Ectopic Notch1 activation alters mammary cell fate during puberty and promotes the development of lactating

adenomas during pregnancy

by

Aaron Kucharczuk

A thesis submitted in conformity with the requirements for the degree of Masters, Department of Molecular Genetics,

University of Toronto

©Copyright by Aaron Kucharczuk 2009

ii

Ectopic Notch1 activation alters mammary cell fate during puberty and promotes the development of lactating

adenomas during pregnancy

Aaron Kucharczuk

Department of Molecular Genetics University of Toronto

Masters Degree

August 2009

Abstract The role that each of the Notch receptors play in controlling alveolar development and cell fate

determination in the mouse mammary gland has remained unclear. By utilizing a cre-conditional

constitutively active intracellular Notch1 knock-in I define, in vivo, that ectopic Notch1 activation is

sufficient to inhibit ductal outgrowth, cause the formation of alveolar-like cell accumulations, and

promote Elf5+/ER- cell fate, at the expense of ER+ cell fate, in the mammary gland of pubescent mice.

Furthermore, ectopic Notch1 in the pregnant mammary gland is sufficient to promote the formation of

pregnancy/lactation-dependent lactating adenomas. These lactating adenomas consist of differentiated

secretory cells and normally regress during involution but progress into non-regressing tumours after

multiple pregnancies. These lactating adenomas exhibit decapitation secretions characteristic of apocrine

differentiation. Together these results suggest that Notch1 may function to promote Elf5+/ER- cell fate

and may be misregulated in pregnancy-associated masses and apocrine-carcinoma of the breast in

humans.

iii

Acknowledgments

I wish to thank Dr. Sean Egan’s support, guidance, patience, vision, and instruction. From Sean I learnt important lessons on asking the right questions and he provided me the freedom to explore how to find the answers. Keli Xu and Kelvin Wang provided tremendous technical expertise and advice for which I will always be thankful. To the rest of the Egan lab, thanks for the many enlightening discussions about life past and present.

I also wish to thank my parents for their constant support in so many aspects of my life. They not only gave me life but also filled it with all the love and affection one could wish for and for that I am forever grateful. I dedicate this thesis to them.

iv

Table of Contents Abstract…………………………………………………………………………………………………......ii Acknowledgements…………………………………………………………………………………..…….iii Table of Contents…………………………………………………………………………………………..iv List of Tables and Figures……………………………………………………………………………..…....v List of abbreviations…………………………………………………………………………………..…...vi 1. Introduction……………………………………………………………………………….………..…….1

1.1 Mammary Gland Development……………………………………………………..………1 1.1.1 Puberty…………………………………………………………………………..……….1

1.1.1.1 Estrogen and Ductal Outgrowth…………………………………………..………….7 1.1.1.2 Progesterone and Ductal Branching……………………………………..……….....10

1.1.2 Pregnancy…………………………………………………………………..…………..11 1.1.2.1 Wnt/Progesterone and Alveolar Specification………………………..…………….11 1.1.2.2 Prolactin and Lactogenic Differentiation…………………………..……………….12

1.2 Notch Signaling Pathway………………………………………………..…………………13 1.2.1 Notch and Breast Cancer…………………………………………………………….....14 1.2.2 Notch and Breast Cancer Models…………………………………………………...….15 1.2.3 Notch and Mammary Gland Development……………………………………………..16

2. Objective………………………………………………………………………………………..…...…19 3. Materials and Methods...........................................................................................................................20

3.1 Breeding/Strains…………………..…………………………………………………...…….20 3.2 Genotyping…………………………………………………………………………...……...20 3.3 Wholemount………………………………………………………………………...……….21 3.4 Histology: Immunohistochemistry and Immunofluorescence ……………………………....21 3.5 Flow Cytometry……………………………………………………………………………...22 3.6 Transmission Electron Microscopy………………………………………………………….26

4. Results………………………………………………………………………………………………….29 4.1 Generation of Transgenic System for Analysis of Notch1 Function in the Developing

Mammary Gland……………………………………………………………………………..29 4.2 Pubertal Phenotype of Ectopic Notch1IC Expression ……………………………………….35

4.2.1 Notch1IC Inhibits Ductal Growth when Activated in Body Cells………………………..35 4.2.2 Notch1IC Expression Causes the Formation of Alveolar-Like Structures within

Ducts……………………………………………………………………………………..46 4.2.3 Notch1IC Cell Autonomously Promotes Specification of Hormone Receptor

Negative Cells……………………………………………………………………………58 4.3 Effects of Ectopic Notch1IC Expression during Pregnancy…………………………………65

4.3.1 Notch1IC Expression Promotes Formation of Pregnancy-Dependent Lactating Adenomas………………………………………………………………………………..65

4.3.2 Notch1IC-Induced Adenomas Contain Highly Proliferative Luminal Secretory Cells with Two Distinct Morphologies………………………………………………….69

4.3.3 Notch1IC-Induced Adenomas Exhibit Irregular Subcellular Structures and Morphologies…………………………………………………………………………….81

4.4 Other Effects of Ectopic Notch1IC Expression……………………………………………...88 4.4.1 Notch1IC Induces Facial Tumours and Lymphoma…...................………………………88

5. Discussion……………………………………………………………………………………………...93 5.1 Pubertal Effect of Ectopic Notch1IC Expression…………………………………………….93 5.2 Effects of Ectopic Notch1IC Expression during Pregnancy………………………………….95

6. References……………………………………………………………………………………………...99

v

List of Figures Figure 1……………………………………………………………………………………………………4 Figure 2……………………………………………………………………………………………………6 Figure 3……………………………………………………………………………………………………9 Figure 4……………………………………………………………………………………………………28 Figure 5……………………………………………………………………………………………………32 Figure 6……………………………………………………………………………………………………37 Figure 7……………………………………………………………………………………………………39 Figure 8……………………………………………………………………………………………………41 Figure 9……………………………………………………………………………………………………43 Figure 10…………………………………………………………………………………………………..45 Figure 11…………………………………………………………………………………………………..49 Figure 12…………………………………………………………………………………………………..51 Figure 13…………………………………………………………………………………………………..53 Figure 14…………………………………………………………………………………………………..55 Figure 15…………………………………………………………………………………………………..57 Figure 16…………………………………………………………………………………………………..60 Figure 17…………………………………………………………………………………………………..62 Figure 18…………………………………………………………………………………………………..64 Figure 19………………………………………………………………………………………………67, 68 Figure 20…………………………………………………………………………………………………..72 Figure 21…………………………………………………………………………………………………..74 Figure 22…………………………………………………………………………………………………..76 Figure 23…………………………………………………………………………………………………..78 Figure 24…………………………………………………………………………………………………..80 Figure 25…………………………………………………………………………………………………..83 Figure 26…………………………………………………………………………………………………..85 Figure 27…………………………………………………………………………………………………..87 Figure 28…………………………………………………………………………………………………..90 Figure 29…………………………………………………………………………………………………..92

List of Tables Table 1……………………………………………………………………………………………………..24 Table 2……………………………………………………………………………………………………..34

vi

List of Abbreviations ADAM17 ADAM metallopeptidase domain 17 CD24 Heat stable antigen CD29 Beta1 integrin CD49f Alpha6 integrin CD61 Beta3 integrin C/EBPβ CCAAT/enhancer binding protein beta DAB 3,3'-Diaminobenzidine Dpc Days post coitum eGFP Enhanced green fluorescent protein EGFR Epidermal growth factor receptor Elf5 E74-like factor 5 ER Estrogen receptor FBS Fetal bovine serum FSC Forward scatter Gata3 GATA binding protein 3 H&E Hematoxylin and eosin HER2 Human Epidermal growth factor Receptor 2 Hes Hairy and enhancer of split Hey Hairy/enhancer-of-split related with YRPW motif Id2 Inhibitor of DNA binding 2 IGF2 Insulin-like growth factor 2 IHC Immunohistochemistry Int3 Insertional site 3 Ires Internal ribosome entry site Jak2 Janus kinase 2 K8 Cytokeratin 8 K14 Cytokeratin 14 MMTV Mouse mammary tumour virus MMTV LTR Mouse mammary tumour virus long terminal repeat Notch1IC Intracellular Notch1 domain PBS Phosphate Buffered Saline PCNA Proliferating Cell Nuclear Antigen PI Propidium iodide PR Progesterone receptor Prlr Prolactin receptor RANKL Receptor Activator for Nuclear Factor κ B Ligand RBPJκ Recombination signal binding protein for immunoglobulin kappa J region shRNA Small hairpin Ribonucleic acid SSC Side scatter Stat5 Signal transducer and activator of transcription 5 TEB Terminal end bud TEM Transmission electron microscopy WAP Whey Acidic Protein

1

1. Introduction

1.1 Mammary Gland Development

The murine mammary gland is a powerful system for the study of normal development and

transformation. Uniquely, mammary glands develop almost entirely post-natally, making

analysis of their growth and development from start to finish relatively easy to perform.

Furthermore, recent advances have made possible the identification and isolation of mammary

stem cells, which can be transplanted into an epithelial cell divested mammary fat pad to

generate a complete and functional mammary gland in recipient mice1,2. Indeed, the mammary

system has been used to model stem cells in human breast cancer, a disease that according to the

World Health Organization accounts for 10.4% of all cancer incidences and is the fifth most

common cause of cancer death.

1.1.1 Puberty

Development of the mammary gland occurs largely under control of the female

reproductive hormones estrogen, progesterone, and prolactin3. At birth, the mouse mammary

gland consists of a nipple and a small arborized gland in the underlying mammary fat pad.

Following birth, the gland grows isometrically with the rest of the body until puberty when a

rapid influx of hormones induces substantial growth and differentiation. Terminal end buds

(TEBs) are highly proliferative structures, enriched in mammary stem/progenitor cells, which

invade the mammary fat pad and drive ductal development4. Terminal end buds consist of a

single outer layer of undifferentiated cap cells and multiple layers of inner body cells. As the

duct grows, trailing edges of the cap cell layer differentiate into myoepithelial cells5. Body cells

closest to the cap cell layer tend to be highly proliferative, supporting forward growth of the

2

duct. These cells give rise to both hormone receptor positive and hormone receptor negative

luminal cells. Body cells furthest from the cap cell layer undergo apoptosis to create a lumen in

the developing duct (Figure 1)6. Hormone receptor positive cells are cuboidal and express the

estrogen receptor (ER), the progesterone receptor (PR), and the prolactin receptor (Prlr)7. In

contrast, hormone receptor negative cells are morphologically columnar and express both Elf5,

an Ets transcription factor required for lobuloalveolar development and milk production, and

CCAAT/enhancer binding protein beta (C/EBPβ), required for ductal morphogenesis and

alveolar differentiation8,9. As TEBs invade the fat pad they bifurcate to form a branched ductal

tree-like structure. The TEBs persist and continue to move forward until the ducts have reached

the outer limits of the fat pad, at which point they regress. Distinct from TEB bifurcation, lateral

or side branching grow from sites along the developed ductal structure. These side branches are

dependent on recurrent estrous cycles and/or pregnancy and are thought to consist largely of

alveolar precursors9. During the estrous cycle, these side branches develop small alveolar buds,

which will either develop into milk producing structures if the animal becomes pregnant or will

apoptose in a non-pregnant animal (Figure 2)10.

In the past few years, thanks to advances in transplantation methodologies and flow

cytometric analyses, various mammary cell types have been identified and isolated. For

examples, flow cytometric analysis was used to identify three populations on the basis of CD24

expression: CD24Negative, CD24Low, and CD24High, which were confirmed by quantitative PCR to

be non-epithelial, myoepithelial, and luminal cells, respectively11. Interestingly, it was found

that transplantations in cleared mammary fat pads resulted in extensive mammary gland

repopulation in myoepithelial CD24Low cells, whilst luminal CD24High cells were unable to

recapitulate the mammary gland in the divested mammary fat pad11. Indeed, it has been

3

Figure 1. Cellular architecture of terminal end buds and mature ducts during puberty.

An illustrated depiction of cap cells (orange) and body cells (blue) within terminal end buds of

the growing duct. The mature duct consists of myoepithelial cells (red) that differentiated from

cap cells as well as hormone receptor positive (green) and hormone receptor negative (black)

luminal cells that differentiated from body cells.

4

5

Figure 2. Pubertal development of mammary gland in mouse.

(a) At birth the gland occupies only a small portion of the mammary fat pad and consists of a

nipple with a single teat canal that branch into a limited number of ducts. (b) Ducts elongate at

puberty, as directed by terminal end buds, which grow and bifurcate to form a branched

structure. (c) By the end of puberty, ductal growth ceases at the edge of the fat pad, leaving a

tree of branching ducts extending from the teat canal, as shown in the upper portion. The

hormones released during the estrous cycle promote further side branching, which if fertilization

occurs will grow and form milk secreting alveoli connected to the ductal tree. Figure modified

from Muller and Neville (2001)10.

6

7

established that an entire functional mammary gland can be formed from single

CD24LowCD29High cells or related CD24LowCD49fHigh cells1,2. Luminal progenitor cells have also

been identified as CD61+ and ER-12, 13. Despite evidence that alveolar and ductal progenitor cells

are distinct cell types no marker analysis to date has been able to distinguish each of these

individual populations14, 15. Not surprisingly, ductal and alveolar progenitors appear to be

regulated by different transcription factors; Gata3 is found to promote differentiation of CD61+

luminal progenitors into mature CD61- ER+ ductal cells, while Elf5 appears to promote

differentiation of CD61+ luminal progenitors into CD61- alveolar cells, which eventually

differentiate into mature secretory cells12, 8. Consistent with this, Gata3 expression is higher in

CD61- cells in virgin mice and lower during pregnancy, whilst Elf5 is lower in CD61- cells in

virgin glands but increases during pregnancy8. A summary of the current understanding of the

various cell types within the mammary gland and the corresponding transcription factors

required for the proper differentiation and maintenance of those cell types can be seen in Figure

3.

1.1.1.1 Estrogen and Ductal Outgrowth

Estrogen is an ovarian steroid that triggers mammary gland growth during puberty17.

Estrogen’s role in pubescent mammary development is mediated by binding to estrogen receptor

α (ERα), as shown by the fact that estrogen receptor α knockout mice are unable to undergo

pubertal mammary growth while estrogen receptor β knockout mice are unaffected and undergo

normal pubertal mammary development. Consistent with this, double knockouts phenocopy

estrogen receptor α knockout mice18. More recently it has been found that epithelial ERα is

essential for ductal outgrowth while stromal ERα is dispensable19. Interestingly, proliferating

body cells and luminal cells are those that do not express steroid hormone receptors, but are

8

Figure 3. An illustration of mammary cell types and transcription factors required for

their differentiation.

