DNA Technology Lect 5

8/12/2019 DNA Technology Lect 5

1/19

Finishing replication

Completion of DNA replication requires a set of specific events.

These events are different for circular versus linear chromosomes.

For a circular chromosome, the conventional replication machinery

can replicate the entire molecule, but the resulting daughters aretopologically linked to one another.

Type II DNA topoisomerass are required to separate (or decatenate)

daughter DNA molecules.


2/19

Topoisomerase II catalyzes the decatenation of replication products


3/19

Replication of the very ends of linear chromosomes cannot be completed

by the replication machinery we have discussed so far.

The requirement for an RNA primer to initiate all new DNA synthesis

creates a dilemma of the ends of linear chromosomes, called the

end replication problem.

Prokaryotic cells use a protein priming protein instead of RNA primers,the protein provides the priming 3OH to initiate DNA synthesis.

Eukaryotic cells use the enzyme, telomeraseto replicate their

chromosome ends (telomeres).

Telomerase is a polymerase acts to extend the 3 end of its substrate.


4/19

The end replication problem


5/19

DNA ligase

As each newly formed segment of the lagging strand approaches

the 5end of the adjacent Okazaki fragment (the one just completed),

DNA polymerase I takes over.

The DNA polymerase I has two functions:

1- The 5 3 exonuclease activity of this enzyme removesthe RNA primer of the adjacent fragment.

2- Fills the gap between the DNA fragments.

Finally DNA ligase joins the DNA fragments by the formation of Enz-AMPComplex which binds to the 5 phosphate of one fragment activating it, so

It is susceptible to 3 OH attack to form a phosphodiester linkage.

Thus, the two DNA fragments are ligated into one fragment.


6/19


7/19

Mode of action of DNA ligase


8/19


9/19

Mutation: a change in the genetic material (ie. DNA).

Let's further define mutation as a heritable change in the genetic

material.

This point becomes important in multicellular organisms where we

must distinguish between changes in gametes (germline mutations)

and changes in body cells (somatic mutations).

Definition of mutation


10/19

Types of Mutations

A. Base pair (nucleotide pair) substitutions

These are of two types:

1- Transitions(purine to purine or pyrimidine to pyrimidine)

2- Transversions(purine to pyrimidine or pyrimidine to purine).

The two categories because they can occur in different ways.


11/19

B. Frameshift mutationsThese result from the insertion or deletion of one or more

nucleotides in the coding region of a gene.

This causes an alteration of the reading frame: since codons are

groups of three nucleotides, there are three possible reading frames foreach gene although only one is used.

eg. mRNA with sequence AUGCAGAUAAACGCUGCAUAA

amino acid sequence from the first reading frame: metglnileasnala

alastop

The second reading frame gives: cys arg stop


12/19

Origins of spontaneous mutation

A spontaneous mutation is one that occurs as a result of natural

processes in cells.

Induced mutations; those that occur as a result of interaction of

DNA with an outside agent or mutagen.

. Some so-called "spontaneous mutations" probably are the result

of naturally occurring mutagens in the environment; nevertheless

there are others that definitely arise spontaneously, for example,DNA replication errors.


13/19


14/19

A mutation can be permanently incorporated

by replication


15/19

Base alterations and base damage

The bases of DNA are subject to spontaneous structural alterations

called tautomerization.

If during DNA replication, G is in the enol form, the polymerase will add a

T across from it instead of the normal C because the base pairing rules

are changed (not a polymerase error).

The result is a G :C to A :T transition; tautomerization causes transition

mutations only.


16/19

Another mutatgenic process occurring in cells is spontaneous base

degradation. Thedeamination of cytosine to uracil happens at a

significant rate in cells.

Deamination can be repaired by a specific repair process which detects

uracil, not normally present in DNA; otherwise the U will cause A to be

inserted opposite it and cause a C:G to T:A transition when the DNA is

replicated.

Deamination of cytosine creates uracil


17/19

Deamination of methylcytosine to thymine can also occur.

Methylcytosine occurs in the human genome at a sequence

which is normally avoided in the coding regions of genes.

If the meC is deaminated to T, there is no repair system which

can recognize and remove it (because T is a normal base in DNA).

This means that wherever the sequence containing meC occurs

in genes it is a "hot spot" for mutation.

Deamination of 5-methyl cytosine creates thymine


18/19

DNA is damaged by alkylation, oxidation, and radiation

In alkylation, methyl or ethyl groups are transferred to reactive sites

On the bases and to phosphates in the DNA backbone.

Alkylating chemicals include nitrosamines and N-methyl-N-nitro-N-

Nitrosoguanidine.

Example: is the formation of O6-methylguanine, often mispairs with thymine,

resulting in the change of a G:C to A:T when damaged DNA is replicated

Specific sites on guaninethat can be damaged byalkylation, oxidation orradiation


19/19

Ultraviolet induces the formation of a cyclobutanering between adjacent thymines

Documents

DNA Technology Lect 5