Gene 559 (2015) 86–93

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

DNA barcoding for species identification from dried and powdered plantparts: A case study with authentication of the raw drug market samplesof Sida cordifolia

Sophie Lorraine Vassou a, G. Kusuma b, Madasamy Parani a,⁎a Department of Genetic Engineering, Center for DNA Barcoding, School of Bioengineering, SRM University, Kattankulathur 603203, Indiab Pharmacy Department, Captain SrinivasaMurti Research Institute for Ayurveda and Siddha DrugDevelopment (CSMRIASDD), Under Central Council for Research in Ayurvedic Sciences (CCRAS),Department of AYUSH, Ministry of Health and Family Welfare, Government of India, Anna Hospital Campus, Arumbakkam, Chennai 600106, India

Abbreviations: rbcL, ribulose-bisphosphate carboxylastrnH,intergenicspacer; ITS2, internaltranscribedspacer2;Cbromide; EDTA, ethylene diamine tetraacetic acid; PCR, pnational center for biotechnology information; BOLD, barc⁎ Corresponding author.

E-mail address: parani.m@ktr.srmuniv.ac.in (M. Paran

http://dx.doi.org/10.1016/j.gene.2015.01.0250378-1119/© 2015 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 2 October 2014Received in revised form 9 January 2015Accepted 11 January 2015Available online 14 January 2015

Keywords:DNA barcodingSidaRaw drugspsbA-trnHITS2

The majority of the plant materials used in herbal medicine is procured from the markets in the form of dried orpowdered plant parts. It is essential to use authentic plant materials to derive the benefits of herbal medicine.However, establishing the identity of these plant materials by conventional taxonomy is extremely difficult.Here we report a case study in which the species identification of the market samples of Sida cordifolia wasdone by DNA barcoding. As a prelude to species identification by DNA barcoding, 13 species of Sidawere collect-ed, and a reference DNA barcode library was developed using rbcL,matK, psbA-trnH and ITS2markers. Based onthe intra-species and inter-species divergence observed, psbA-trnH and ITS2 were found to be the best two-marker combination for species identification of the market samples. The study showed that none of the marketsamples belonged to the authentic species, S. cordifolia. Seventy-six per cent of the market samples belonged toother species of Sida. The predominant onewas Sida acuta (36%) followed by S. spinosa (20%), S. alnifolia (12%), S.scabrida (4%) and S. ravii (4%). Such substitutions may not only fail to give the expected therapeutic effect, butmay also give undesirable effects as in case of S. acuta which contains a 6-fold higher amount ofephedrine compared to the roots of S. cordifolia. The remaining 24% of the samples were from other generasuch as Abutilon sp. (8%), Ixonanthes sp., Terminalia sp., Fagonia sp., and Tephrosia sp. (4% each). This obser-vation is in contrast to the belief that medicinal plants are generally substituted or adulterated with closelyrelated species. The current study strongly suggests that the raw drug market samples of herbal medicinesneed to be properly authenticated before use, and DNA barcoding has been found to be suitable for thispurpose.

© 2015 Elsevier B.V. All rights reserved.

1. Introduction

The cost of healthcare using modern medicines is ever increasing.Apart from this, the awareness and knowledge about the side effectsof modernmedicines, especially in case of treatment against chronic ill-nesses, is on the rise (Balch, 2002). As a result, people are increasinglyembracing the less expensive herbal remedies that have been themain-stay in the past. Herbal remedies enjoy the confidence of billions of peo-ple due to their presence and practice over many centuries. Theworldwide resurgence in the use of herbal remedies is evident by thehuge increase in the demand for herbal products, which stood at $

e gene;matK,maturase K; psbA-TAB,cetyltrimethylammoniumolymerase chain reaction; NCBI,ode of life.

i).

120 billion in 2013, and is expected to reach $ 7 trillion by 2050 (Nation-al Medicinal Plants Board, Government of India) (http://nmpb.nic.in/).

Due to deforestation, urbanization, over-exploitation, loss of biodi-versity habitats, etc., the existence, distribution, and availability of herb-al plants are vastly different now when compared to the past in whichherbal remedieswere developed. Complete absence or extreme scarcityof the authentic herbal plant species on a local or global scale is verycommon. This leads to the demand-supply crisis resulting in unjustifiedsubstitutions in the absence of effective regulation, quality control orstandardization of herbal products. In fact, this is the major challengeto the attempts aimed at the integration of the herbal remedies intothe mainstream healthcare services (Niraj et al., 2002). The WorldHealth Organization has emphasized the need to ensure the quality ofmedicinal plant products by using modern control techniques and ap-plying suitable standards (WHO, 1998). Using taxonomically correctplants is critical to the safety and efficacy of herbal medicine (WHO,2004). Rather than own collections, the present day practitioners ofherbal medicines use the herbal products purchased from the markets.

Fig. 1. Case study of themarket samples of S. cordifolia in India. The red dot denotes the place of collection and the yellow shading represents the state fromwhich it was procured. The 25market samples were collected from Tamil Nadu to Himachal Pradesh as well as Gujarat to Assam covering 13 States (provinces) in India.

Table 1Details about the species of Sida that were collected for the study.

Sl no. Name of the species Voucher ID No. of accessions Places of collection BOLD accession no.

1 Sida acuta B0266A, B, C 3 Ernakulam District, Kerala SRM000601A, B, C2 Sida alnifolia B0983A, B, C 3 Thrissur District, Kerala SRM000602A, B, C3 Sida beddomei B0982A, B 2 Ernakulam District, Kerala SRM000603A, B4 Sida cordata B0380A, B, C 3 Ernakulam District, Kerala SRM000604A, B, C5 Sida cordifolia B0147A, B, C 3 Ernakulam District, Kerala SRM000605A, B, C6 Sida fryxellii B0980A, B, C 3 Kozhikode District, Kerala SRM000606A, B, C7 Sida linifolia B0979A, B, C 3 Ernakulam District, Kerala SRM000607A, B, C8 Sida ravii B0984A, B, C 3 Palakkad District, Kerala SRM000608A, B, C9 Sida rhombifolia B0052A, B, C 3 Calicut, Kerala SRM000609A, B, C10 Sida rhomboidea B0578A, B, C 3 Thrissur District, Kerala SRM000610A, B, C11 Sida scabrida B0981A, B 2 Thrissur District, Kerala SRM000611A, B12 Sida spinosa B0850A, B 2 Ernakulam District, Kerala SRM000612A, B13 Sida tiagii B0989A, B, C 3 Sikar District, Rajasthan SRM000613A, B, C

87S.L. Vassou et al. / Gene 559 (2015) 86–93

Table 3Inter-species divergence between the 13 species of Sida.

Sl no. DNA marker(s) Divergence (%)

1 rbcL 0.0–1.802 matK 0.0–3.003 psbA-trnH 0.0–6.804 ITS2 0.4–9.605 rbcL + matK 0.0–4.206 rbcL + psbA-trnH 0.0–7.507 rbcL + ITS2 0.4–10.908 matK + psbA-trnH 0.1–9.609 matK + ITS2 0.4–11.6010 psbA-trnH + ITS2 0.6–15.30

Table 2Details of the market samples of S. cordifolia collected from different states in India.

Sl no. Sample ID Form of the raw drug Place of collection State (province) of collection Language used for collection Vernacular names used for collection

1 ASS1 Whole Plant Sonitpur Assam Assamese Bariala2 CHE1 Roots Chennai Tamil Nadu Tamil Kurunthotti ver, Chittamutthi ver3 CHE2 Leaves Chennai Tamil Nadu Tamil Kurunthotti ver, Chittamutthi ver4 CHE3 Roots Chrompet Tamil Nadu Tamil Kurunthotti ver, Chittamutthi ver5 DEL1 Powder Khari Baoli Delhi Sanskrit Bala6 DEL2 Stems Chandni Chowk Delhi Sanskrit Bala7 GUJ Whole Plant Ahmedabad Gujarat Gujarati Jangli Methi8 HIM Leaves Paprola Kangra Himachal Pradesh Hindi, Bengali Bariyar, Barela9 KAN1 Whole Plant Kanpur Uttar Pradesh Hindi Kangi10 KAR1 Roots Belgaum Karnataka Kannada Kadeeru, Hithuthi11 KAR2 Stems Belgaum Karnataka Kannada Kadeeru, Hithuthi12 KER1 Roots Paravur Kerala Malayalam Kurunthotti13 KER2 Roots Thrissur Kerala Malayalam Kurunthotti14 KER3 Roots Peechi Kerala Malayalam Kurunthotti15 KOL1 Whole Plant Kolkata West Bengal Bengali Shwet Berela16 KOL2 Whole Plant Kolkata West Bengal Bengali Shwet Berela17 KUM1 Stem Kumbakonam Tamil Nadu Tamil Nilatutti, Chitaamuttie18 MAD1 Powder Bhopal Madhya Pradesh Hindi Bariara19 MAD2 Powder Bhopal Madhya Pradesh Hindi Bariara20 MUM1 Whole Plant Mumbai Maharashtra Sanskrit, Marathi Bala, Chikana21 PAT1 Seeds Patna Bihar Bihari Choti Kangi22 PON1 Stems Puducherry Puducherry Tamil Chitaamuttie23 PUN1 Powder Pune Maharashtra Sanskrit, Marathi Bala, Chikana24 TRI1 Roots Trichy Tamil Nadu Tamil Nilatutti25 TRI2 Roots Trichy Tamil Nadu Tamil Nilatutti

88 S.L. Vassou et al. / Gene 559 (2015) 86–93

However taxonomic identification of the plants at the species levelfrom the market samples that are traded in the form of dried plantparts and powders is extremely difficult. Hence we have used DNAbarcoding to identify the dried leaves, stems, roots, whole plants,seeds as well as powdered market samples of Sida cordifolia (Indiancountry mallow) at the species level. ‘Bala’, meaning strength, isthe vernacular name for S. cordifolia in Ayurveda and the Ayurvedicformulary of India (Anonymous, 2003; Sharma, 2011), and it is animportant medicinal plant in herbal medicine. The roots of “Bala”are used for strengthening the central nervous system and treatingneurological disorders such as hemiplegia, facial paralysis, sciatica,emaciation, cervical spondylosis, neuralgia, and neurosis (Koman,1921). It is also a chief ingredient in several important Ayurvedicpreparations like Ksirabala, Dhanvantaram, Balaristam, and RasnadiKasayam which are used as nervine tonic (Sivarajan and Balachandran,1994).

Our preliminary market survey in India revealed that S. cordifoliais traded in different forms, even though only the roots of the plantare to be used for its medicinal value. Nair (2004) and Sharma(2011) have listed S. cordifolia as a controversial ayurvedic drugprone to adulteration. The market samples that we have collectedwere morphologically different, but identification at a special levelwas difficult because the key taxonomic characters were not intactwith the dried or powdered samples. Even with intact specimens,Sida is a taxonomically difficult genus, and typification has been amatter of confusion (Sivarajan and Pradeep, 1996). This underscoredthe importance of DNA barcoding for the species level identificationof the market samples.

There is no single universal DNA barcodemarker for plants, and eachmarker has its own advantages and disadvantages. The Consortium forthe Barcoding of Life (CBOL) has recommended rbcL and matK as coremarkers, which may be supplemented with psbA-trnH and ITS for DNAbarcoding of plants (CBOL, 2009). The rbcLmarker is well characterized,although it is not the most variable one. The matK marker is a rapidlyevolving plastid coding region and shows high levels of discriminationin angiosperm species. These two markers are frequently used inmulti-locus combinations for species discrimination (Burgess et al.,2011). The non-coding chloroplast psbA-trnH marker was reported todifferentiate equally well in combination with core markers. Kress and

Erickson (2007) have recommended rbcL and psbA-trnH as an efficienttwo-marker combination for DNA barcoding of land plants. The psbA-trnH marker itself was very efficient in barcode recovery and speciesdiscrimination in many plant groups including Ericaceae, Fabaceaeand Cassia (Gao et al., 2010; Liu et al., 2012; Chen et al., 2014;Purushothaman et al., 2014). The use of ITS2 marker for large scaleDNA barcoding was first reported by Chen et al. (2010), and it is fastemerging as a core DNA barcode marker (Gu et al., 2013; Li et al.,2013). We have evaluated all the four markers (rbcL, matK, psbA-trnH,and ITS2) in Sida to find a best marker or combination of markers forspecies level identification.

There are 19 species of Sida reported from India (Gamble, 1935; Nairand Henry, 1983; Sharma and Sanjappa, 1993; Sivadasan and Kumar,1996; Sivarajan and Pradeep, 1996). Six of them have very limited dis-tribution in South India, and hence unlikely to be present in the rawdrug markets (personal communication Dr. A. K. Pradeep, Departmentof Botany, University of Calicut, Kerala, India). Therefore, accessionsfrom the remaining 13 species of Sida were collected, and DNAbarcoded using rbcL, matK, psbA-trnH and ITS2 in order to generate areference DNA barcode library for this genus. Subsequently, this librarywas used for species level authentication of the market samples ofS. cordifolia using a two-marker combination of psbA-trnH and ITS2.Samples that did not match with any species in the reference DNA

89S.L. Vassou et al. / Gene 559 (2015) 86–93

barcode library were DNA barcoded using the rbcL marker for genuslevel identification.

2. Materials and methods

2.1. Ethics statement

The Sida species areweedswhich are found onwaste lands and roadsides, and therefore, no special permits were required for the samplecollection.

Fig. 2. Phylogenic trees constructed for the species of Sida. Neighbour-Joining (NJ) method wasand (d) ITS2 markers.

2.2. Collection of Sida species

Thirty six accessions from 13 species of Sida were collected fromdifferent parts of India. A small twig from each accession was collect-ed for DNA isolation and herbarium preparation. Names of thespecies and the places of collection are given in Table 1. The plantspecimens were taxonomically identified by Dr. A.K. Pradeep(University of Calicut, Kerala), Dr. C.N. Sunil (S.N.M College, Kerala),Dr. N. Anil Kumar (M. S. Swaminathan Research Foundation, Kerala),and Ashok Kumar Datusalia (National Institute of Pharmacologyand Toxicology Punjab). The voucher samples were mounted on

used for the construction using the nucleotide data from (a) rbcL, (b)matK, (c) psbA-trnH,

Fig. 3. Combinational phylogenic tree constructed for the species of Sida. Neighbour-Joining (NJ) method was used for the construction using nucleotide data from psbA-trnHand ITS2 markers.

90 S.L. Vassou et al. / Gene 559 (2015) 86–93

herbarium sheets which were deposited with the SRM UniversityHerbarium.

2.3. Collection of the market samples of S. cordifolia

“Bala” or its equivalent vernacular name(s) in local language spokenin the place of collection were used for the collection of the samples ofS. cordifolia from local raw drug markets. The raw drugs were directlybought from the traders by referring to specific vernacular names.About 100 g of the raw drug samples were purchased from 25 traderscovering 13 states (provinces) of India for this survey (Fig. 1). The pur-pose of sample collection was not revealed to the traders in order to getthe same samples being sold to the common man. Places of collection,the form of the raw drug, the local language, and the vernacularnames used for collection are given in Table 2.

2.4. Genomic DNA extraction, PCR amplification and DNA sequencing

Genomic DNA from 100 mg of fresh plant samples and 30 mg ofraw drug market samples were isolated using cetyl trimethyl ammo-nium bromide (CTAB) method with minor modifications (Doyle andDoyle, 1987). The samples were ground with liquid nitrogen andthoroughly suspended in 500 μL of CTAB buffer (100 mM TrispH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl and 2% CTAB) containing2% β-mercaptoethanol and 2% polyvinylpyrrolidone (PVP). The sus-pension was incubated at 55 °C for 30 min. After cooling to roomtemperature, 500 μL of chloroform was added, mixed well, and centri-fuged at 10,000 rpm for 10 min. The aqueous phase was transferred tofresh tubes, and an equal volume of ice-cold isopropanol was added toprecipitate the DNA. The samples were centrifuged at 10,000 rpm for10min immediately or after 1 h of incubation at−20 °C (if DNA threadswere not seen). The pellet was washed twice with 70% ethanol, airdried, and dissolved in 100 μL of 10 mM Tris–HCl (pH 8.0). The DNAwas checked on 0.8% agarose gel, and quantified.

The primers used for PCR amplification of the barcode markersinclude rbcL: rbcLaF (ATGTCACCACAAACAGAGACTAAAGC), rbcLajf634R(GAAACGGTCTCTCCAACGCAT) (Kress et al., 2005, Fazekas et al., 2008),matK : 3F_KIM (CGTACAGTACTTTTGTGTTTACGAG), 1R_KIM (ACCCAGTCCATCTGGAAATCTTGGTTC) (Ki-Joong Kim, School of Life Sciencesand Biotechnology, Korea University, Korea, unpublished), psbA-trnH:psbA3'f (GTTATGCATGAACGTAATGCTC), trnHf (CGCGCATGGTGGATTCACAATCC) (Kress et al., 2005) and ITS2: S2F (ATGCGATACTTGGTGTGAAT), S3R (GACGCTTCTCCAGACTACAAT) (Chen et al., 2010). The primerswere synthesized by Bioserve India Pvt Ltd, India. Polymerase chainreaction (30 μL) was performed in a thermal cycler (Eppendorf,Germany). The reaction mixture consisted of 20–50 ng of genomicDNA, 1× PCR Buffer, 200 μM dNTPs, 5 pmol primers and 1.0 U of TaqDNA polymerase (Genet Bio., Korea). Amplification involved initial de-naturation at 95 °C for 5 min followed by 35 cycles of denaturation at95 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for1 min, with a final extension at 72 °C for 5 min. The amplicons werechecked on 1% agarose gels, and purified using EZ-10 Spin ColumnPCR Purification Kit (Bio Basic Inc. Ontario, Canada). Samples weresequenced using 3130xl Genetic analyzer (Applied Biosystems, CA,USA). The sequences were manually edited using Sequence ScannerSoftware v1.0 (Applied Biosystems, CA, USA), and full length sequenceswere assembled using a local alignment algorithm CodonCode Aligner,version 4.2.4 (CodonCode Corporation).