Mammary stem cell can be enriched by sorting for CD24LowCD29High or CD24LowCD49fHigh

cells. These differentiate into myoepithelial and luminal progenitor cells. Through an unknown

process, CD61+ luminal progenitor cell differentiate into alveolar or ductal progenitor cells.

Ductal progenitor cells will, with the help of Gata3, eventually give rise to ER- and ER+ mature

ductal cells. Alveolar progenitor cells eventually differentiate into mature secretory alveolar

cells under direction of Stat5, C/EBPβ, and Elf5, although the role of each in differentiation is

distinct. Figure modified from Lamarca (2008)16.

9

10

generally adjacent to hormone receptor positive cells. It has been proposed that ERα positive

cells are essential for sensing the hormonal milieu and creating an appropriate environmental

niche for mammary development to occur20, 21, 22. Currently it is believed that, during puberty,

the estrogen receptor mediates the production of epidermal growth factor receptor (EGFR) ligand

amphiregulin which is the major EGFR ligand present during puberty23. Amphiregulin is

expressed as an inactive precursor molecule and is activated by metalloproteinase, ADAM17,

mediated cleavage24, 25. Competition for ADAM17 is a potential mechanism for why activation

of the estrogen pathway blocks intracellular cleavage of Notch, in vitro, which also requires

ADAM1726, 27. This crosstalk between estrogen signaling and Notch signaling helps explain the

fact that Notch signaling is only active in ER- cells and why gamma secretase inhibitors, which

block Notch activation, are ineffective at treating ER+ cancer cells but effective at treating ER-

cancer cells, in vitro26.

1.1.1.2 Progesterone and Ductal Branching

Transplantations of progesterone receptor mutant mammary epithelium have

demonstrated that epithelial progesterone receptor is required for proper side branching during

puberty and normal lobuloalveolar development during pregnancy28, 29. Progesterone receptor

null mammary epithelium transplanted next to wild type epithelium develops normally,

demonstrating that progesterone signaling, like estrogen signaling, acts in a paracrine manner28.

Wnt proteins likely mediate progesterone’s paracrine action on mammary epithelial cells that do

not express ER or PR. Brisken et al. (2000) demonstrated that ectopic Wnt1 expression was able

to rescue progesterone receptor knockout mice despite not being normally expressed in the

mammary gland. These authors went on to show that Wnt4, which is normally expressed during

early to mid pregnancy acted downstream of progesterone30. It has been proposed that other

11

Wnts present during puberty (Wnt2, Wnt5a, and Wnt6) mediate the induction of side branching

by progesterone, although this has yet to be confirmed in vivo23.

1.1.2 Pregnancy

The functional differentiation and development of the mammary gland during pregnancy

and lactation can be divided into 4 phases: the proliferative phase of early pregnancy, secretory

differentiation, secretory activation, and lactation31. The proliferative phase is characterized by

the extensive proliferation of alveolar mammary epithelial cells beginning at conception.

Despite the massive proliferation that occurs, organization of the mammary gland is maintained,

albeit with substantial side branching31. It has been proposed that RANKL, Wnt4, and

amphiregulin regulate this phase31. The secretory differentiation phase is characterized by the

generation of alveolar buds and an increase in the activity of lipid synthetic enzymes although

the production of milk appears to be blocked by high levels of progesterone32. The secretory

activation phase is set in motion by the drop in the level of serum progesterone around birth33.

This results in the closure of tight junctions, that prior to this stage are leaky, and allows for

maximal activation of prolactin receptor signaling through Stat5, leading to a substantial increase

in the transcription of milk protein genes33, 34. The lactation phase is defined by the continuous

production of large volumes of milk to nourish the newly born offspring.

1.1.2.1 Wnt/Progesterone and Alveolar Specification and Growth

Progesterone receptor knockout mice lack side branches and alveoli indicating that

placentally produced progesterone is required for correct alveolar morphogenesis during

pregnancy35, 28. Importantly, it has been found that Wnt4 and RANKL are downstream of

progesterone and stimulate the proliferation and side branching of progesterone receptor negative

cells during early pregnancy30. In addition RANKL is thought to stimulate cell proliferation and

12

alveolar differentiation through a mechanism involving nuclear translocation of Id236, 37. Despite

the requirement for progesterone signaling in proper development and differentiation of alveoli it

is the loss of placental progesterone signaling at birth that allows for alveolar/secretory cells to

perform their primary function, milk production38.

1.1.2.2 Prolactin and Lactogenic Differentiation

During pregnancy, prolactin affects alveolar development both indirectly, by sustaining

ovarian progesterone secretion, and directly by binding to prolactin receptors (Prlr) within the

mammary epithelium39. Importantly, transplantation experiments of prolactin receptor

knockouts resulted in normal ductal morphogenesis and side branching during early pregnancy

and failed to undergo both the proliferation and differentiation phases of alveolar development39.

Prolactin binding and activation of the prolactin receptor results in phosphorylation of Jak2,

which in turn phosphorylates the prolactin receptor, ultimately resulting in recruitment and

phosphorylation of Stat5 by Jak2, and translocation of Stat5 to the nucleus where it activates

transcription of target genes, including milk protein genes like β-casein and whey acidic protein

(WAP)40. Transcription profiling experiments indicate that prolactin also, at least indirectly,

stimulates transcription of Wnt-4, RANKL, Elf5, and Cyclin D141, 42, 43, 44. Interestingly, Cyclin-

D1 null mammary epithelial cells fail to proliferate in response to prolactin and prolactin induced

Cyclin-D1 expression is mediated by IGF-242.

Elf5 has been hypothesized to be a direct target of Stat5 because its expression can be

induced via prolactin treatment and is diminished in prolactin knockout experiments; however

this has yet to be experimentally proven45, 43, 46. Regardless, mice lacking just one Elf5 allele

display defective alveolar morphogenesis that phenocopies Prlr+/- mice47. In fact, retro-viral re-

expression of Elf5 in isolated Prlr-/- mammary epithelial cells rescued failed alveolar

13

morphogenesis43. This experiment and others prompted Elf5 to be termed the master regulator

of alveolar differentiation48. Elf5 promotes alveolar differentiation and development. Indeed, its

ectopic activation is sufficient to produce aveoli in ducts and TEBs of pubertal glands15. Flow

cytometric analysis of Elf5 null epithelial cells revealed a significant increase in CD61+ cells,

while ectopic activation of Elf5 resulted in a decrease of CD61+ cells indicating that Elf5

promotes differentiation of luminal progenitor cells to alveolar cells8.

1.2 Notch Signaling Pathway

Notch transmembrane receptors play diverse roles during development, including acting as

key regulators of stem cell maintenance and differentiation49. In vivo evidence demonstrates that

Notch acts to regulate differentiation in neural and hematopoietic stem cells by promoting

differentiation of astrocytes and T-cells, respectively, and does so in a dose-dependent manner50,

51, 52, 53, 54.

Notch signaling is activated upon binding of its extracellular domain to either Jagged or

Delta ligands. In response to ligand binding, a conformation change occurs resulting in cleavage

of the Notch extracellular domain by ADAM metalloproteases: ADAM17 and/or Kuzbanian.

Following this, the extracellular domain is internalized, along with the ligand, by the ligand-

expressing cell. The remaining Notch polypeptide is cleaved by the γ-secretase protease

complex, thus releasing a Notch intracellular domain fragment (NotchIC) from its membrane

tether. NotchIC then translocates to the nucleus where its RAM23 sequences bind to a

transcriptional repressor complex through direct contact with the RBPJκ DNA-binding protein.

The binding of RBPJκ and NotchIC disrupts the transcriptional repressor complex and recruits

activating proteins, ultimately turning on transcription of genes previously repressed prior to

Notch activation55. Hes and Hey have long been known to be NotchIC/RBPJκ targets, but more

14

recently it has been found that Cyclin D1, c-myc, and Gata3 are directly regulated by Notch in

several tissues, including the mammary gland56, 57, 58.

1.2.1 Notch and Breast Cancer

Like the misregulation of other developmental pathways, inappropriate activation of

Notch signaling has been associated with cancer, including cervical and lung cancer,

neuroblastoma, and T-cell acute lymphoblastic leukemia, where Notch1 truncating activating

mutations have been identified in over 50% of tumors59, 60, 61. A number of years ago Robert

Callahan’s lab identified a common insertional site (Int3) of the Mouse Mammary Tumour Virus

(MMTV) in mammary tumours from MMTV-infected mice62. They later identified this

insertional site as the Notch4 locus and showed that MMTV insertion created a constitutively

activated C-terminal fragment of Notch4. Callahan went on to characterize the mammary and

salivary gland tumours that resulted in Int3 expressing mammary glands and showed that ectopic

Notch4 activation retarded pubertal development and blocked secretory and alveolar

development63, 64, 65, 66, 67. Ongoing work on Notch4 (Int3) led other groups to study the role of

the other Notch receptors in mammary tumorigenesis both in humans and mouse models.

Following this, another group used the Mouse Mammary Tumour Virus to identify

genetic events necessary to transform mammary glands in mice with overexpressed HER2.

These mice develop tumours after long latency periods, suggesting that HER2 activation is not

sufficient for transformation. By using the MMTV provirus insertional mutagenesis approach

they found that Notch1 was targeted and truncated through MMTV provirus insertion in 8% of

tumours. They went on to show that intracellular Notch1 can transform HC11 mouse mammary

epithelial cells in vitro and identified via deletion analysis that OPA and PEST sequences were

dispensable for transformation68. The importance of defining precise roles for Notch signaling in

15

transformation of mammary epithelium was highlighted recently when it was found that patients

with mammary tumours expressing high levels of the Notch ligand, Jagged1, or Notch1 had

significantly poorer overall survival compared with patients with tumours expressing low levels

of these genes69. Moreover, a synergistic effect of high-level Jagged1 and high-level Notch1 co-

expression on overall survival was observed69. It has also been reported that attenuation of

Notch signaling reverts the transformed phenotype of human breast cancer cell lines70. Notch is

considered a potential therapeutic target in breast cancer. Indeed, a novel strategy has recently

been developed to minimize previously debilitating side effects of gamma-secretase inhibitors, in

vivo71.

1.2.2 Notch and Breast Cancer Models

The Artavanis-Tsakonas lab has developed a transgenic mouse model by cloning a

constitutively active truncated human Notch1 cDNA, downstream of MMTV regulatory

elements. Transgenic mice expressing this construct developed lactation-dependent papillary

tumours in multiple mammary glands, which regressed during involution. After several

pregnancies, these lesions progressed into non-regressing pregnancy-independent adenomas.

Analysis of these tumours has been somewhat limited to date. Their analysis concluded the

tumours expressed high levels of Hes1, were negative for myoepithelial progenitor marker p63,

and that Cyclin D1 is an in vivo Notch1 target. The group later followed up this work by

identifying c-myc as another target of Notch1 in this context and a requisite for Notch1-induced

mammary tumorigenesis56, 57.

Interestingly, an attempt by Jolicoeur’s group to replicate these results using the

intracellular domain of mouse- Notch1 revealed a slightly different phenotype. They observed

no effect during puberty; however, substantially reduced lobuloalveolar development, as evident

16

by smaller and reduced numbers of alveolar complexes, was observed during the onset of

pregnancy. They describe lobules as undifferentiated due to the reduced area of lipid droplets

within cells and reduced expression of β-casein, as measured by immunohistochemistry (IHC).

Their analysis included the observation that despite the presence of two RBPJκ binding sites in

the β-casein promoter, Notch1IC was able to repress a β-casein luciferase assay. Also in contrast

to Artavanis-Tsakonas’ group, they found that involution proceeded at a slower rate than wild

type controls, that there was no up regulation of Hes1 and that development of tumours was

pregnancy-independent72.

It remains a distinct possibility that differential phenotypes observed in these two ectopic

Notch1 mouse models are due to differential effects of human and mouse Notch1. Another

possible explanation is simply that the MMTV provirus promoter, presumably inserted in

different loci, drives Notch1IC expression at different levels, in different cell types, and/or at

different stages of mammary gland development. The fact that Notch signaling regulates cell

differentiation, proliferation, and stem cell maintenance in a stage-, cell type-, and dose-

dependent manner and the lack of any tag or immunostaining for Notch1IC by either group makes

these differences difficult to reconcile. Their work, while supporting Notch1’s role as a

mammary oncogene, do not address the role of Notch1, if any, in regulating mammary epithelial

stem cell/progenitor cell function. Future work needs to direct Notch1 activation in specific cell

types, at a consistent level of expression, and utilize many of the recently developed techniques

and mammary cell markers.

1.2.3 Notch and Mammary Gland Development

Recently, progress has been made toward defining roles for Notch signaling in mammary

gland development. Lothar Hennighausen’s group used a Cre-conditional RPBJκ knockout, to

17

eliminate all Notch signaling in the mammary gland, resulting in a dramatic phenotype. They

observed that, despite normal development during puberty, there was rapid proliferation of

myoepithelial cells at the expense of luminal cells during pregnancy. Furthermore, luminal

oriented cells expressed myoepithelial cell markers in addition to luminal cell markers,

ultimately resulting in alveolar complexes consisting entirely of myoepithelial cells and a small

number of estrogen receptor positive luminal cells73. Their work suggests that Notch is required

for luminal, specifically hormone receptor negative, cell differentiation and maintenance and to

suppress myoepithelial proliferation.

The lack of pubertal phenotype in this report is perhaps best explained by their

experimental approach. Due to perinatal death of RBPJκf/f:MMTV-Cre mice they performed

mammary transplantations, resulting in ductal structures forming from mammary stem cells.

Given a putative role of Notch in differentiation or regulation of mammary stem cells, as has

been suggested, the mammary ducts may have developed from stem cells negative for Cre

expression. Ultimately this results in knocking out RBPJκ primarily during pregnancy when the

MMTV promoter is known to be most active. In contrast, Welm et al. showed that lentiviral

infection of a dominant-negative Xenopus RBPJκ construct into transplanted primary mammary

epithelial cells produced hyperbranching and TEBs that were nearly four times larger than

controls74. It is difficult to interpret such results since there was no analysis regarding which

cells showed decreased Notch signaling and to what extent but this paper did suggest a role for

Notch signaling during puberty. Further analysis needs to be performed to understand the role of

Notch during pubertal development.

