JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 1991, p. 250-255 Vol. 29, No. 20095-1137/91/020250-06$02.00/0

Differentiation of Pathogenic from Nonpathogenic Entamoebahistolytica by Restriction Fragment Analysis of a Single

Gene Amplified In VitroEGBERT TANNICH* AND GERD D. BURCHARD

Bernhard Nocht Institute for Tropical Medicine, 2000 Hamburg 36, Federal Republic of Germany

Received 4 September 1990/Accepted 21 November 1990

We previously reported the identification of homologous cDNA clones derived from a pathogenic isolate anda nonpathogenic isolate of Entamoeba histolytica, which had been designated cEh-Pl and cEh-NP1, respec-tively. Sequence analysis of both clones had revealed 10% nucleic acid substitutions, which were dispersed overthe entire sequence. This genetic difference had been found to be conserved between all four pathogenic and allfive nonpathogenic laboratory strains ofE. histolytica tested. On the basis of nucleic acid substitutions, we havenow developed a sensitive assay to distinguish pathogenic from nonpathogenic forms of E. histolytica by usingfresh clinical isolates. Comparing the sequence of cEh-Pl and cEh-NPI, we identified a 482-bp segment thatcontained identical 5' and 3' ends but differed in internal cleavage sites for restriction endonucleases. By usingoligonucleotide primers corresponding to the 5' and 3' ends of this segment, the corresponding gene wasamplified by the polymerase chain reaction. Endonuclease digestion of the amplified DNA yielded restrictionfragments that are characteristic for pathogenic and nonpathogenic forms. This assay allows the detection andclassification of fewer than 10 amoebae within a few hours. The differentiation of 48 isolates into pathogenic andnonpathogenic strains by using this method corresponded to the clinical status of the infected individuals andto the classification obtained by isoenzyme determination. The results further support the concept thatpathogenic and nonpathogenic strains of E. histolytica constitute distinct subspecies.

Entamoeba histolytica is an enteric protozoan parasitethat infests half a billion people worldwide. Ten percent ofinfected individuals develop disease such as hemorrhagiccolitis or extraintestinal abscesses, leading to about 70,000deaths each year (25). The numerical difference between theoccurrence of infection and expression of morbidity is basedon the existence of pathogenic and nonpathogenic strains ofE. histolytica. Although there is disagreement about thenature of pathogenicity, strain-specific differences have beenshown by biological assays, isoenzyme analysis, monoclonalantibodies, and DNA probes (9, 13, 20, 21). All currentmethods of classifying E. histolytica have certain disadvan-tages and are not useful for a rapid and sensitive distinctionbetween pathogenic and nonpathogenic forms. Such a dis-tinction is of considerable medical importance because itaids in the decision of whether to treat an infected individual(15, 19).We recently reported on genomic DNA differences be-

tween pathogenic and nonpathogenic E. histolytica (27). Onthe basis of these differences, we have now developed arapid and reliable assay to distinguish both forms. By usingthe polymerase chain reaction (PCR) and subsequent restric-tion fragment analysis, this assay allows the detection andclassification of fewer than 10 amoebae within a few hours.

MATERIALS AND METHODS

E. histolytica strains. The pathogenic E. histolytica strainSAW755 and the nonpathogenic strain SAW 760 were ob-tained from P. Sargeaunt (London, England) and propagatedxenically in TYI-S-33 medium (5). Clinical isolates of E.histolytica from microscopically positive stool samples werecultured in Dobell-Laidlaw medium (6) and subsequently

* Corresponding author.

transferred to TYSGM-9 monophasic medium (4) containingbacteria.

E. histolytica was defined as pathogenic if (i) it originatedfrom patients with symptoms indicative of invasive amebia-sis, (ii) the sera of these patients contained antibodiesspecific for E. histolytica, and (iii) the E. histolytica isolateshad one of the hexokinase isoenzyme patterns which hadbeen shown to be characteristic for pathogenic forms.