2.5. Data analysis

Intra and inter-species pairwise divergences were calculated byusing the TaxonDNA v. 1.6.2 software (Meier et al., 2006). Geneticdistances were calculated by Kimura 2-Parameter (K2P) distancemodel (Kimura, 1980). Phylogenetic trees based on Neighbour-Joining(NJ) method were constructed using MEGA version 5.1 (Tamura et al.,

2011). The difference between intra and inter-species divergencewere calculated as barcoding gap (Meyer and Paulay, 2005).Bootstrapping was done with 1000 replications. BLAST analysis wasdone using the nucleotide database at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and BOLD database (http://www.boldsystems.org/index.php/databases). The market samples of S. cordifoliawere first analyzedby sequencing the psbA-trnH and ITS2 markers. The data from the twomarkers were queried with the reference barcode library and speciesidentities were established through the best match method (Meieret al., 2006). Unmatched samples were re-analyzed by sequencing therbcL marker (besides the psbA-trnH and ITS2 markers which werealready done), and by BLAST searching against the NCBI nucleotidedatabase and BOLD database.

3. Results and discussion

The NCBI and BOLD Systems databases contain only 14 DNAbarcode sequences representing 6 species of Sida reported from India.We have generated 144 reference DNA barcode sequences for 13species of Sida, in addition to the 50 barcode sequences generatedfrom 25 market samples. The barcode sequences derived from theplants with a voucher specimen were used as the reference barcodelibrary to authenticate the market samples. Hence, the present studyrepresents the first comprehensive molecular marker based study forthe genus Sida in India. DNA barcoding mainly depends on the successrate of PCR amplification and DNA sequencing. Although the plant sam-ples contained polysaccharides and other secondary metabolites, PCRamplification and bidirectional sequencing of rbcL, matK, psbA-trnHand ITS2 barcodemarkerswere successful with all the 36 accessions col-lected. As expected, there was no size variation in rbcL marker (607 bp,GC 43.82–44.48%). However, there was a different range of length vari-ations inmatK (828–843 bp, GC 33.45–34.78%), psbA-trnH (379–484 bp,GC 23.45–26.35%), and ITS2 (454–456 bp, GC 55.48–57.46%) markers.BLAST search in NCBI and BOLD Systems databases recovered the ex-pected species (only in case of the 6 species that are represented in

91S.L. Vassou et al. / Gene 559 (2015) 86–93

these databases) providing the first line of validation for the sequencesin the reference barcode library. DNA barcode sequences alongwith original trace files were submitted to BOLD Systems under theaccession numbers SRM000601A to SRM000613A.

Fig. 4. Raw drugs of S. cordifolia that were collected from the market

Intra-species divergence in the 13 species of Sida ranged between0.0 and 0.5%. Inter-species divergence was found to be the highestwith ITS2 (9.6%) followed by psbA-trnH, matK and rbcL (Table 3).Barcoding gap was also found to be the highest with ITS2 (0.0 to 4.8%)

s. Refer to Table 2 for the details of the samples marked 1 to 25.

Table 4Species identification of the market samples of S. cordifolia.

Sl no. Sample ID Divergence (%) Species identified by DNA barcoding

1 ASS1 0 Sida ravii2 CHE1 0 Sida acuta3 CHE2 0 Sida acuta4 CHE3 0 Sida acuta5 DEL1 0 Sida spinosa6 GUJ 0 Sida spinosa7 HIM 0 Sida spinosa8 KAR1 0 Sida acuta9 KAR2 0 Sida acuta10 KER1 0 Sida scabrida11 KER2 0 Sida alnifolia12 KER3 0 Sida alnifolia13 KOL1 0 Sida acuta14 KOL2 0 Sida acuta15 MAD2 0 Sida alnifolia16 MUM1 0 Sida spinosa17 TRI1 0 Sida acuta18 TRI2 0 Sida spinosa19 PON1 0.2 Sida acuta20 DEL2 60 Abutilon sp.21 PAT1 60 Abutilon sp.22 MAD1 70 Fagonia sp.23 KAN1 73 Tephrosia sp.24 PUN1 73 Ixonanthes sp.25 KUM1 77 Terminalia sp.

Divergence cut-off for species identification set at 0.6%.

92 S.L. Vassou et al. / Gene 559 (2015) 86–93

followed by psbA-trnH (0.0 to 2.5%),matK (0.0 to 2.1%), and rbcL (0.0 to0.3%). The psbA-trnHmarker differentiated all the species pairs except S.cordata and S. beddomei. The ITS2markerwas able to differentiate all thespecies pairs but inter-species divergence between S. cordifolia and S.fryxellii was less than intra-species divergence. Therefore, in order todifferentiate all the species pairs, inter-species divergence was deter-mined with the two-marker combinations. It was found to be thehighest with psbA-trnH + ITS2 combination followed by matK + ITS2,rbcL + ITS2, psbA-trnH + matK, rbcL + psbA-trnH and rbcL + matK.The psbA-trnH + ITS2 combination differentiated all the species ofSida with inter-species divergence ranging between 0.6 and 15.3%. Thelowest divergence was observed between S. cordifolia and S. fryxellii ofsection Cordifoliae Borss.

Phylogenic trees were constructed by using the data from individualmarkers (Fig. 2) and two-marker combinations. In the phylogenic treesthatwere constructedwith singlemarkers, the two non-codingmarkerspsbA-trnH and ITS2 showed better species resolution than the codingmarkers. It is seen from Fig. 2c and Fig. 2d, that these two markerswere complementary to each other in species resolution. The speciesthat were not resolved by psbA-trnH were found to be resolved byITS2, and vice versa. This complementary nature was reflected in thephylogenic tree that was constructed for the psbA-trnH + ITS2 two-marker combination, and all the species of Sida were clearly resolvedby this combination (Fig. 3). Therefore, psbA-trnH + ITS2 marker com-bination was used for the DNA barcoding of the market samples ofS. cordifolia.

We have collected themarket samples fromTamil Nadu in the Southto Himachal Pradesh in the North as well as Gujarat in the West toAssam in the East covering 13 States of India. Roots of S. cordifolia arethe chief component to be used for the treatment of neurological disor-ders. However, themarket samples of S. cordifolia included dried leaves,stems, roots, whole plants, seeds and powders (Fig. 4).

Unlike fresh samples, isolation of genomic DNA from dried plantparts and powders that are suitable for PCR can be challenging due tothe degradation of DNA and the presence of unknown PCR inhibitors.Though the quality of DNA as determined from OD260/280 ratio and aga-rose gel electrophoresis was variable, PCR amplification was successfulwith all the market samples after standardization of DNA quantity. Ingeneral, re-amplification of failed samples by using the lowest amount

of template DNA was successful, probably due to dilution of PCR inhib-itors. Since there are no mixed peaks occurring in DNA sequencing, itmeans that all the market samples are single species. As a result, thesesamples could be DNA barcoded directly without resorting to cloningof PCR products or amplification of species-specific markers.

The sequences obtained from psbA-trnH and ITS2 markers for themarket samples were analyzed by the best match method for speciesidentification (Table 4). Considering the intra-species and inter-species divergence for the Sida species in the reference barcode library,0.6% divergence cut-off was empirically sent to identify themarket sam-ples at the species level. Nineteen out of the 25 samples were identifiedat the species level, and none of them belonged to the authenticS. cordifolia. As against the authentic species S. cordifolia, DNA barcodingrevealed that majority of the market samples were from S. acuta and S.spinosa, together accounting for 56% of the samples. The reason for sucha prolific substitution may be the abundance of these species asaggressiveweeds throughout the range of distribution of Sida. S. alnifoliaand S. scabrida were found among the market samples from Kerala.S. alnifolia was reported to be used in place of S. cordifolia in Kerala(Sivarajan and Balachandran, 1994) but the current study showed thatS. scabrida is also used. S. alnifolia was also found among the marketsamples collected from Madhya Pradesh. S. ravii, a new species fromKerala (Sivadasan andAnil Kumar, 1996),was found in themarket sam-ple from Assam, which is far away from Kerala.

Six market samples that could not be identified at species level wereidentified at genus level by sequencing rbcL marker and BLAST analysisagainst NCBI nucleotide database and BOLD database. The resultsshowed that species from outside the genus Sida were also foundamong the market samples, and the most frequently found genus wasAbutilon. Garg (1992) has reported A. indicum as an adulterant forS. cordifolia. Abutilon is taxonomically closer to Sida because it wascarved out of Sida by including 15 species (Miller, 1858). However, theother samples belonged to the genus Ixonanthes, Terminalia, Fagonia,and Tephrosia, which are morphologically and taxonomically unrelatedto Sida. Presence of such species among themarket samples shows thatthere is a complete disregard of the species identity of the drug.