Further evidence that Notch regulates stem cell maintenance and differentiation come

from Bouras et al. who used shRNA to knockdown RBPJκ in a mammary stem cell enriched

18

population (CD29HI CD24Low) and found an increased repopulating frequency and a 2-fold

increase in stem cell activity58. Consistent with the idea that Notch signaling promotes and

maintains luminal differentiation they also observed an increase in the number of basal cells

expressing p63 and K14 and observed a clear basal cell expansion into the luminal cell layer.

They went further to retrovirally express activated Notch1 in mammary stem cells and found that

no ductal structures developed from transplantations into a cleared mammary fat pad. The

transplantations developed into hyperplastic luminal nodules that were completely blocked from

branching or undergoing differentiation during pregnancy. Not surprisingly, they found that

Notch1 is not expressed in myoepithelial cells but rather its expression was restricted to cells of

luminal origin with slightly higher expression in CD61+ cells. Since, by their own analysis

Notch1 is not expressed in myoepithelial cells or mammary stem cells the more significant

experiment was the transplantation of infected CD61+ luminal progenitor cells into the mammary

fat pad, which also developed into hyperplastic luminal nodules. They describe infected CD61+

cells as incapable of undergoing alveolar differentiation, however, since transplanted wild type

CD61+ cells do not form outgrowths it cannot be determined if this is due to Notch activation or

lack of a normal environmental niche required for proper development. Their work further

confirms that Notch can promote luminal differentiation and is required to block myoepithelial

differentiation and proliferation, however their experimental model lacks the appropriate

environmental niche to properly assess the role of Notch1 in mammary gland development.

Clearly an in vivo analysis needs to be performed to properly identify the role of Notch in

differentiation of luminal and CD61+ cells. It also remains to be determined what role Notch

signaling plays in more differentiated mammary cells.

19

2. Objective

The objective of my work is to probe the role of Notch1 in mammary gland development,

differentiation, and the transformation of mammary epithelium.

20

3. Materials and Methods

3.1 Breeding/Strains

The Rosa26loxP-stop-loxP-Notch1ICδC-ires-eGFP (now referred to as Notch1IC) activated

Notch1 strain, used for my studies, was generously provided by Dr. Douglas Melton, Harvard

University75. It was generated by targeting a DNA fragment encoding an intracellular fragment

of Notch1 (amino acids 1749-2293) followed by an internal ribosome entry sequence and

nuclear-localized enhanced GFP (eGFP) into a previously described Rosa26 targeting vector78.

Importantly, this line contains a transcriptional termination sequence flanked by loxp sites

upstream of the Notch1 construct, rendering it untranscribed unless recombined by Cre

recombinase.

This line was crossed with a number of Cre recombinase expressing strains to activate

Notch1 in the mammary gland in different temporal and spatial patterns, including MMTV-Cre

Line A77, MMTV-Cre TL78, and K14-Cre79.

3.2 Genotyping

Polymerase chain reaction was performed, using Qiagen kit (Cat# 201205), to identify

the genotypes of pups born. To identify pups containing the targeted Notch1IC locus,

denaturation was performed at 95° for 15 minutes, with 35 amplification cycles of 94°, 59°, and

72° for 1 min each, and the final elongation step was performed at 72° for 10 minutes.

Polymerase chain reaction was performed using the primers (R1 >

AAAGTCGCTCTGAGTTGTTAT, R2 > GCGAAGAGTTTGTCCTCAACC, R3 >

GGAGCGGGAGAAATGGATATG). This yielded an approximately 500 base pair product for

the wild type Rosa26 allele and approximately a 250 base pair product for the targeted locus.

21

Cre genotyping was performed with primers C1 > TCGCGATTATCTTCTATATCTTCAG and

C2 > GCTCGACCAGTTTAGTTACCC with a denaturation step of 5 minutes at 94°, 35 cycles

of 94° (30 seconds), 58° (45 seconds), and 72° (30 seconds), before a final elongation step of 72

for 30 seconds. This ultimately yielded an approximate 250 base pair product for Cre.

3.3 Wholemount

Mammary glands were harvested, spread on glass slides and immediately submerged in

acetone overnight. Following acetone treatment the glands were submerged in hematoxylin

overnight and afterwards in acid alcohol overnight, which consists of 595ml of ethanol, 355ml of

H2O, and 9.5ml of 37% HCl. The glands were then placed in ammonia water (3ml ammonium

hydroxide in 1L H2O) for 1 minute, 95% ethanol for 1 hour, 100% ethanol for 1hour, and then

toluene for 1 hour before being mounted with a coverslip using permount.

3.4 Histology: Immunohistochemistry and Immunofluorescence

Tissues were fixed in 10% neutral buffered formalin overnight at room temperature, after

which they were paraffin-embedded. For histology, sections were stained with hematoxylin and

eosin (H&E). For immunohistochemistry, paraffin sections (5µm) were cleared in two 5-minute

xylene submersions followed by rehydration through an alcohol series consisting of 2 minutes in

each 100% of ethanol (two times), 95% ethanol (two times), a 75% ethanol, and finally a 50%

ethanol bath before being carefully rinsed with running tap water. A Digital Decloaking

Chamber (Biocare Medical; Walnut Creek, CA) was utilized for antigen retrieval. Sections were

immersed in a heat-induced epitope-retrieval solution, pH 6.0 (Reveal Decloaker RTU, Biocare

Medical, Lot# 111008). Set-Point 1 was 125° for 5 minutes and Set-Point 2 was set to 90° for 10

seconds. After carefully rinsing the slides in running tap water, sections were placed in the Tecan

Freedom Evo® robotic pipetter, where they underwent hydrogen peroxide

22

treatment, followed by blocking, primary antibody incubation, secondary antibody incubation,

and treatment with avidin DH solution and biotinylated enzyme each for 30 minutes and as

prescribed in the Vectastain® ABC kit (Vectorlabs, Rabbit Cat#PK6101, Goat Cat# PK6105,

Mouse Cat# PK4002, and Rat Cat# PK4004). Primary antibodies were diluted as described in

Table 1. Staining with 3,3'-Diaminobenzidine (DAB) was performed under a microscope for 10

minutes, in accordance with the Vector Laboratories DAB staining kit protocol (Cat # SK-4100).

Occasionally the staining procedure was stopped prior to this when non-specific staining was

observed. Following DAB staining, sections were carefully rinsed under running tap water.

Counterstaining of sections was performed in hematoxylin for 10 seconds followed by

dehydration through an alcohol series consisting of 10 seconds in each of two 95% ethanol and

two 100% ethanol baths. Sections were submerged in three xylene baths for 10 seconds each

followed by mounting the sections with a drop of permount and a cover slide, before images

were taken.

Sections used for immunofluorescence received the same treatment up to, and including,

antigen retrieval at which point they were washed with PBS three times, exposed to the DAKO

Protein Block (Cat# x0909) blocking solution for 45 minutes, washed another three times with

PBS, and incubated with the primary antibodies diluted in blocking solution overnight at 4°.

After another three washes with PBS the secondary antibody was added and incubated for 30

minutes before being washed another three times with PBS. Finally, cover slips were mounted

and images taken.

3.5 Flow Cytometry

Mammary glands were extracted and placed in 5 ml of EpiCult®-B medium (made by

adding 50ml of EpiCult®-B proliferation supplements (StemCell Technologies Cat# 05611) to

23

Table 1. Antibodies and conditions used for immunohistochemistry and

immunofluorescence.

24

Antigen Antibody

Species

Provider Product No. Dilution

ERα Rabbit Santa Cruz Sc542 1:300

Keratin 14 Rabbit Panomics E2624 1:200

Keratin 8 Mouse Fitzgerald 10R-C177ax 1:10

PCNA Mouse Santa Cruz Sc56 1:200

p63 Mouse Santa Cruz Sc8431 1:100

Gata3 Rabbit Proteintech 10417-1-AP 1:100

Stat5a Rabbit Santa Cruz Sc1081 1:100

pStat5a Rabbit Cell Siganling 9359 1:200

Elf5 Mouse Santa Cruz Sc9645 1:100

Progesterone Rabbit Santa Cruz Sc538 1:200

Cleaved

Caspase3

Rabbit Cell Siganling 96615 1:400

GFP Goat Abcam Ab6673 1:250

C/EPBβ Mouse Santa Cruz Sc7962 1:50

Jagged 1 Goat Santa Cruz Sc6011 1:100

CD34 Rat Abcam Ab8158 1:50

E-Cadherin Goat Santa Cruz Sc1500 1:100

P-Cadherin Goat Santa Cruz Sc1501 1:100

CD61 Mouse Caltag MCD6104 1:20

25

450ml EpiCult®-B Basal medium (StemCell Technologies Cat# 05611) with 5% FBS on ice).

The glands were then minced using a sterile razor blade and placed in 1ml collagenase with 9ml

of Epicult®-B medium with 5% FBS incubated in a 37° water bath. Mammary pieces were

incubated for 5 hours with mixing by pipetting up and down 20 times every hour. After

digestion, cells were centrifuged at 350g for 3 minutes and resuspended in 5ml of 1:4 cold HF

(2% FBS in Hank’s balanced salt solution) and NH4Cl (StemCell Technologies Cat# 07800) to

lyse red blood cells. Cells were then vortexed and incubated on ice for 10 minutes, and then

centrifuged for 3 minutes before the supernatant was removed. Next, cells were mixed gently by

pipetting up and down for 3 minutes in 3ml of pre-warmed trypsin-EDTA before adding 10ml of

HF, centrifuging for 3 minutes, and removing the supernatant. 2ml of pre-warmed dispase

(5mg/ml) and 200µl DNase1 (1µg/ml) were added and then mixed by pipetting for 1-2 minutes.

Another 10ml of HF was added before filtering cell suspension through a 40µm cell strainer into

a new tube. The new cell suspension was centrifuged for 3min and the supernatant discarded

before being resuspended in 200µl HF. Following this, 20µl of cell enrichment cocktail

(StemCell Technologies Cat# 19757) was added and mixed well before incubating on ice for 15

min. Following incubation, 40µl of biotin selection cocktail was added, mixed well, and

incubated on ice for 15 minutes before adding 20µl of magnetic nanoparticles and incubating on

ice for 15 minutes. Another 2ml of HF was added with 1% DNase1 and the tube placed inside

the magnet (Stemcell Technologies Cat# 18000) for 5 minutes. In one continuous motion, the

magnet was inverted and the desired fraction poured into a new 12X75mm polystyrene tube.

The magnet was left inverted for 3 seconds but no attempt to shake off or blot off any hanging

droplets occurred. Another 2ml of HF was added to the original tube and placed without a cap

into the magnet for 5 minutes before being inverted and poured into the tube with cells from the

26

original separation. The tube was then centrifuged and the supernatant discarded before being

resuspended in 2.5ml HF and put inside the magnet again without the cap for 5 minutes then

inverted and poured into a new tube. The tube was then centrifuged again and the supernatant

discarded before being resuspended in 500µl HF with 10% DNaseI. The cell suspension was

then split into 5 tubes labeled as unstained, PE-CD24, PECy5-CD49f, PE-CD24 & PECy5-

CD49f, and PE-CD61. Antibodies were then added in accordance to Table1 and incubated on

ice for 10 minutes. The cells were then washed with 3ml of HF plus 100µl of propidium iodide

(PI) (BD Phramingen Cat# 558025), a DNA intercalating agent impermeant to viable cells, and

resuspended in 500µl of HF. Immunofluorescence was measured using flow cytometry with a

Becton Dickinson FACScan analyzer and analyzed using Flowjo (version 8.8.6) software. Cell

populations on Flowjo were first gated according to size and granularity, forward and side scatter

respectively, then PI positive cells gated out, as shown in Figure 4, before the cells were

analyzed with regard to CD61 and eGFP status.

3.6 Transmission Electron Microscopy

Mammary glands were harvested and approximately 1mm piece was submerged in TEM

universal fixative solution (1.0% Gluteraldehyde, 4.0% Formaldehyde in 0.1M phosphate buffer)

and taken to Pathology Laboratory Services at The Hospital for Sick Children where toluidine

slides were made followed by ultrathin sections.

27

Figure 4. Flow Cytometry: Dead cells were gated out before further analyzed.

(A) Cells from a wild type 14.5 dpc mammary gland were analyzed by flow cytometry. The

graph depicts a two parameter 5% probability contour plot of the distribution of forvard versus

side scatter signals, which were used to gate out debris and red blood cells (low FSC & SSC) and

cell aggregates (high FSC & SSC). (B) The graph depicts propidium iodide staining versus FSC

(measure of cell size) on the gated population shown in panel A. The polygone region identifies

PI- (live) cells in the gated population.

28

29

4. Results

4.1 Generation of Transgenic System for Analysis of Notch1 Function in

the Developing Mammary Gland

Notch signaling is required for specification/maintenance of hormone receptor negative

cells in the pregnant mammary gland, and to suppress proliferation of myoepithelial cells73.

Ectopic activation of Notch1 in transplanted stem cells leads to hyperplastic nodules expressing

luminal cell markers58. Consistent with the ability of Notch1 to induce such lesions, expression

of Notch1IC in MMTV-Notch1IC transgenic mice is oncogenic, though discrepancies exist with

regard to the nature of resulting mammary tumours, such as whether these tumours are

dependent on pregnancy for their growth and survival57, 72. Interpretation of these studies is

somewhat complicated by i) studying development of transplanted Notch1IC-expressing

mammary stem or progenitor cells in the absence of contact with differentiated cells that may

form a required niche, ii) differences in expression associated with transgene insertion into

distinct chromosomal loci in each transgenic mouse strain, and also by iii) the fact that human

Notch1IC was expressed in one of the transgenic studies71. In addition, by using the MMTV

LTR, a hormone-responsive promoter, the level of Notch1IC would likely be upregulated during

pregnancy, which would complicate comparisons between transgenic mice in puberty and

pregnancy. Therefore, I have chosen to test for a role of mouse Notch1 in mammary

development and tumor formation using the Cre-conditional ROSA26 transgenic system

(ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP)77. This system was developed in the Melton lab and

has been used to study the effect of mouse Notch1 activation in the intestine80, pancreas75, and

lungs81. With this system, the Notch1IC transgene can be induced using multiple distinct Cre

30

deleter strains and, once turned on, should be expressed at a consistent level from ROSA26

regulatory sequences. In other words, Notch1IC transgene expression levels will be hormone-

independent. Finally, the current strategy also employs expression of eGFP as a surrogate for

Notch1IC expression. This is because Notch1IC and eGFP are linked together on the same

transcript and are separated by an internal ribosomal entry site (IRES). eGFP+ cells will

therefore also express Notch1IC. The specific Notch1IC allele employed in ROSA26loxP-stop-loxP-

Notch1ICδC-ires-eGFP mice has a C-terminal truncation to delete PEST sequences and thereby

expresses an unusually stable Notch1IC protein (Figure 5).

To express activated Notch1 in the mammary gland we crossed ROSA26loxP-stop-loxP-

Notch1ICδC-ires-eGFP mice to three Cre expressing lines: MMTV-Cre line A77, MMTV-Cre

TL78, and K14-Cre79 to ensure activation in mammary stem cells1. As can be seen in Table 2,

ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP;MMTV-Cre Line A mice mostly died as embryos,

likely due to Cre expression in the lungs and nervous systems, as previously documented82. Two

females, however, did survive embryogenesis and their mammary glands were analyzed at

puberty. ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP;MMTV-Cre TL mice did not exhibit the

same embryonic lethal phenotype, likely due to more mammary restricted expression of Cre.

Attempts to generate ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP;K14-Cre mice were

unsuccessful, once again due to embryonic lethality. Consequently, MMTV-Cre TL was the

primary Cre line used for my studies. However, as mentioned, MMTV-Cre Line A was used in

addition to MMTV-Cre TL to study pubertal effects. From this point forward ROSA26loxP-stop-

loxP-Notch1ICδC-ires-eGFP+/-; MMTV-Cre Line A+/- and ROSA26loxP-stop-loxP-Notch1ICδC-ires-

eGFP+/-;MMTV-Cre TL+/- mice will be referred to as Line A transgenics and TL transgenics,

respectively.

31

Figure 5. The ROSA26loxP-stop-loxP-Notch1IC∆C-ires-eGFP allele.

Figure modified from Srinivas et al (2001)76. Black arrows represent loxp sites, ‘SA’ denotes

the splice acceptor, ‘PGK-neo’ the neomycin cassette, and ‘bpa’ the polyadenylation sequence.

32

33

Table 2. Breeding success of Notch1IC mice with various Cre-expressing strains.

This table depicts the success of breeding heterozygous MMTV-Cre Line A, MMTV-Cre TL,

and K14 mice with heterozygous Notch1IC mice. The table indicates the total number of female

pups born, the total number of transgenic females that are heterozygous for both the Notch1IC

and Cre allele, and the percent of transgenic females. Mendelian frequencies of unlinked alleles

would predict that 25% of females born would be transgenic, and as such, it is clear that both

transgenic MMTV-Cre Line A and transgenic K14-Cre mice can be embryonic lethal.

34

Notch1IC+/-

MMTV-Cre Line A+/-

MMTV-Cre TL+/-

K14-Cre+/-

Total # of female

pups born

194

168 25

# of transgenic

female pups born

2 40 0

% of transgenic

female pups

1% 24% 0%

35

4.2 Pubertal Phenotype of Ectopic Notch1IC Expression

4.2.1 Notch1IC Inhibits Ductal Growth when Activated in Body Cells

To study the effects of ectopic Notch1IC signaling on pubertal development, we harvested

mammary glands from Line A and TL transgenics at six weeks of age. Transgenic and control

mammary gland wholemount preparations were compared. Line A transgenic ducts were

dramatically reduced in length and showed less branching (Figure 6). Line A glands also

exhibited altered TEB morphology, as most were substantially smaller than wild type TEBs. In

one of the two Line A transgenic glands studied, however, some TEBs were found to be

noticeably larger than normal (Figure 7). Histological analysis of sections revealed the presence

of structural abnormalities within the Line A transgenic TEBs (Figure 8). Interestingly, the

stunted ductal growth phenotype and gross TEB morphology was exclusive to Line A transgenic

mice, however, TL transgenic TEBs did occasionally exhibit less severe structural abnormalities

(Figure 9). The primary difference between Line A and TL transgenics, in terms of eGFP gene

expression (and presumably Notch1IC expression), was that Cre-mediated gene activation was

seen in a much higher percentage of Line A body cells (Figure 10).

36

Figure 6. Notch1IC inhibits pubertal growth.

(A&B) Hematoxylin stained wholemounts of wildtype virgin mammary glands at six weeks of

age. (C&D) Hematoxylin stained wholemounts of six week old virgin mammary glands from

two Line A transgenic littermates showing dramatically reduced ductal length, reduced ductal

branching, and irregular terminal end bud development. Terminal end buds from wildtype

mammary glands (boxes a, b, c) and transgenic mammary glands (boxes d, e, f) are illustrated in

higher magnification in Figure 7. Scale bars for A, B, C, and D are 2.5mm, 3mm, 2mm, and

2mm, respectively (magnification 1.9X).

37

38

Figure 7. Notch1IC induces aberrant terminal end bud growth and development.

(A, B, C) Hematoxylin stained wholemounts of terminal end buds from six week old virgin

wildtype mammary glands, enlarged from A&C in Figure 6. (D, E, F) Hematoxylin stained

wholemounts of terminal end buds from six week old virgin mammary glands from Line A

transgenic littermates showing both TEBs that are dramatically inflated and reduced in size,

enlarged from panels B & D in Figure 6. Scale bars are 0.5mm for all panels except for B, which

has a scale bar of 1.25mm (magnification 12X).

39

40

Figure 8. Notch1IC induces irregular cellular architecture in terminal end buds.

(A) Hematoxylin eosin stain of an enlarged terminal end bud from a six week old virgin Line A

transgenic gland exhibiting a distinct alveolar-like ‘budding’phenotype. (B) Hematoxylin and

eosin stain of a significantly smaller TEB observed in six week old virgin Line A transgenic

glands. Interestingly, it does not appear to be one distinct structure but rather displaying an

alveolar-like ‘budding’ phenotype similar to that observed in A. (C) A terminal end bud from a

wild-type six week old virgin littermate stained for p63, a myoepithelial cell marker, with normal

compact cellular architecture. Scale bar represents 10 µm (magnification 40X).

41

42

Figure 9. Normal overall growth and less severe TEB phenotype observed in TL transgenics.

(A, D) Wholemounts depicting normal growth of six week old virgin wild type mammary gland and a TL

transgenic littermate, respectively. (B, E) A magnified view of TEBs in both a wild type littermate

mammary gland and a TL transgenic gland, respectively, showing normal overall growth and development

of TEBs, enlarged from panels A & D, respectively. (C, F) Sections of terminal end buds, stained for K14,

in both wild type and mutant glands, respectively. Overall cellular architecture of the mutant gland is

intact with the exception of one area demarcated by an arrow, which exhibits the alveolar-like ‘budding’

phenotype previously described. Scale bars for A&D are 1.5mm (magnification 1.9X), B&E are 0.5mm

(magnification 12X), and C&F are 20µm (magnification 20X).

43

44

Figure 10. Notch1IC expression more widespread in Line A transgenic body cells than in TL

transgenics.

(A, C) eGFP staining in six week old virgin Line A and TL transgenic TEBs, respectively. Line A

transgenic TEB clearly exhibits expression of eGFP in a greater proportion of body cells, relative to its TL

transgenic counterpart. (B, D) eGFP staining in six week old virgin mammary glands from wild type

littermates of the Line A and TL transgenic mice, respectively. Scale bars are 10µm (magnification 40X).

45

46

4.2.2 Notch1IC Expression Causes the Formation of Alveolar-Like

Structures within Ducts

Interestingly, the irregular TEB morphology in Line A transgenics was also observed in

mature ductal regions of both Line A and TL transgenic glands, and appeared similar to

developing alveolar buds (Figure 11). To identify the lineage of cells trapped within ducts,

immunofluorescence staining was performed, using antibodies against cytokeratin 8 (K8), a

luminal cell marker, and cytokeratin 14 (K14), a myoepithelial marker. This analysis revealed a

typical pattern of luminal and myoepithelial cell segregation in morphologically normal regions

of transgenic ducts, and an accumulation of extra luminal cells in regions with alveolar-like

morphology. Importantly, there were myoepithelial cells encapsulating some, but not most, of

the irregular luminal cell accumulations (Figure 12). Interestingly, the majority of luminal cells

within alveolar-like accumulations were estrogen receptor negative, in contrast to luminal cells

that were found in more peripheral positions, and in contact with the myoepithelial layer (Figure

13). There was also a noticeable increase in the number of Elf5+ cells in both Line A and TL

transgenic glands, resulting in development of regions with multiple Elf5+ cells lined up side-by-

side (Figure 14). Note that Elf5+/columnar cells are normally intercalated between Elf5 -

/cuboidal cells of the luminal layer (Figure 14). Interestingly, analysis of Elf5 promoter

sequences (approximately 5800 base pairs upstream of the Elf5 transcriptional start site) reveals

the presence of eight core consensus RBPJκ binding sites (TGGGAA/TTCCCA), identical to the

site present in the murine Hes-1 promoter, which is transactivated by NotchIC and RBPJκ83, 84.

Another five putative RBPJκ binding sites (CTGGGAG/CTCCCAG and

GTGGGAG/CTCCCAC)83 were also found, one of which is only 152 base pairs upstream of the

start site (Figure 15). Together, this indicates that Notch1IC may directly induce Elf5

47

transcription. We next tested for expression and phosphorylation of Stat5 in accumulated

luminal cells. Whereas these cells expressed Stat5, tyrosine phosphorylated Stat5 was not

observed (A Kucharczuk data not shown). This result is not surprising, given that prolactin

levels are low in non-pregnant mice. Thus, in the pubescent gland, Notch1IC induced an

accumulation of extra luminal cells trapped within ducts, forming an alveolar-like complex, and

these cells were typically ER-, Elf5+ and Stat5+.

48

Figure 11. Notch1IC ectopic expression promotes alveolar-like morphology during puberty.

(A,B) Hematoxylin and eosin staining of six week old virgin Line A transgenic glands showing

ductal regions with alveolar-like morphology. (C,D) H&E staining of six week old virgin TL

transgenic glands displaying alveolar-like structures within mature ducts. Scale bars represent

10µm (magnification for A&B is 40X and for C&D is 80X).

49

50

Figure 12. Notch1IC induced alveolar-like regions consist of mainly of luminal cells.

(A,B) Immunofluorescent staining for K8 (red) and K14 (cyan) in the ducts of six week old

virgin wild type littermates of Line A and TL transgenic mice, respectively. (C,D) Line A and

TL transgenic ducts, respectively, exhibiting alveolar morphogenesis stained for K8 (red) and

K14 (cyan). Arrows point out myoepithelial cells within alveolar regions. Scale bar represents

10µm (magnification 40X).

51

52

Figure 13. Notch1IC induced alveolar-like regions are predominately estrogen receptor

negative.

(A) Immunohistochemistry staining for estrogen receptor (ER) in the ducts of a six week old

virgin wild type litter mate of TL transgenic mice. (B, C) Staining for ER in the ducts of six

week old virgin TL transgenic ducts showing that the expression of the estrogen receptor is

restricted to the periphery of alveolar-like regions in the pubertal gland. Scale bar is 10µm

(magnification 80X).

53

54

Figure 14. Ectopic Notch1IC expression and Elf5 expression.

(A, B) Immunohistochemistry staining for Elf5 in the ducts of six week old virgin wild type

littermates of Line A and TL transgenic mice, respectively. (C, D) Staining for Elf5 in six week

old virgin Line A and TL transgenic ducts, respectively, displaying an increase in the number of

Elf5 positive cells and the number of morphologically columnar cells. Arrows point to regions

with multiple consecutive columnar cells in the transgenic duct. Scale bar is 10µm for B&D

(magnification 80X) and 20µm for A&C (magnification 40X).

55

56

Figure 15. Putative RBPJκ binding sites in Elf5 promotor.

Analyzing the 5800 base pairs upstream of Elf5 yields eight core consensus RBPJκ binding sites

(TGGGAA/TTCCCA) and another five putative RBPJκ binding sites (CTGGGAG/CTCCCAG

and GTGGGAG/CTCCCAC) identified within the Elf5 promoter sequence, one of which is only

152 base pairs upstream on the Elf5 start site. Putative RBPJκ binding sites are indicated in

green and the Elf5 start codon in red.

57

tgtaggagtccctgtgggaagatgaatctttaatgaatgtgattatctgttggtaacctttgttaggatgctttccagatcaactgagctcattggccatgcatggagagagaggcccacac

actagcagggccaccaataccagtacccatagtaactatacccaatggcaacaacatggactgaccacaggctcacctctaacaacactctcaaaaagcaaaccttgtgcctgccggga

tactgtttaaaaagaactggggaagactgtcttcaagactgcttccttggagaacggctcagttctgtgcctttgcacagtcattaatgacttcagacttaacagcctgatcctgagagaga

aatctgcaatggatgggcttctaatacctctactgacagagagagaaagacagtcttgcagggtggtggctatttcacaaacattgatgtaattaagcccttgtaaagaggaggtcagtgt

tctctagagttttaatggttttaaaagaatcagattctgttgtggatgcaaccctgtttgttggtagagcattcatctgaaatgcatgaagccctgggttccatcctcagctctgcataaataa

cccagagtgccatactcctataatcccagcatttggaagatcttgaatccatggtcatctttggctacagactgagttcaaaaccatctttggctgcatgagatcctttctcaaaaaaaaaa

aaaaagaaaaatatgaaattcaagtcaagcatggtggtgcacacctttaatcccagttcttgggagtcaaatgcaggtgtgtccctgtgagttcagagccagcctggtctacacagaaag

ttgcaggacagttagagctatatagcaaaaacctgtctcaaaatgaaaaaacaaattctgtaacatttattgcagtattgatcatcttcataacaccgtgggcagccactggtttcatcag

agtttgagtgcaatgtcttcagtgctgaaaatatacagagacccatcacttccaaggcacaggcaaggaaagggatttaggagataggggagaaccgcctcattggtttgctcaactga

actggggttcttagtcaaaaaggacacatgaatggctaaagatgggagaggatacccaaagataaagggaaggaaaaaaagaaatctcagactatacaaccaacacataaactgttt

atgtgcttaacatatgtgcctatatatgcttaaatcatcctgtgaatttccgaggcctttatactcaattcaaatatcgtatcaaaaagttggtacatctcaactgagagtcatctccccaggg

ctaccagaagctgggagttctgtgtgggactaggcaggttacctgaactctctatgcctgtttcctcatcagtaaattttaggtgttgatgatgacgcatccctcataagaattatgtaatcat

caaatgacttaatacagtatgtttagtctgtcctgagcacctaagaaatccacccagcaaaggacggctgtcaggattattcaatcctaacttgggacggcaaactcaaaagttgggggc

ctcaatcaacaactgtgtttccctccatcctaatgagatatgccatgtatcagcatgtaccatcgatgtaaatgcctcacagatgaagaaatagatgaagtcgacgcctcatctaatggctc

ccaggtgccaggtgccagcaatgtgttgtcatatatgtccactgcccccaccaaacatccaccaaaacacactttgacaggaactagttaaaacaatagagcttagaaaaattaacattc

tccgcagagtctgtcctgaaaataaagccaggataaaggagactgacccccacagcctggacactcacctgcctgccaaaggcctcttctaatgggctagtgatctaatggtctatgactt

tttcttttcaattcacttttgtttccagcctgggccgtctggttggggttcagaggcgggggcagtgaaagtggcagattttagggggttagggaagtgacctggagagaaagcagcagac

acaagtctgttgggttcagtgaaggcttggatggggccctcctgcctcgtgtcaggtagcatgtcctttaactcacttgattctgtgtgtaggagagaggggagggggaggagagagaga

acatgtgtgtgttagctgtcttctttaagaatttctactcagccgggcagtggtagtgtacacctttaatcccagcacttgggaggcagaggcaggagaatttctgagttcgaggccagcct

ggtctacagagtgagttccaggacagccagaactacacagaaaaaccatgccttggaaataaaataaaaattaaaaaaaaattaaaaaacacttaaagaatttctactctacactaag

agaggagctgggctgcaaatgaccaggagatgtgaagactctgggccatagagagggaaacatccaaagagaacagtgctgaggtcagatcatcgagggaggccagggggagacct

tgtttctatagtgtggtgtttacatccggtaggctgcagtccaacccagagctggccccaggccagatgagtgacatccactgagcaccagcccctctgttcccttatcttaaaaaataata

tgatggtaactgtctcgtagagttgctttgaaaaataaccaaggtaagacaggtgagccagtccagcccagttcgtggcatatgaaagatgcagtacagggtgggattccttcctccctac

ccaaaaacctaccccaggagcaccgggaaccgtcagaacctaagagactagaagcagaggcgaacggccaggactgcacagtgctccctcggcccctgctcacgcgcttcatcttcat

catctgagaaagggtgataagtagcgcccggggttgaaggtctgcacagaacataattaatgaaagaaaacagatcaagatcactcaattgcagagctgtttcaggggtttctcaggct

catccagccaccaaatggcacagcagtaattacagcccgagggggctctttccagagtcacctctcagctactctgctacaatgatgcaatgactaatttcaggaatgccgctctgagaac

ctggaaggaaaatagtgagaaatctaaatgagctcagttcttcccccaccacccctggttcctgcccttcccacttccacagctcatcttcacccacaggcatagtgaagctttcccatagc

ttagtgtttgagatcatccaaacatccattctaatcaaattaagatcaaatgtgatgcttacgcttagagtgcaagttctcttttgtttttgttttatattaatcatcccttttaacgactggtcc

agaagcctctaattccccaggcagtcacccagagatgctacattatgtactcaggaccacaaagcaaaacaggaccactagcatccaaactcgggtcatagaaaaaaatgcaaattctc

caaaactgctttggttttctaaaaacatattgttttctaaagacagtagcagaatagcccgtttttcttggacacttttccttgggaagacagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg

tgtgtgtgtgctcgcgcgcacgtgtgcgcacgtgcgtgtggttcagaaactggtaacgaggtgggacaaagctcagcagcagagaaaatcatgtgcaggacagaggagtcccccaaaa

aacaggcttcaacaggacaagtcacagatgttaaaacttctgtgaggacatctgaattcggttatttccagattctggtcctgtgcagatacttttgttcagacgaaattttaccaagaaga

tttagagaaaagctttggggctcttcttgaatccctcttctaaactctcgaccttcaaacaggacactttttaaactcccgcctaagggctggagagatggtgctgtggataaagcacttccc

tccccaagccttgagttcagtcaatctctagaacccaaattaaagaaaaagccaggtgtagcagggcaggcctgcaatcccaggactagagaggcagagtcaggaggagcctggaag

cttgtaacccagctagtgtagctaaatcaggctcagcaatagactgtgccaaaagcaaagaggagaggctggagagatggctcaaagtttgctgctcttgcagaggacccaggttcaat

tcccagcacccacgtggcagctcacaaccgtctgtaactccagttccagaggatctgaccctctcacatacaggatacaagtaggcagaataccagtatgcattaaaaaaaaaaaaaaa

aaaaaaaacatgttttaaaaatgcctagtgatacagggtctcattgtgtggatcaccctgggtagcctaaaactcactgtgtaaatcaacctggcctcaaacccacagatatctgccgcct

gagtgttgggattaaaggcactgttaaatccaacaaaatgattaaataaataaataaataacttaatcccgttttctcctattactgttgggagaattctgacccagaaaagctggctctcc

cacctaaggtcccagagccaagccagagcctcaacaggccacttatcttgccccgactatttttccatgatgacacatgactcctcacatgaactgccttttgtttcttcacgccgttcgggt

gtttggatttgagtgtttgtgcctatgcccagtgttcccaagaaaacctaaccaaccagtcaatctctgctttccacttcaagatcacagagtctgcagtttgagcaccttggtgtcttggctg

cctgagattgagagaggaacggaacccacgaaagggggttatgaacactcctcccagatgactgcctaggccgtcatttagatttgagagatgtcctaaaaactgggtagttctcagtga

gacagctgacagcttgcaagccaatcaggaccccccgcccccgtgttgttctggatgtttgacactgcagctccacgatcccttcatatcgccatttctaaaacagaggacactgggaaag

ggggaaagctgtcacatggctcctgtattcaaacatggcgccctttgggtgcttagagtggaaaggccagtgaaagcactgctccctgactctctccctgccccctgatcggaaggtcccc

accaggatcaatagaaggaaatatgtagcgcccaaggacaggcttccaggtgattggctgacattaccaagtatggccttcccagcaacccaaggacagattccattattgcattaatct

gatggatcccggatatgctcattaacttattcacagtaatgcagccagaaaatgaccggctcagaatttgatccctgaagcacctttattctttaccacttcttggcactgctcttctttccta

acacgcacagaataggggataacactacatacagaggttcgggacttggccagcccaggcaaaggctgcaatgaacagacaccaggcctgaatttccttccctccagcttgctcaacgg

agactgctccagccagcactccacttatccccccgggggcaagaattctctgctcatttcctgggtcccctcggtgggtggtgggagctgggcacaaaagcaggagaaaggtaaactttct

gcatgtgaaaaccaccccccacccccgaggagccgtgtcacaccgtatgtcaccgtcatcaaaggggctgtgcataaacctgaaaaaccaaacggacctgtctgtaggtgtcacttatat

g

58

4.2.3 Notch1IC Cell-Autonomously Promotes Specification of Hormone

Receptor Negative Cells

As noted above, Line A and TL transgenic glands contain numerous regions with a

disproportionate number of Elf5+ columnar cells8, and this could potentially be linked to

induction of Elf5 by Notch1IC. To test for cell-autonomous effects of Notch1IC on cell fate, I

performed a series of double immunofluorescence experiments. First, there was very little

overlap between ER and eGFP expression (Figure 16). Consistent with this, GFP expression was

predominately found in columnar cells (Figure 17), which are ER- in wild type glands7. In

addition, the number of ER+ cells was significantly reduced in both Line A and TL transgenic

glands compared to wild type, although TL had significantly more ER+ cells than Line A

transgenics (Figure 18). Thus, my data suggest that Notch1IC expression promotes

Elf5+/columnar cell fate specification, survival or proliferation. Alternatively, Notch1IC may be

inhibiting specification, proliferation or survival of ER+/cuboidal/Elf5- cells. I believe the former

possibility is more likely given the accumulation of ectopic Elf5+/columnar cells in the lumen of

Line A and TL transgenic ducts. However, it remains formally possible that segregation of eGFP

expression to the columnar lineage could be due to higher expression of MMTV-Cre Line A/TL

in these cells and lower in ER+ cells, which would result in less frequent activation of Notch1IC

expression in ER- cells. Crosses of MMTV-Cre to ROSALacZ mice are being performed to

exclude this possibility.

59

Figure 16. Notch1IC/eGFP+ cells are hormone receptor negative.

(A,B,D,E) Immunofluorescent staining for the estrogen receptor (red), eGFP (green), and DAPI

(blue) of six week old virgin TL transgenic glands demonstrate little co-localization of ERα and

eGFP. As previously observed ERα expression is limited to the periphery of developing

alveolar-like structures. (C, F) Staining for ERα (red) and eGFP (green) in a six week old virgin

wild type littermate showing no expression of eGFP and a normal ERα expression pattern. Scale

bars are 10 µm (magnification 40X).

60

61

Figure 17. Notch1IC/eGFP expressing cells are morphologically columnar.

(A) A six week old virgin wild type littermate exhibiting no expression of eGFP. (B) A six week

old virgin TL transgenic gland exhibiting substantial eGFP staining in morphologically columnar

cells. Arrows indicate regions with multiple consecutive eGFP+ columnar cells. Scale bars are

10µm (magnification 40X).

62

63

Figure 18. Notch1IC transgenic mice exhibit a reduced number of ERα+ cells.

(A, B) Immunohistochemical staining for ERα expression in ducts of six week old virgin wild

type littermates. (C, D) Staining for ERα in six week old virgin Line A and TL transgenic ducts,

respectively, displaying a decrease in the number of ERα+ cells. The decreased number of ERα+

cells is more dramatic in Line A transgenic ducts, and arrows indicate cells stained positively for

ERα, albeit with reduced expression levels. Scale bar is 10µm (magnification for A&C is 40X,

for B&D is 80X). (E) A bar graph quantifying the frequency of luminal cells in mature ducts that

exhibit positive staining for ERα in Line A transgenic, TL transgenic, and wildtype glands. Both

Line A and TL transgenic ducts display a significant reduction in the frequency of ERα+ cells

compared to wildtype ducts. Importantly, Line A transgenic ducts exhibit a significant reduction

in the frequency of ERα+ cells compared to TL transgenic ducts (p-value = 3.6395e-07, 2.8147e-

06, and 0.00246, respectively).

64

65

4.3 Effects of Ectopic Notch1IC Expression during Pregnancy

4.3.1 Notch1IC Expression Promotes Formation of Pregnancy-Dependent

Lactating Adenomas

To determine how Notch1 activation affects mammary epithelium during pregnancy, I next

studied alveolar development and lactogenic differentiation in TL transgenic mice.

Wholemounts revealed development of transgenic mammary glands were superficially normal

until approximately 14.5 dpc. At this point, some regions formed into large cystic masses

(Figure 19). These lesions frequently arose in multiple mammary glands during late pregnancy

and grew even faster during lactation, with palpable tumors developing in almost 100% of

lactating TL transgenics (11/12). The palpable tumours normally regressed during involution but

occasionally did not regress completely and continued to grow at a dramatically reduced rate.

Many pups were able to survive until weaning, however, their growth was delayed and it was not

uncommon for a few pups to die in each litter. Death of pups was independent of their

ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP or MMTV-Cre genotype. Interestingly, pups from the

one of 12 mice that did not develop a palpable mammary tumor in its first pregnancy, all died of

malnutrition, suggesting that milk production/secretion was insufficient or that milk content was

abnormal. Furthermore, this mouse developed a palpable mammary tumor in its second

pregnancy. These Notch1IC-induced tumours were characterized as lactating adenomas (Dr.

Robert Cardiff, University of California Davis, personal communication).

66

Figure 19. Notch1IC mutant mice develop pregnancy-dependent adenomas.

(A, C) Hematoxylin stained wholemounts of a wild type littermate and TL transgenic gland,

respectively, extracted at 14.5 dpc showing normal overall growth. (B, D) Enlarged regions of

wild type and TL transgenic glands from panels A and C, respectively, showing normal

branching and ductal development. (E, G) Hematoxylin stained wholemounts of a wild type

littermate and TL transgenic glands, respectively, extracted at 17.5 dpc showing adenoma growth

in the TL transgenic gland. (F, H) Enlarged regions of wild type and TL transgenic glands from

panels E and G, respectively, showing cystic lobules in the Notch1IC induced adenoma. Scale

bars are 1mm for A&C, 0.5mm for C&D, 1.75mm for E, 1mm for G, 0.25mm for F, and 0.5mm

for H (magnification for A,C,E, and G is 1.9X and 12X for B, D, F, H).

67

68

69

4.3.2 Notch1IC-Induced Adenomas Contain Highly Proliferative Luminal

Secretory Cells with Two Distinct Morphologies

Histological analysis of adenomas in pregnant or lactating TL transgenic mice revealed the

presence of two morphologically distinct epithelial cell types; some regions were composed of

cuboidal cells while others contained flat cells (Figure 20). Cells within adenomas were GFP+

and those in morphologically normal ducts and alveoli were GFP-, suggesting that these lesions

developed from GFP+ cells observed during puberty (see above). Alternatively, GFP+ cells seen

in the pubescent gland may die in early pregnancy, with adenomas developing in response to de

novo Cre-mediated Notch1IC gene activation in alveolar progenitor cells of the pregnant gland.

We favor this second possibility since GFP+ cells were easily detected during puberty but not

always at mid-pregnancy of TL transgenic glands. Further experimentation will be required to

distinguish these models.

To characterize Notch1IC-induced adenomas, I stained sections for lineage-specific and

differentiation associated markers. Positive staining was observed for luminal markers, K8 and

Gata3, and negative staining for myoepithelial markers, K14 and p63, demonstrating that

adenomas were luminal (Figure 21). Furthermore, these lesions were highly proliferative as

indicated by strong expression of PCNA (Figure 22). Also, most cells expressed C/EBPβ, Elf5,

and Stat5a, but not ERα (Figure 22). Flow cytometric analysis at 14.5 dpc revealed that the vast

majority of GFP+ cells (and therefore Notch1IC+ cells) did not express the luminal progenitor

marker, CD61, indicating that they had differentiated beyond the luminal progenitor or precursor

stage2 (Figure 23). Interestingly, flow cytometric analysis also reveals that CD61- cells in the TL

transgenic gland have a reduced population of small cells and an increased population of large

cells. Furthermore, the average sized CD61+ cells in the TL transgenic gland appear to be

70

expressing CD61 to a higher degree than the average sized CD61+ wild type cells (Figure 23,

panel B & E). In panel C & F of Figure 23 it is also clear that there is a marked reduction of

CD61-eGFP- cells in the TL transgenic gland, suggesting that eGFP is being preferentially

expressed in these cells but this cannot be formally concluded.

Consistent with expression data and CD61- status, adenoma cells were clearly secretory, with

lipid droplets found within many cells, and cystic lumens were full of protein and lipid

containing secretions. Indeed, it should be noted that when tumours were harvested, an

unusually large amount of white milky fluid was present within each adenoma. Together this

data revealed that Notch1IC-induced adenomas were composed of highly proliferative but

differentiated secretory cells. Interestingly, the cuboidal and flat cell containing regions showed

identical patterns of staining for every marker except for tyrosine phosphorylated pStat5a, which

was only positive in cuboidal cells (Figure 24). Thus, prolactin signaling was apparently

restricted to adenoma cells with cuboidal morphology. Regions composed of morphologically

flat cells also contained luminal lipid droplets, indicating that a secretory pathway was also

activated in these cells.

71

Figure 20. Notch1IC-induced adeomas exhibit two morphologically distinct regions.

(A,B,C) Hematoxylin and eosin stained section of a 17.5 dpc wild type littermate mammary

gland, cuboidal cell region, and flat cell region from a 17.5 dpc TL transgenic gland,

respectively. Arrows mark lipid droplets characteristic of this stage of pregnancy, however,

these droplets are increased in size and number within abnormally large lumens of the adenoma

while still within cells of the wild type gland. Scale bars are 20µm (magnification 40X).

72

73

Figure 21. Notch1IC-induced adenomas are luminal.

The pregnancy dependent adenomas, harvested from TL transgenic mice at 17.5 dpc, are positive

for K8 (E) and almost entirely negative for K14 (F). Adenomas are also negative for p63, as

shown in panel G where the adenoma mass is adjacent to and below normal alveolar complexes.

The adenoma is also strongly positive for Gata3 (H). (A,B,C,D) Sections from a wild type

littermate mammary gland, harvested at 17.5 dpc and stained with K8, K14, p63, and Gata3,

respectively. Scale bars are 10µm (magnification 20X).

74

75

Figure 22. Notch1IC-induced adenomas are composed of highly proliferative secretory cells.

Pregnancy dependent lesions, harvested from TL transgenic mice at 17.5 dpc, are strongly

positive for PCNA (F), mostly positive for C/EBPβ (G), strongly positive for Elf5 (H), strongly

positive for Stat5a (I), and are almost entirely negative for ERα (J), with the exception of a small

number of positive cells, two of which are indicated by arrows. (A, B, C, D, E) Sections from a

wild type littermate mammary gland, harvested at 17.5 dpc, stained with PCNA, C/EBPβ, Elf5,

Stat5a, and ERα, respectively. Scale bars are 20µm (magnification 20X).

76

77

Figure 23. Notch1IC/eGFP+ cells are CD61-.

(A, B) Cells from a wild type 14.5 dpc mammary gland harvested were analyzed by flow

cytometry. The graph depicts a two parameter 5% probability contour plot of forward scatter

versus eGFP signals and forward scatter versus CD61 signals, respectively. (C) Cells from a wild

type 14.5 dpc mammary gland analyzed for CD61 versus eGFP signals. (D, E) Cells from a 14.5

dpc TL transgenic mammary gland were analyzed by flow cytometry. The graph depicts a 2

parameter 5% probability contour plot of forward scatter versus eGFP signals and forward

scatter versus CD61 signals, respectively. (F) This graph depicts CD61 versus eGFP signal of

cells from a 14.5 dpc TL transgenic mammary gland. Importantly, the vast majority of eGFP+

cells are negative for CD61.

78

79

Figure 24. Morphologically distinct regions of the Notch1IC-induced tumour exhibit

differentially activated Stat5 signaling.

(A) Staining for pStat5(tyr694) in 17.5 dpc wild type mammary gland littermate. (B) Staining

for pStat5 in morphologically flat cells of the tumour indicates little to no Stat5 activation. (C)

An adenomous region with morphologically flat and pStat5 negative cells (indicated by arrow)

adjacent to cuboidal and pStat5 positive cells. (D) A region of the tumour composed of cuboidal

cells stained positively for pStat5. Scale bars are 20µm (magnification 20X).

80

81

4.3.3 Notch1IC-Induced Adenomas Exhibit Irregular Subcellular

Structures and Morphologies

Upon identifying adenoma regions containing cells with distinct morphologies and

differential Stat5 activation, further analysis was performed to compare these cell types. High

magnification light microscopy of histological sections revealed the presence of decapitation

secretions in some but not all cuboidal cells (Figure 25). These structures were not seen in the

flat cells. Decapitation secretions are apical cytoplasmic processes which “pinch-off” into the

lumen. These structures are frequently seen in apocrine cells and apocrine carcinomas and are

pathognomonic of apocrine differentiation85. Next, we performed transmission electron

microscopy (TEM) on representative cells from both regions. Figure 25 reveals the presence of a

decapitation secretion that was still attached and one that appears to be separated from the

nearest cell. In the later case, this may be a due to complete secretion of a membrane bound

structure or an artifact of thin sectioning in which case the secretion was still attached, but in a

different plane. TEM analysis also revealed the presence of other membranous projections

including extremely long villi (Figure 26). Finally, irregular nuclear structures were also

observed (Figure 27). The long villi and abnormal nuclei were observed in adenoma cells of

cuboidal and flat morphologies.

82

Figure 25. Notch1IC-induced adenomas exhibit decapitation secretions.

(A) Section of Notch1IC-induced adenoma stained for PCNA clearly shows decapitation

secretions. Black arrows mark decapitation secretions still in the process of blebbing, while the

red arrow indicates a decapitation secretion that appears to have broken free from its cell of

origin. Scale bar is 10µm (magnification 80X). (B) Transmission electron microscope image of

a Notch1IC induced adenoma extracted at 17.5 dpc depicts a decapitation secretion that has

appeared to have detached from its cell of origin, while, (C) depicts an intact decapitation

secretion in the same adenoma. Arrows mark decapitation secretions, or parts thereof and “Lu”

denotes the lumen. Scale bar is 500nm (magnification 25000X).

83

84

Figure 26. Transmission electron microscope images showing irregular membranous

projections in Notch1IC-induced adenoma cells.

Transmission electron microscope images of a Notch1IC induced adenoma extracted at 17.5 dpc

(A, B) Elaborate membranous projections compared with simpler and smaller membranous

projections previously identified in the literature as normally present in alveolar cells (C,D) from

Pitelka et al. (1973)86 and Morroni et al. (2004)87, respectively. “Lu” denotes the lumen and

scale bars are 2 microns (A) (magnification 10000X), 500nm (B) (magnification 40000X),

0.5µm (C) (magnification 27000X), and 2µm.

85

86

Figure 27. Transmission electron microscope images showing irregular nuclear profiles of

Notch1IC-induced tumours.

Transmission electron microscope images of Notch1IC induced adenoma cells harvested from a

17.5 dpc mouse (A, B) Arrows indicate cells with noticeable abnormalities in nuclear shape.

“Lu” denotes the lumen and scale bars are 2 microns (magnification 5000X and 4000X,

respectively).

87

88

4.4 Other Effects of Ectopic Notch1IC Expression

4.4.1 Notch1IC Induces Facial Tumours and Lymphoma

In addition to lactating adenoma formation, TL transgenics also developed tumors in other

tissues. Two mice developed facial tumours as early as six weeks of age (Figure 28). More

frequently, TL transgenic mice were found to be lethargic, and experienced difficulty breathing

prior to death. After euthanasia, these mice were found to have grossly enlarged livers and

spleens. These symptoms were suggestive of lymphoma, but a complete characterization of

spleen and liver lesions has yet to be performed (Figure 29). TL transgenic mice of both genders

eventually developed these lymphoma-like symptoms over the course of many months, but death

as a result of this condition has been observed as early as seven weeks of age.

89

Figure 28. Notch1IC TL transgenic mice occasionally develop facial tumours.

(A, B) Hematoxylin and eosin staining of adjacent normal salivary tissue and the tumour,

respectively. Scale bars are 20µm (magnification 20X).

90

91

Figure 29. Notch1IC TL transgenic mice exhibit enlarged and irregular liver and spleens.

(A, B) Hematoxylin and eosin staining of a 7 week old wild type liver. (C, D) H&E staining of a

7 week old wild type spleen. (E, F) H&E staining of a 7 week old TL transgenic liver. (G, H)

H&E staining of a 7 week old TL transgenic spleen. Scale bars are 200µm for A, C, E, and G

(magnification 2.5X) and 20µm for B, D, F, and H (magnification 20X).

92

93

5. Discussion

5.1 Pubertal Effects of Ectopic Notch1IC Expression

A number of studies have described effects of ectopic Notch1 signaling in the mouse

mammary gland. For example, Notch1IC can induce mammary tumor formation57, 72. In

contrast, Notch1IC inhibits self-renewal and actually promotes differentiation of isolated

mammary stem cells58. In these latter experiments, Notch1IC-expressing stem and/or progenitor

cells were transplanted into the mammary fat pad in the absence of differentiated mammary cells

that may form a niche, in vivo58. Indeed, the effects of ectopic Notch1IC expression during

mammary gland development are diverse and can be understood best in terms of which cells

express it in each experiment, and in what context. In my study, I have used a Cre-conditional

transgenic system to achieve mosaic activation of Notch1IC expression in a subset of mammary

epithelial cells. Notch1IC-expressing cells in this system therefore will develop in the presence of

a normal mammary niche.

In Line A transgenic mammary glands at puberty, where Notch1IC is expressed in TEB

body cells, the transgene inhibited TEB growth and elongation. Most Line A transgenic TEBs

were unusually small, suggesting that stem or early progenitor cell self-renewal was impaired or

that many Notch1IC-expressing cells were dying, which preliminary evidence suggests is not the

case (A Kucharczuk, data not shown). In addition, a few large and abnormal TEBs were

observed in Line A transgenic glands, and these were found to contain alveolar-like structures of

Elf5+ luminal cells. These structures were also observed in mature ducts of Line A and TL

transgenic glands, where ectopic Notch1IC expression promoted Elf5+, Stat5+, ER- cell fate

specification, survival or proliferation. In fact, very few eGFP+ (Notch1IC-expressing) cells in

94

both transgenic lines were ERα+. While it remains formally possible that this is due to

preferential activation of Cre expression in Elf5+ columnar cells, I do not favor this interpretation

since Line A and TL transgenic mice both exhibit an increase in Elf5+ columnar cells at the

expense of ERα+ cells. However, MMTV-Cre (Line A and TL) are being crossed to ROSALacZ to

test for any Elf5+ cell versus ERα+ Cre expression cell bias in these lines in the absence of

Notch1IC. The mechanism of Elf5+ cell fate induction by Notch1IC is currently unknown, but the

existence of putative RBPJκ-binding sites in the Elf5 promoter suggest that this effect may be

through direct induction of Elf5 transcription. The increased proportion of Elf5+ cells, with

compensatory reduction in ERα+ cell numbers, may have contributed to the poor growth

observed in Line A mutant glands since ERα+ cells are required for ductal elongation and

branching19, 28, 29. Indeed, the poor ductal growth observed in Line A transgenics is likely due to

effects of Notch1IC on mammary stem/progenitor cell self-renewal (inhibition)58 and on ERα+

cuboidal/Elf5+ columnar cell ratios. While TL transgenic mice also exhibit a significant

reduction in the ERα+/Elf5+ cell ratio, the number of ERα+ cells was apparently sufficient for

estrogen signaling to promote normal ductal outgrowth during puberty.

My work identifies Notch1IC as sufficient to promote Elf5+ER- cell fate at the expense of

ERα+ fate, while previous work indicates that Notch signaling is required for maintenance of this

cell type. Specifically, Hennighausen’s lab has shown that canonical Notch signaling through

RBPJκ is required for maintenance of ERα- luminal cell fate during pregnancy73. In addition,

Miele’s group has shown that Notch signaling is required for the survival of transformed ERα-

cells in vitro26. My work, therefore, reveals for the first time that Notch1 activation is sufficient

for Elf5+/columnar cell accumulation during puberty. At this time it is not clear whether this is

via promotion of Elf5+/columnar cells or the blockage of ERα+ cell fate.

95

Hormone receptor negative luminal cells that accumulated in mature ducts of Line A and TL

transgenics may have differentiated into alveolar cells or their immature progenitors, as

evidenced by the alveolar-like morphology of these accumulations, with some regions even

being encapsulated by myoepithelial cells. Staining for Aquaporin 5 (a marker of ductal luminal

cells that is not expressed in alveoli) as well as for Npt2b (expressed in luminal cells of the

alveoli but not in luminal cells of ducts) will have to be performed to test for alveolar

specification of Notch1IC-expressing cells7. Interestingly, ectopic expression of Elf5 has been

shown to induce similar alveolar-like regions in pubescent glands, with significant upregulation

of the milk protein, β-casein8. We therefore plan to probe these structures for expression of β-

casein. Ultimately, my results indicate that Notch1 signaling can induce or enhance

Elf5+/columnar cell differentiation, proliferation and/or survival during puberty. Whether this

represents a normal function for Notch1 during puberty is currently unknown. My results,

however, may be most consistent with a role for Notch1 signaling in alveolar development

during early pregnancy, when Elf5+ cell accumulation is observed43.

5.2 Effects of Ectopic Notch1IC Expression during Pregnancy

Surprisingly, pregnancy in ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP;MMTV-Cre TL

mice appears to proceed normally until approximately day 14.5 dpc. This could be due to high

levels of endogenous Notch1 activation up to this time, as speculated above. Arguing against

this idea, however, is that eGFP+ cells were not easy to detect during early to mid pregnancy,

especially given the high frequency of such cells (approximately 50%) observed during puberty.

This result suggests that eGFP+ cells in the pubescent gland may die, with alveolar buds

developing from eGFP- cells, and adenomas forming in response to de novo Cre-mediated

96

Notch1IC gene activation at mid pregnancy. Further analysis is being performed to directly test

for the fate of pubertal eGFP+ cells in the early pregnant gland.

Pregnancy-associated adenomas contained regions with luminal cells of two different

morphologies. One of these had cuboidal cells with phospho-Stat5, the other had flat cells with

Stat5 that was not phosphorylated. The cuboidal cells were K8+, Elf5+, CD61-, pStat5+, with

notable presence of lipid droplets and decapitation secretions. It is currently unclear whether

Notch1IC is driving differentiation of secretory cells or whether it is being selectively activated in

secretory cells. One way to test for this is to cross a Cre-inducible ROSA26-eGFP mouse with

MMTV-Cre TL, and then to analyze eGFP activation vs luminal progenitor cell (CD61+)

differentiation by flow cytometry. If, as with TL transgenics, eGFP+ cells are exclusively CD61-,

then MMTV-Cre (TL)-mediated Notch1IC activation was restricted to differentiated secretory

cells, and my results must be interpreted in this context. However, if CD61+ cells are also eGFP+

in 14.5 dpc pregnant ROSA26loxP-stop-loxP-eGFP;MMTV-Cre TL mice, then Notch1IC would

appear to be driving secretory differentiation of CD61+ cells during pregnancy of TL transgenics.

The other transformed cell type, the flat ones, do not contain phospho-Stat5. To identify

the cell of origin, I am currently performing double immunofluorescence experiments to screen

for ERα- alveolar cells in the pregnant gland that do not show Stat5 activation in late pregnancy.

Alternatively, it is possible that these flat tumour cells originate from a known cell type,

unrecognizable following Notch activation. For example, they may have originated from mature

ductal cells induced by Notch1IC to secrete a substance into the lumen.

The adenomas that form in ROSA26loxP-stop-loxPNotch1ICδC-ires-eGFP;MMTV-Cre TL

mice are pregnancy dependent, as they are induced by pregnancy and regress during involution.

However, this regression is not always complete and after several pregnancies these lesions

97

continue to grow after the pups are weaned. Indeed, TL transgenics develop tumors that mimic

those described by Kiaris et al. in MMTV-humanNotch1IC transgenic mice57and differs from

results of Hu et al. in MMTV-mouse Notch1IC transgenics72. It is not clear what changes are

responsible for progression of TL tumors, and further analysis needs to be performed to compare

non-regressing tumours with the pregnancy dependent precursor lesions. Preliminary analysis

has revealed that progression can be associated with outgrowth of tumor cells with the flat

morphology (A. Kucharczuk data not shown).

Lactating adenomas are by far the most common form of pregnancy-associated breast

lesions88. These are mostly benign and regress after pregnancy, but approximately 5% develop

into pregnancy independent tumours 89, 90. In total, pregnancy-associated breast cancer accounts

for 0.2-3.8% of all breast cancer in humans91. Together, my results suggest that Notch1IC

transgenics may be an excellent model to study lactating adenomas and potentially their further

progression.

Notch1IC induced lactating adenomas may also provide insights into the biology of

apocrine tumours. The appearance of decapitating secretions in my model suggest that altered

Notch signaling may play a role in apocrine tumours, since this apical feature is considered

pathognomonic of apocrine differentiation85. Recent microarray analysis has revealed a new

class of breast tumors termed ‘molecular apocrine’ that includes all ERα- luminal tumours and

represents 8-14% of breast cancer92. Given that TL tumors are ERα-, luminal, and show

decapitation secretions, it would be of interest for test for Notch1 signaling in such tumors.

While still a work in progress many insights have been gained with regard to the role of

Notch1 in regulating normal mammary gland development and transformation using

ROSA26loxP-stop-loxP-Notch1ICδC-ires-eGFP;MMTV-Cre TL mice. For example, Notch1 promotes

98

accumulation of Elf5+/columnar cells during puberty, at the expense of ER+ cells. While

currently unclear whether Notch1IC promotes secretory cell fate it remains a distinct possibility

given the frequently observed ‘alveolar-like’ morphology in transgenic ducts, the presence of

secretory tumours, and the potential that ectopic Notch1IC expression may phenocopy ectopic

Elf5 expression. Additionally, the Notch1IC induced lactating adenomas may provide some

insight into the human disease. Finally, my results show that Notch1 signaling can promote the

development of facial tumours and supports previous work with regards to the capacity of

Notch1 to promote lymphoma61, and identified the Notch signaling pathway as potentially

disrupted in apocrine tumours. Further analysis is required to test for the importance of Notch1

signaling in pregnancy-associated breast cancer and molecular apocrine breast cancers in

humans.

99

6. References 1) Shackleton, M., Vaillant, F., Simpson, K.J., Stingl, J., Smyth, G.K., Asselin-Labat, M.L.,

Wu, L., Lindeman, G.J., and Visvader, J.E. (2006). Generation of a functional mammary

gland from a single stem cell. Nature 439(7072), 84-88.

2) Stingl, J., Eirew, P., Ricketson, I., Shackleton, M., Vaillant, F., Choi, D., Li, H. I., and

Eaves, C. J. (2006). Purification and unique properties of mammary epithelial stem cells.

Nature 439(7079), 993-997.

3) Hennighausen, L. and Robinson, G.W. (2001). Signaling pathways in mammary gland

development. Dev Cell 1(4), 467-475.

4) Ball, S.M. (1998). The development of the terminal end bud in the prepubertal-pubertal

mouse mammary gland. Anat Rec 250(4), 459 – 464.

5) Williams, J.B. and Daniel, C.W. (1983). Mammary ductal elongation: differentiation of

myoepithelium and basal lamina during branching morphogenesis. Dev Biol 97, 274-90.

6) Humphreys, R.C., Krajewska, M., and Krnacik, S. (1996). Apoptosis in the terminal

endbud of the murine mammary gland: a mechanism of ductal morphogenesis.

Development 122, 4013-22.

7) Grimm, S.L. and Rosen, J.M. (2003) The role of C/EBP beta in mammary gland

development and breast cancer. J Mammary Gland Biol Neoplasia 8(2), 191-204.

8) Oakes, S.R., Naylor, M.J., Asselin-Labat, M.L., Blazek, K.D., Gardiner-Garden, M.,

Hilton, H.N., Kazlauskas, M. Pritchard, M.A., Chodosh, L.A., Pfeffer, P.L., Lindeman,

G.J., Visvader, J.E., and Ormandy, C.J. (2008). The Ets transcription factor Elf5

specifies mammary alveolar cell fate. Genes Del 22(5), 581-586.

100

9) Brisken, C. (2002). Hormonal Control of Alveolar Development and Its Implications for

Breast Carcinogenesis. J Mammary Gland Biol Neoplasia 7(1), 39-48.

10) Muller, W.J. and Neville, M.C. (2001). Introduction: Signaling in mammary development

and tumorigenesis. J Mammary Gland Biol Neoplasia 6(1), 1-5.

11) Sleeman, K.E., Kendrick, H., Ashworth, A., Isacke, C.M., and Smalley, M.J. (2006).

CD24 staining of mouse mammary gland cells defines luminal epithelial,

myoepithelial/basal and non-epithelial cells. Breast Cancer Res 8(1).

12) Asselin-Labat, M.L., Sutherland, K.D., Barker, H., Thomas, R., Shackleton, M., Forrest,

N.C., Hartley, L., Robb, L., Grosveld, F.G., van der Wees, J., Lindeman, G.J., and

Visvader, J.E. (2007). Gata-3 is an essential regulator of mammary-gland morphogenesis

and luminal-cell differentiation. Nat Cell Biol 9(2), 201-U103.

13) Sleeman, K.E., Kendrick, H., Robertson, D., Isacke, C.M., Ashworth, A., and Smalley,

M.J. (2007). Dissociation of estrogen receptor expression and in vivo stem cell activity

in the mammary gland. J Cell Biol 176(1), 19-26.

14) Smith, G.H. (1996). Experimental mammary epithelial morphogenesis in an in vivo

model: Evidence for distinct cellular progenitors of the ductal and lobular phenotype.

Breast Cancer Res Treat 39, 21-31.

15) Kordon, E. C. and Smith, G. H. (1998). An entire functional mammary gland may

comprise the progeny from a single cell. Development 125(10) 1921-30.

16) Lamarca H. L., and Rosen J. M. (2008). Minireview: hormones and mammary cell fate –

what will I be when I grow up? Endocrinology 149, 4317–4321.

101

17) Hovey, R.C., Trott, J.F., and Vonderhaar, B.K. (2002). Establishing a framework for the

functional mammary gland: From endocrinology to morphology. J Mammary Gland Biol

Neoplasia 7(1), 17-38.

18) Couse, J.F. and Korach, K.S. (1999). Estrogen receptor null mice: what have we learned

and where will they lead us? Endocr Rev 20,(4), 459-459.

19) Mallepell, S., Krust, A., Chambon, P., and Brisken, C. (2006). Paracrine signaling

through the epithelial estrogen receptor alpha is required for proliferation and

morphogenesis in the mammary gland. Proc Natl Acad Sci U S A 103(7), 2196-2201.

20) Zeps, N., Bentel, J.M., Papadimitriou, J.M., D'Antuono, M.F., and Dawkins, H.J.S.

(1998). Estrogen receptor-negative epithelial cells in mouse mammary gland

development and growth. Differentiation 62(5), 221-226.

21) Fendrick, J.L., Raafat, A.M., and Haslam, S.Z. (1998). Mammary gland growth and

development from the postnatal period to postmenopause: Ovarian steroid receptor

ontogeny and regulation in the mouse. J Mammary Gland Biol Neoplasia 3(1), 7-22.

22) Brisken C. and Duss S. (2007). Stem Cells and the stem cell niche in the breast: an

integrated hormonal and developmental perspective. Stem Cell Rev 3, 147–156.

23) Howlin, J., McBryan, J., and Martin, F. (2006). Pubertal mammary gland development:

Insights from mouse models. J Mammary Gland Biol Neoplasia 11(3-4), 283-297.

24) Sahin, U., Weskamp, G., Kelly, K., Zhou, H.M., Higashiyama, S., Peschon, J., Hartmann,

D., Saftig, P., and Blobel, C.P. Distinct roles for ADAM10 and ADAM17 in ectodomain

shedding of six EGFR ligands. J Cell Biol 164(5), 769-779.

25) Sternlicht, M.D., Sunnarborg, S.W., Kouros-Mehr, H., Yu, Y., Lee, D.C., and Werb, Z.

(2005). Mammary ductal morphogenesis requires paracrine activation of stromal EGFR

102

via ADAM17-dependent shedding of epithelial amphiregulin. Development 132(17),

3923-3933.

26) Rizzo, P., Miao, H., D'Souza, G., Osipo, C., Yun, J., Zhao, H.P., Mascarenhas, J., Wyatt,

D., Antico, G., Hao, L., Yao, K., Rajan, P., Hicks, C., Siziopikou, K., Selvaggi, S.,

Bashir, A., Bhandari, D., Marchese, A., Lendahl, U., Qin, J.Z., Tonetti, D.A., Albain, K.,

Nickoloff, B.J., and Miele, L. (2008). Cross-talk between Notch and the estrogen receptor

in breast cancer suggests novel therapeutic approaches. Cancer Res 68(13), 5226-5235.

27) Brou C., Logeat F., Gupta N., Bessia C., LeBail O., Doedens J.R., Cumano A., Roux P.,

Black R. and Israël A. (2000) A novel proteolytic cleavage involved in Notch signaling:

the role of the disintegrin-metalloprotease TACE. Mol Cell 5, 207–216.

28) Brisken, C., Park, S., and Vass, T.A. (1998). Paracrine role for the epithelial progesterone

receptor in mammary gland development. Proc Natl Acad Sci U S A 95(9), 5076-81.

29) Humphreys, R.C. Lydon, J.P., O'Malley, B.W., and Rosen, J.M. (1997). Use of PRKO

Mice to Study the Role of Progesterone in Mammary Gland Development. J Mammary

Gland Biol Neoplasia 2(4), 343-354.

30) Brisken, C., Heineman, A., Chavarria, T., Elenbaas, B., Tan, J., Dey, S.K., McMahon,

J.A., McMahon, A.P., and Weinberg, R.A. (2000). Essential function of Wnt-4 in

mammary gland development downstream of progesterone signaling. Genes Dev 14(6),

650-654.

31) Anderson, S.M., Rudolph, M.C., McManaman, J.L., and Neville, M.C. (2007). Key

stages in mammary gland development - Secretory activation in the mammary gland: it's

not just about milk protein synthesis! Breast Cancer Res 9(1).

103

32) Neville, M. C. McFadden, T. B., and Forsyth, I. (2002). Hormonal Regulation of

Mammary Differentiation and Milk Secretion. J Mammary Gland Biol Neoplasia 7(1),

49-66.

33) Nguyen, D.A., Parlow, A.F., and Neville, M.C. (2001). Hormonal regulation of tight

junction closure in the mouse mammary epithelium during the transition from pregnancy

to lactation. J Endocrinol 170(2), 347-356.

34) Ball, R.K., Friis, R.R., Schoenenberger, C.A., Doppler, W., and Groner, B. (1988).

Prolactin regulation of beta -casein gene expression and of a cytosolic 120-kd protein in a

cloned mouse mammary epithelial cell line. EMBO J 7(7), 2089-2095.

35) Lydon, J.P., DeMayo, F.J., Funk, C.R., Mani, S.K., Hughes, A.R., Montgomery, C.A. Jr.,

Shyamala, G., Conneely, O.M., and O’Malley, B.W. (1995). Mice lacking progesterone

receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9(18), 2266-2278.

36) Fata, J.E., Kong, Y.Y., Li, J., Sasaki, T., Irie-Sasaki, J., Moorehead, R.A., Elliott, R.,

Scully, S., Voura, E.B., Lacey, D.L., Boyle, W.J., Khokha, R., and Penninger, J.M.

(2000). The osteoclast differentiation factor osteoprotegerin-ligand is essential for

mammary gland development. Cell 103(1), 41-50.

37) Kim, N.S., Kim, H.J., Koo, B.K., Kwon, M.C.,Kim, Y.W., Cho, Y., Yokota, Y.,

Penninger, J.M., and Kong, Y.Y. (2006). Receptor activator of NF-kappa B ligand

regulates the proliferation of mammary epithelial cells via Id2. Mol Cell Biol 26(3),

1002-1013.

38) Nguyen, D.A., Parlow, A.F., and Neville, M.C. (2001). Hormonal regulation of tight

junction closure in the mouse mammary epithelium during the transition from pregnancy

to lactation. J Endocrinol 170(2), 347-356.

104

39) Brisken, C., Kaur, S., Chavarria, T. E., Binart, N., Sutherland, R. L., Weinberg, R. A.,

Kelly, P. A., and Ormandy, C. J. (1999). Prolactin Controls Mammary Gland

Development via Direct and Indirect Mechanisms. Dev Biol 210(1), 96-106.

40) Oakes, S.R., Rogers, R.L., Naylor, M.J., and Ormandy, C.J. (2008). Prolactin regulation

of mammary gland development. J Mammary Gland Biol Neoplasia 13(1), 13-28.

41) Ormandy, C. J., Naylor, M., Harris, J., Robertson, F., Horseman, N. D., Lindeman, G. J.,

Visvader, J., and Kelly, P. (2003). A Investigation of the transcriptional changes

underlying functional defects in the mammary glands of prolactin receptor knockout

mice. Recent Prog Horm Res 58,297-323.