Isolates were defined as nonpathogenic if (i) they origi-nated from healthy subjects, (ii) the subjects had no detect-able antibodies against E. histolytica, and (iii) the isolateshad one of the hexokinase isoenzyme patterns which wereshown to be characteristic for nonpathogenic forms.ELISA. The enzyme-linked immunosorbent assay

(ELISA) for the detection of antiamoeba antibodies wasperformed as previously described (10). In brief, a cell lysatewas made from E. histolytica isolated from a patient with anamoebic liver abscess. The amoebae (108) were rinsed threetimes in cold phosphate-buffered saline (PBS). The pelletwas resuspended in 1 ml of distilled water, frozen andthawed five times, and subsequently treated by ultrasound10 times for 30 s and stored at 4°C overnight. It was thencentrifuged at 30,000 x g for 30 min, and the supernatantwas stored at -70°C until used as antigen. ELISA wasperformed in microtiter plates (24). Results were expressedas multiples of normal activity up to a maximum of 100 (8).Isoenzyme determination. The isoenzymes of hexokinase

(EC 2.7.1.1) were examined as previously described (16). Inbrief, whole-cell lysates of the trophozoites were applied tothin-layer starch gel electrophoresis. The relative mobility ofthe hexokinase isoenzymes was determined by the localiza-tion of the specific enzymatic activity by using formazandevelopment. Slow-migrating hexokinase bands were as-signed to nonpathogenic forms, and fast-migrating bands

250

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA 251

TABLE 1. Subjects and corresponding E. histolytica isolates studied

Characterization of:

Case Infected individuals E. histolytica isolatesno.

Recent travel Symptoms Antiamoebic anti- Hexokinase DNA patternhistory' bodieSb mobility

GhanaChinaIndonesiaGhana

GuineaIndia

NicaraguaNepal

India

EcuadorSierra Leone

AfricaDominican RepublicNigeriaIndia

MexicoSicilyIndonesiaTanzaniaIndia

BrazilMexico

IndiaColombiaAfricaIndonesiaGhanaAfrica

Ivory CoastWorldwideIndiaBrazil

IndiaIndiaIndia

AsymptomaticAsymptomaticChronic diarrheaAsymptomaticAsymptomaticAsymptomaticDiarrheaAsymptomaticAsymptomaticDiarrheaAsymptomaticAsymptomaticAsymptomaticAsymptomaticDiarrheaAsymptomaticAsymptomaticAsymptomaticMeteorismBloody diarrheaAsymptomaticAsymptomaticLiver abscessBloody diarrheaAbdominal discomfortAsymptomaticBloody diarrheaAsymptomaticAsymptomaticDiarrheaAsymptomaticAsymptomaticAsymptomaticBloody diarrheaAsymptomaticAsymptomaticAsymptomaticAsymptomaticAsymptomaticAsymptomaticLiver abscessAsymptomaticAsymptomaticAsymptomaticAsymptomaticAsymptomaticBloody diarrheaAsymptomatic

NegNegELISA, 49 UNegNDNegELISA, 28 UNegNegELISA, >100 UNegNegNegNegELISA, 10 UNegNegNegNegELISA, 44 UNDNegNDELISA, >100 UNegNegNDNDNegNDNegNegNegNDNegNegNegNDNegNegELISA, 44 UNegNDNegNegNegELISA, 50 UNeg

SlowSlowFastSlowSlowSlowFastSlowSlowFastSlowSlowSlowSlowFastSlowSlowSlowSlowFastSlowSlowFastFastSlowSlowFastSlowSlowFastSlowSlowSlowFastSlowSlowSlowSlowSlowSlowFastSlowSlowSlowSlowSlowFastSlow

NonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicPathogenicPathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicNonpathogenicPathogenicNonpathogenic

a -, No history of travels outside of Europe.b Neg, No antibodies detected; ND, not determined. ELISA units are as defined in reference 8.

were assigned to pathogenic forms of E. histolytica (Table1).Preparation of E. histolytica genomic DNA. Cells were

harvested in late logarithmic phase by chilling on ice for 10min and low-speed centrifugation at 4°C for 5 min. