DNA Technology

Genetic Engineering

DNA TechnologyDNA Technology – science involved

in the ability to manipulate genes/DNA

Purpose:◦Cure disease (Cystic Fibrosis)◦Treat genetic disorders (Hemophilia, diabetes)

◦Improve food crops (better tasting, longer shelf life, fungus resistance…)

◦Improve human life in general◦Helps us ID genes for traits

I. How could you get a desired trait without directly manipulating the organisms’ DNA?

A. Selective Breeding - choosing organisms with

desired traits to produce the next generation

Breeding the winners of a horse race (Smarty Jones)

Taking the seeds from the Great Pumpkin

B. Hybridization Crossing organisms with different

traits to produce a hardier productEx. A mule is a cross of a horse and a donkey – Sturdy and surefooted

Hybrid corn – tastes good and is more resistant to disease.

C. Inbreeding

Maintaining the present genes by breeding only within the population

Ex. Pedigree animalsRisk with dipping into the same gene

pool and recessive traits showingup that may be lethal or harmful.

D. Inducing mutations

By using known mutagens, attempt to force mutations to occur

Radiation & ChemicalsNot a sure bet nor do you know what

you are going to getPolyploidy (3N or 4N) plants have

resulted from this – larger & hardier

II. Manipulating Genes by altering an organisms DNA

DNA Technology PurposeCure DiseasesTreat Genetic DisorderImprove Food CropImprove Human Life (reproduce

desired traits)

III. Practical Uses of DNA Technology (positive)

Pharmacutical ProductsGenetically engineered vaccineIncreasing Agricultural Yields

(negative)AllergiesGMO (genetically Modified

Organisms)Supperweeds

CloningGrowing a population of genetically identical

cells from a single cell

Let’s discuss the positives and negatives of m cloning…..

Let’s do a little research first……

Lab Bio: Read Pros and Cons of CloningHonors Bio: Read The Real Face of Cloning

DNA Technology: ex: Gene Therapy Treatment of a genetic disorder (like

cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.

Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary

Has not been proven to be successful in the long term

How do we copy a piece of DNA…..The Tools:

DNA Extraction – Chemical procedure (we’ll do this)

Restriction enzymes – molecular scissors that cut DNA at specific nucleotide sequences

Gel Electrophoresis – method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve)

DNA Ligase – molecular glue that puts pieces of DNA together

Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do?

Inject insulin of course but from what source?

Old method was to use sheep insulin. Costly and labor intensive

New method: Let bacteria with a human insulin producing gene make it for you

The Method: Transformation of a bacterium to produce human insulin1. Extract the insulin producing gene from a healthy human

2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA

What are restriction enzymes? Bacterial enzymes – used to cut

bacteriophage DNA (viruses that invade bacteria).

Different bacterial strains express different restriction enzymes

Restriction enzymes recognize a specific short nucleotide sequence

For example, Eco RI recognizes the sequence:

5’ - G A A T T C - 3’ 3’ - C T T A A G - 5’

Pandindrones same base pairing forward and backwards

Let’s try some cutting:

Using this piece of DNA, cut it with Eco RI G/AATTC

GACCGAATTCAGTTAATTCGAATTC CTGGCTTAAGTCAATTAAGCTTAAG

GACCG/AATTCAGTTAATTCG/AATTC CTGGCTTAA/GTCAATTAAGCTTAA/G

What results is:

GACCG AATTCAGTTAATTCG AATTCCTGGCTTAA GTCAATTAAGCTTAA G

Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

Blunt & Sticky ends

Sticky ends – Creates an overhang. EcoRI

Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

Cloning Vectors

Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another.

Many bacteria contain a cloning vector called a PLASMID.

PLASMID is a ring of DNA found in a bacterium in addition to its main chromosome

3. Cut cloning vector: Use bacterial plasmids

◦Plasmids will be cut with the same restriction enzyme used to cut the desired gene

4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue.

Recombinant DNA - DNA with new piece of genetic information on it

5. Plasmid is then returned to bacterium and reproduces with donor gene in it.

Transgenic organism – organism with foreign DNA incorporated in its genome (genes)

6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

Recombinant DNA Donor Gene

Expression of Cloned Genes

Sometimes PROMOTERS must also be transferred so the genes will be turned on.

Genes are often turned off until the proteins they code for are needed.