42) Brisken, C., Ayyannan, A., Nguyen, C., Heineman, A., Reinhardt, F., Jan, T., Dey, S.K.,

Dotto, G.P., and Weinberg, R.A. (2002). IGF-2 Is a Mediator of Prolactin-Induced

Morphogenesis in the Breast. Dev Cell 3(6), 877-887.

43) Harris, J., Stanford, P.M., Sutherland, K., Oakes, S.R., Naylor, M.J., Robertson, F.G.,

Blazek, K.D., Kazlauskas, M., Hilton, H.N., Wittlin, S., Alexander, W.S., Lindeman,

G.J., Visvader, J.E., and Ormandy, C.J. (2006). Socs2 and Elf5 mediate prolactin-induced

mammary gland development. J Mol Endocrinol 20(5), 1177-1187.

44) Naylor, M.J., Oakes, S.R., Gardiner-Garden, M., Harris, J., Blazek, K., Ho, T.W.C., Li,

F.C., Wynick, D., Walker, A.M., and Ormandy, C.J. (2005). Transcriptional changes

underlying the secretory activation phase of mammary gland development. J Mol

Endocrinol 19(7), 1868-1883.

45) Faraldo, M.M., Deugnier, M.A., Tlouzeau, S., Thiery, J.P., and Glukhova, M.A. (2002).

Perturbation of beta 1-integrin mammary gland results in function in involuting

105

premature dedifferentiation of secretory epithelial cells. Mol Biol Cell 13(10), 3521-

3531.

46) Hennighausen, L. and Robinson, G.W. (2005). Information networks in the mammary

gland. Nat Rev Mol Cell Biol 6(9), 715-725.

47) Zhou, J., Chehab, R., Tkalcevic, J., Naylor, M. J., Harris, J., Wilson, T.J., Tsao, S., Tellis,

I., Zavarsek, S., Xu, D., Lapinskas, E. J., Visvader, J., Lindeman, G. J., Thomas, R.,

Ormandy, C. J., Hertzog, P. J., Kola, I., and Pritchard, M. A. (2005). Elf5 is essential for

early embryogenesis and mammary gland development during pregnancy and lactation.

EMBO J 24(3):635-44.

48) Yeon Sook C., Rumela C., Rosalba E. H., and Satrajit S. (2009). Elf5 conditional

knockout mice reveal its role as a master regulator in mammary alveolar development:

failure of Stat5 activation and functional differentiation in absence of Elf5. Dev Biol. (In

Press).

49) Artavanis-Tsakonas, S., Rand, M.D., Lake, R.J. (1999). Notch signaling: cell fate control

and signal integration in development. Science 284( 5415), 770-6.

50) Chiba, S. (2006). Notch signaling in stem cell systems. Stem Cells 24(11), 2437-2447.

51) Gandbarbe, L., Bouissac, J., Rand, M., de Angelis, M.H., Artavanis-Tsakonas, S.,

Mohier, E. (2003). Delta-Notch signaling controls the generation of neurons/glia from

neural stem cells in a stepwise process. Development (130)7, 1391-1402.

52) De Smedt, M., Hoebeke, I., Reynvoet, K., Leclercq, G., Plum, J. (2005). Different

thresholds of Notch signaling bias human precursor cells toward B-, NK-,

monocytic/dendritic-, or T-cell lineage in thymus microenvironment. Blood. (106)10,

3498-3506.

106

53) De Smedt, M., Reynvoet, K., (2002). Active Form of Notch Imposes T Cell Fate in

Human Progenitor Cells. Journal of Immunology. (169)6, 3021-9.

54) Lowell, S., Benchoua, A., Heavey, B., Smith, A.G., and Lovell-Badge, R. (2006). Notch

Promotes Neural Lineage Entry by Pluripotent Embryonic Stem Cells. PLoS Biol 4(5).

55) Callahan, R. and Egan, S.E. (2004). Notch Signaling in Mammary Development and

Oncogenesis. J Mammary Gland Biol Neoplasia 9(2), 145-163.

56) Klinakis, A., Szaboics, M., Politi, K., Kiaris, H., Artavanis-Tsakonas, S., and Efstratiadis,

A. (2006). Myc is a Notch1 transcriptional target and a requisite for Notch1-induced

mammary tumorigenesis in mice. Proc Natl Acad Sci U S A 103(24), 9262-9267.

57) Kiaris, H., Politi, K., Grimm, L.M., Szabolcs, M. Fisher, P., Efstratiadis, A., and

Artavanis-Tsakonas, S. (2004). Modulation of Notch signaling elicits signature tumors

and inhibits Hras1-induced oncogenesis in the mouse mammary epithelium. Am J Pathol

165(2), 695-705.

58) Bouras, T., Pal, B., Vaillant, F., Harburg, G., Asselin-Labat, M.L., Oakes, S.R.,

Lindeman, G.J., and Visvader, J.E. (2008). Notch signaling regulates mammary stem cell

function and luminal cell-fate commitment. Stem Cell 3(4) 429-441.

59) Radtke, F. and Raj, K. (2003). The role of Notch in tumorigenesis: Oncogene or tumour

suppressor? Nat Rev Cancer 3(10), 756-767.

60) Nickoloff, B.J., Osborne, B.A., and Miele, L. (2003). Notch signaling as a therapeutic

target in cancer: a new approach to the development of cell fate modifying agents.

Oncogene 22(42), 6598-6608.

107

61) Weng, A.P., Ferrando, A.A., Lee, W., Morris, J.P., Silverman, L.B., Sanchez-Irizarry, C.,

Blacklow, S.C., Look, T. and Aster, J.C. (2004). Activating Mutations of NOTCH1 in

Human T Cell Acute Lymphoblastic Leukemia. Science 306(5694), 269-271.

62) Gallahan, D. and Callahan, R. (1987). Mammary tumorigenesis in feral mice:

Identification of a new int locus in mouse mammary tumor virus (Czech II)-induced

mammary tumors. J Virol 61(1), 66-74.

63) Robbins, J., Blondel, B.J., Gallahan, D., and Callahan, R. (1992). Mouse mammary-

tumor gene INT-3 A member of the Notch-gene family transforms mammary epithelial-

cells. J Virol 66(4), 2594-2599.

64) Raafat, A., Bargo, S., Anver, M.R., and Callahan, R. (2004). Mammary development and

tumorigenesis in mice expressing a truncated human Notch4/Int3 intracellular domain (h-

Int3sh). Oncogene 23(58), 9401-9407.

65) Gallahan, D., Jhappan, C., Robinson, G., Hennighausen, L., Sharp, R., Kordon, E.,

Callahan, R., Merlino, G., and Smith, G.H. (1996). Expression of a truncated Int3 gene in

developing secretory mammary epithelium specifically retards lobular differentiation

resulting in tumorigenesis. Cancer Res 56(8), 1775-1785.

66) Jhappan, C., Gallahan, D., Stahle, C., Chu, E., Smith, G.H., Merlino, G., and Callahan, R.

(1992). Expression of an activated Notch-related INT-3 transgene interferes with cell-

differentiation and induces neoplastic transformation in mammary and salivary-glands.

Genes Dev 6(3), 345-355.

67) Smith, G.H., Gallahan, D., Diella, F., Jhappan, C., Merlino, G., and Callahan, R. (1995).

Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs

differentiation and functional development. Cell Growth Differ 6(5), 563-577.

108

68) Diévart, A., Beaulieu, N., and Jolicoeur, P. (1999). Involvement of Notch1 in the

development of mouse mammary tumors. Oncogene 18(44), 5973-81.

69) Reedijk, M., Odorcic, S., Chang, L., Zhang, H., Miller, N., McCready, D.R., Lockwood,

G., and Egan, S.E. (2005). High-level coexpression of JAG1 and NOTCH1 is observed in

human breast cancer and is associated with poor overall survival. Cancer Res 65(18),

8530-8537.

70) Stylianou, S., Clarke, R.B., and Brennan, K. (2006). Aberrant activation of Notch

signaling in human breast cancer. Cancer Res 66(3), 1517-1525.

71) Real, P., Tosello, V., Palomero, T., Castillo, M., Hernando, E., De Stanchina, E., Sulis,

M. L., Barnes, K., Sawai, C., Homminga, I., Meijerink, J., Aifantis, I., Basso, G.,

Cordon-Cardo, C., Ai, W., and Ferrando, A. (2009). γ-secretase inhibitors reverse

glucocorticoid resistance in T cell acute lymphoblastic leukemia. Nat Med 15(1), 50-58.

72) Hu, C., Diévart, A., Lupien, M., Calvo, E., Tremblay, G., and Jolicoeur, P. (2006).

Overexpression of activated murine Notch1 and Notch3 in transgenic mice blocks

mammary gland development and induces mammary tumors. Am J Pathol 168(3), 973-

90.

73) Buono, K. D., Robinson, G.W., Martin, C., Shi,, S., Stanley, P., Tanigaki, K., Honjo, T.,

and Hennighausen L. (2006). The canonical Notch/RBP-J signaling pathway controls the

balance of cell lineages in mammary epithelium during pregnancy. Dev Biol 293(2), 565-

80.

74) Welm, B. E., Dijkgraaf, G.J.P., Bledau, A.S., Welm, A.L., and Werb, Z. (2008).

Lentiviral Transduction of Mammary Stem Cells for Analysis of Gene Function during

Development and Cancer. Cell Stem Cell 2(1) 90-102.

109

75) Murtaugh, L.C., Stanger, B.Z., Kwan, K.M., and Melton, D.A. (2003). Notch signaling

controls multiple steps of pancreatic differentiation. Proc Natl Acad Sci USA 100(25),

14920-14925.

76) Srinivas, S., Watanabe, T., Lin, C.S., William, C.M., Tanabe, Y., Jessell, T.M., and

Costantini, F.(2001). Cre reporter strains produced by targeted insertion of EYFP and

ECFP into the ROSA26 locus. BMC Dev Biol 1, 4-4.

77) Wagner K.U., Wall R.J., St-Onge L., Gruss P., Wynshaw-Boris A., Garrett L., Li M.,

Furth P.A., and Hennighausen L. (1997). Cre-mediated gene deletion in the mammary

gland. Nucleic Acids Res 25, 4323–4330.

78) Li, G., Robinson, G.W., Lesche, R., Martinez-Diaz, H., Jiang, Z., Rozengurt, N., Wagner,

K.U., Wu, D.C., Lane, T.F., Liu, X., Hennighausen, L., and Wu, H. (2002). Conditional

loss of PTEN leads to precocious development and neoplasia in the mammary gland.

Development 129, 4159-4170.

79) Andl, T., Ahn, K., Kairo, A., Chu, E.Y., Wine-Lee, L., Reddy, S.T., Croft, N.J., Cebra-

Thomas, J.A., Metzger, D., Chambon, P., Lyons, K.M., Mishina, Y., Seykora, J.T.,

Crenshaw, E.B., Millar, S.E. (2004). Epithelial Bmpr1a regulates differentiation and

proliferation in postnatal hair follicles and is essential for tooth development.

Development 131(10), 2257-2268.

80) Stanger, B.Z., Datar, R., Murtaugh, L.C., and Melton, D.A. (2005). Direct regulation of

intestinal fate BY Notch. Proc Natl Acad Sci USA 102(35), 12443-12448.

81) Guseh, J.S., Bores, S.A., Stanger, B.Z., Zhou, Q., Anderson, W.J., Melton, D.A., and

Rajagopal, J. (2009). Notch signaling promotes airway mucous metaplasia and inhibits

alveolar development. Development 136, 1751-1759.

110

82) Wagner, K.U., McAllister, K., Ward, T., Davis, B., Wiseman, R., and Hennighausen, L.

(2001). Spatial and temporal expression of the Cre gene under control of the MMTV-

LTR in different lines of transgenic mice. Transgenic research 10, 545-553.

83) Tun, T., Hamaguchi, Y., Matsunami, N., Furukawa, T., Honjo, T., and Kawaichi, M.

(1994). Recognition sequence of a highly conserved DNA binding protein RBP-Jx.

Nucleic Acids Res 22(6), 965-971.

84) Jattiault, S., Brou, C., Logeat, F., Schroeter, E.H., Kopan, R., and Israel, A. (1995).

Signalling downstream of activated mammalian Notch. Nature 377, 355–358.

85) MacNeill, K.N., Riddell, R.H., and Ghazarian, D. (2005). Perianal apocrine

adenocarcinoma arising in a benign apocrine adenoma; first case report and review of the

literature. J Clin Pathol 58(2), 217–219.

86) Pitelka, D.R., Hamamoto, S.T., Duafala, J.G., and Nemanic, M.K. (1973). Cell contacts

in the mouse mammary gland I. Normal gland in postnatal development and secretory

cycle. J Cell Biol 56, 797-818.

87) Morroni, M., Giordano, A., Zingaretti, M.C., Boiani, R., De Matteis, R., Kahn, B.B.,

Nisoli, E., Tonello, C., Pisoschi, C., Luchetti, M.M., Marelli, M., Cinti, S. (2004).

Reversible transdifferentiation of secretory epithelial cells into adipocytes in the

mammary gland. Proc Natl Acad Sci USA 101(48), 16801-16806.

88) Baker, T.P., Lenert, J.T., Parker, J., Kemp, B., Kushwaha, A., Evans, G., and Hunt, K.K.

(2001). Lactating Adenoma: A diagnosis of exclusion. Breast J 7(5), 354-357.

89) Lethaby, A.E., O’Neill, M.A., Mason, B.H., Holdaway, I.M., and Harvey, V.J. (1996).

Overall survival from breast cancer in women pregnant or lactating at or after diagnosis.

Int J Cancer 67, 751–755.

111

90) Sumkin, J.H., Perrone, A.M., Harris, K.M., Nath, M.E., Amortegui, A.J., Weinstein, B.J.

(1998). Lactating adenoma: US Features and Literature Review. Radiology 206, 271-274.

91) Wallack, C.K., Wolf, J.A., Denes, A.E., Glasgow, G., and Kumar, B. (1983). Gestational

carcinoma of the female breast. Curr Probl Cancer 7,1–58.

92) Farmer, P., Bonnefoi, H., Becette, V., Tubiana-Hulin, M., Fumoleau, P., Larsimont, D.,

MacGrogan, G., Bergh, J., Cameron, D., Goldstein, D., Duss, S., Nicoulaz, A.L., Brisken,

C., Fiche, M., Delorenzi, M., and Iggo, R. (2005). Identification of molecular apocrine

breast tumours by microarray analysis. Oncogene 24, 4660-4671.