting using

primary antibodies targeting HER2, PTK6, phospho-STAT3, phospho-MAPK 1/3

(ERK 1/2), and tubulin (loading control). For quantification, the means of two

independent transfections were calculated.

Figure 2: The reduced phosphorylation of tumor-promoting signaling proteins

following stable single and simultaneous knockdown of HER2 and PTK6 in the

trastuzumab-resistant JIMT-1 cells. A: Western blot analysis of protein extracts using

primary antibodies targeting HER2, PTK6, (phospho) STAT3, (phospho) Akt,

(phospho) PTEN, (phospho) MAPK 1/3 (ERK 1/2), (phospho) p38 MAPK, and tubulin

(loading control). For quantification, the means of three independent infections were

calculated. B: The graphs show the quantifications of the phosphorylation status

relative to mock control. The mean values of three independent infections, the

standard deviations and the significant p-values of single and simultaneous

knockdown in comparison are shown. 1: mock, 2: control vector, 3: shRNAHER2, 4:

shRNAPTK6, 5: shRNAHER2 + shRNAPTK6.




30

Figure 3: The reduced phosphorylation of tumor-promoting signaling proteins

following stable single and simultaneous knockdown of HER2 and PTK6 in T47D

cells. A: Western blot analysis of protein extracts using primary antibodies targeting

HER2, PTK6, (phospho) STAT3, (phospho) Akt, (phospho) PTEN, (phospho) MAPK

1/3 (ERK 1/2), (phospho) p38 MAPK, and tubulin (loading control). For quantification,

the means of three independent infections were calculated. B: The graphs show the

quantifications of the phosphorylation status relative to mock control. The mean

values of three independent infections, the standard deviations and the significant p-

values of single and simultaneous knockdown in comparison are shown. 1: mock, 2:

control vector, 3: shRNAHER2, 4: shRNAPTK6, 5: shRNAHER2 + shRNAPTK6.

Figure 4: The simultaneous knockdown of HER2 and PTK6 does not induce

apoptosis, but it elevates the protein expression of p27 and leads to significantly

reduced cell proliferation. A: Western blot analysis of JIMT-1 and T47D cell extracts

using primary antibodies targeting full-length (116 kDa) and cleaved (89 kDa) PARP

and tubulin (loading control). B: Western blot analysis of JIMT-1 and T47D cell

extracts using primary antibodies targeting HER2, PTK6, p27 and tubulin (loading

control). For quantification, the mean values of three independent infections were

calculated. C: JIMT-1 and T47D cells were seeded at a concentration of 1 x 104 per

well and incubated for 48 h. The WST-1 reagent was added and the absorbance

measured after 1 h is shown. The graph represents the amount of viable cells in

relation to the mock control. The mean values of five independent experiments and

the standard deviations are shown. The differences between the mock control and

cells depleted of HER2 (T47D cells p < 0.008, JIMT-1 cells: p = 0.004), of PTK6

(T47D and JIMT-1 cells: p < 0.001, respectively), and of both (T47D and JIMT-1

cells: p < 0.001, respectively), as well as between HER2-depleted cells and cells




31

depleted of both proteins (T47D and JIMT-1 cells: p < 0.001, respectively), and

PTK6-depleted cells and cells depleted of both proteins (T47D cells: p < 0.001, JIMT-

1 cells: p = 0.04) were statistically significant. ** p < 0.001, * p ≤ 0.05.

Figure 5: The simultaneous knockdown of HER2 and PTK6 additively reduces JIMT-

1 cell migration. A: Representative figures illustrating the migration of JIMT-1 mock,

cells infected with empty vector, vectors for HER2 and PTK6 single knockdown,

respectively, and both vectors simultaneously. The percentages of the open area

were calculated using the TScratch software. B: The graph shows the mean values,

the standard deviations and respective p-values of three independent experiments.

The scale bars are 400 µm.

Figure 6: The simultaneous knockdown of HER2 and PTK6 and reduced JIMT-1 cell

invasion. A: Control (mock) and infected with empty vector, and vectors for HER2

and PTK6 single knockdown, respectively, and both vectors simultaneously were

seeded at a concentration of 5 x 104 onto invasion chambers in 24-well cell culture

plates and were incubated for 24 h at 37°C. Invasive cells were stained and counted.

The graph shows the means and the standard deviations of two independent

infections. B: Western blot analysis of the extracts from JIMT-1 cells (mock, infected

with the empty vector, and vectors for HER2 and PTK6 single knockdown,

respectively, and both vectors simultaneously) using primary antibodies targeting

HER2, PTK6, and cleaved (84 kDa) MMP9. For quantifications, the means of three

independent infections were calculated.

Figure 7: The knockdown of HER2 or PTK6 significantly reduces tumor growth in

vivo. Nude mice were orthotopically inoculated with JIMT-1 and T47D cells carrying a




32

control vector, cells depleted of HER2, PTK6 or of both proteins. The median and

standard error of the normalized tumor sizes are plotted, (n = 11 animals per group).

























Published OnlineFirst January 30, 2013.Mol Cancer Res Natalie Ludyga, Natasa Anastasov, Michael Rosemann, et al. cellsmalignancy and tumor progression in human breast cancer Effects of simultaneous knockdown of HER2 and PTK6 on

Updated version

10.1158/1541-7786.MCR-12-0378doi:

Access the most recent version of this article at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2013/01/30/1541-7786.MCR-12-0378To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-12-0378

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2013/01/30/1541-7786.MCR-12-0378


Documents

Effects of simultaneous knockdown of HER2 and PTK6 on … › content › molcanres › early › ... · In addition to surgery and hormonal and chemo- or radiation-therapy, an antibody-based