The efficiency of the traditional system of medicine mainly dependson the appropriate use and availability of the genuine raw materials(Gupta, 2003). Medicinal properties of Ayurveda drugs are based onthe observations over several centuries. Therefore, it is not advisableto substitute one species for another without further studies. Untilevidence based studies and identification of active ingredients are car-ried out, only the time-tested authentic species should be consideredgenuine. Untested substitutions may not only fail to give the expectedtherapeutic effects but become harmful. For example, ephedrine is atoxic compound reported to be present in higher amount in someplant parts of certain species of Sida. Thewhole plant of S. acuta contains6-fold higher amount of ephedrine compared to the roots of S. cordifolia(Khatoon et al., 2005; Wake, 2011). In the present study, 36% of themarket samples belonged to S. acuta. The clinical effect of the untestedsubstitution of S. cordifoliawith S. acuta is not known.

4. Conclusion

DNA barcoding successfully established the taxonomic identity ofthe dried and powdered medicinal plant parts that were collectedfrom themarkets. The present case study revealed the presence of adul-terants to the extent that the authentic species were completely absent.Development of a reference DNA barcode library for all the medicinallyimportant plants and authentication of the market samples of the rawdrugs by DNA barcoding will help to authenticate plant based drugs,and reduce the chances of undesirable consequences due to the use ofwrong plant materials. This would be of interest to both the consumersand traders of the raw drugs in the context of globally increasingpatronage to complementary and alternate medicines.

93S.L. Vassou et al. / Gene 559 (2015) 86–93

Acknowledgments

We acknowledge the help of G. Nartunai (Captain Srinivasa MurthiResearch Institute, Tamil Nadu), Neethumol, K. Devanathan, R. Balaji,and A. Nithaniyal (SRM University, Tamil Nadu) for their help in thecollection of market samples and identification of Sida species. Wealso acknowledge the funding from SRM University.

References

Anonymous, 2003. The Ayurvedic Formulary of India. Part I. Second ed. Government ofIndia, Ministry of Health and Family Welfare, Department of Indian Systems of Med-icine and Homoeopathy, New Delhi, p. 309.

Balch, P.A., 2002. Prescription for Herbal Healing. Penguin Putnam Inc., New York.Burgess, K.S., Fazekas, A.J., Kesanakurti, P.R., Graham, S.W., Husband, B.C., Newmaster,

S.G., et al., 2011. Discriminating plant species in a local temperate flora using therbcL + matK DNA barcode. Methods Ecol. Evol. 2, 333–340 (March 1).

CBOL, 2009. A DNA barcode for land plants. Proc. Natl. Acad. Sci. U. S. A. 106,12794–12797 (Aug 4, PubMed PMID: 19666622. Epub 2009/07/30.eng).

Chen, S.L., Yao, H., Han, J.P., Liu, C., Song, J.Y., Shi, L.C., et al., 2010. Validation of the ITS2region as a novel DNA barcode for identifying medicinal plant species. PLoS One 5,e8613 (Jan 07, PubMed PMID: 20062805. Epub 2010/01/07. eng).

Chen, S., Pang, X., Song, J., Shi, L., Yao, H., Han, J., et al., 2014. A renaissance in herbal med-icine identification: from morphology to DNA. Biotechnol. Adv. 32 (7), 1237–1244(Nov, PubMed PMID: 25087935. Epub 2014/07/31. eng).

Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of freshleaf tissue. Phytochem. Bull. 19, 11–15.

Fazekas, A.J., Burgess, K.S., Kesanakurti, P.R., Graham, S.W., Newmaster, S.G., Husband,B.C., et al., 2008. Multiple multi locus DNA barcode from the plastid genome discrim-inate plant species equally well. PLoS One 3, e2802 (Jul 30, PubMed PMID: 18665273.Epub 2008/07/30. eng).

Gamble, J.S., 1935. Flora of the presidency Madras. vol. 1. Adlard and sons, London, p. 86.Gao, T., Yao, H., Song, J., Liu, C., Zhu, Y.,Ma, X., et al., 2010. Identification ofmedicinal plants

in the family Fabaceae using a potential DNA barcode ITS2. J. Ethanopharmacol. 130,116–121 (Jul 6, PubMed PMID: 20435122. Epub 2010/05/07. eng).

Garg, S., 1992. Substitute and Adulterant Plants. Periodical Experts Book Agency, NewDelhi.

Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., et al., 2013. Application of the ITS2 regionfor barcodingmedicinal plants of Selaginellaceae in Pteridophyta. PLoS One 8, e67818(Jun 27, PubMed PMID: 23826345. Pubmed Central PMCID: 3694882. Epub 2013/06/27. eng).

Gupta, A.K., 2003. Quality Standards of Indian Medicinal Plants. vol. 1. Indian Council ofMedical Research, New Delhi.

Khatoon, S., Srivastava, M., Rawat, A.K.S., Mehrotra, S., 2005. HPTLC method for chemicalstandardization of Sida species and estimation of the alkaloid ephedrine. J. PlanarChromatogr. 18, 364–367.

Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutionsthrough comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120 (Dec,PubMed PMID: 7463489. Epub 1980/12/16. eng).

Koman, 1921. Indian Materia Gazette. Aug.

Kress, W.J., Erickson, D.L., 2007. A two-locus global DNA barcode for land plants: the cod-ing rbcL gene complements the non-coding trnH-psbA spacer region. PLoS One 2,e508 (Jun 6, PubMed PMID: 17551588. Epub 2007/06/06. eng).

Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H., 2005. Use of DNAbarcodes to identify flowering plants. Proc. Natl. Acad. Sci. U. S. A. 102, 8369–8374(Pubmed PMID: 15928076. Epub 2005/05/31. eng).

Li, X., Wang, B., Han, R., Zheng, Y., Yin, H.Y., Xu, L., et al., 2013. Identification of medicinalplant Schisandra chinensis using a potential DNA barcode ITS2. Acta Soc. Bot. Pol. 82(4), 283–288 (December 30).

Liu, Y., Zhang, L., Liu, Z., Luo, K., Chen, S., Chen, K., 2012. Species identification of Rhodo-dendron (Ericaceae) using the chloroplast deoxyribonucleic acid PsbA-trnH geneticmarker. Pharmacogn. Mag. 8 (29), 29–36 (Jan, PubMed PMID: 22438660. PubmedCentral PMCID: 3307199. Epub 2012/01/08. eng).

Meier, R., Shiyang, K., Vaidya, G., Ng, P.K.L., 2006. DNA barcoding and taxonomy inDiptera: a tale of high intraspecific variability and low identification success. Syst.Biol. 55, 715–728 (Apr, PubMed PMID: 17060194. Epub 2006/04/07. eng).

Meyer, C.P., Paulay, G., 2005. DNA Barcoding: error rates based on comprehensivesampling. PLoS Biol. 3, 2229–2238 (Dec, PubMed PMID: 16336051. Epub 2005/11/29. eng).

Miller, P., 1858. Gardener's Dictionary, Abridg. ed. 4. London. Miquel, F.A.W.Nair, R.V., 2004. Controversial Drug Plants. University Press (India), Hyderabad,

pp. 33–37.Nair, N.C., Henry, A.N., 1983. Flora of Tamil Nadu India. Botanical survey of India, southern

Circle, Coimbatore. vol. 1 p. 36.Niraj, S., Iyer, M., Prasad, R., 2002. The Ayurvedic Medicine Industry: Current Status and

Sustainability. Ecotech Services (India) Private Ltd, India.Purushothaman, N., Newmaster, S.G., Ragupathy, S., Stalin, N., Suresh, D., Arunraj, D.R., et

al., 2014. A tiered barcode authentication tool to differentiatemedicinal Cassia speciesin India. Genet. Mol. Res. 13 (2), 2959–2968 (Apr 16, PubMed PMID: 24782130. Epub2014/04/16. eng).

Sharma, P.V., 2011. Dravyaguna Vijnana (in Hindi). vol. 2. Chaukhambha Bharati Acade-my, Varanasi, pp. 735–738.

Sharma, B.D., Sanjappa, M., 1993. Flora of India. southern Circle, Coimbatore. Botanicalsurvey of India vol. 3, pp. 280–294.

Sivadasan, M., Kumar, A., 1996. Sida ravii, a new species of Malavaceae from India.Willdenowia 25, 651–654.

Sivarajan, V.V., Balachandran, I., 1994. Ayurvedic Drugs and Their Plant Sources. Oxfordand IBH Publishing Cooperation Private Limited, New Delhi, p. 71.

Sivarajan, V.V., Pradeep, K.A., 1996. Malvaceae of Southern Peninsula India: A TaxonomicMonograph. Daya Publishing House, New Delhi.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molec-ular evolutionary genetics analysis using maximum likelihood, evolutionary distance,and maximum parsimony methods. Mol. Biol. Evol. 28 (10), 2731–2739 (PubMedPMID: 21546353. Pubmed Central PMCID: 3203626. Epub 2011/05/04. eng).

Wake, R., 2011. Genus Sida — the plants with ethno medicinal and therapeutic potential.Golden Research Thoughts 5 (1), 1–4.

World Health Organization, 1998. Quality Control Methods for Medicinal Plant Materials.World Health Organization, Geneva.

World Health Organization, 2004. WHO Guidelines on Safety Monitoring of HerbalMedicines in Pharmacovigilance Systems. World Health Organization, Geneva.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具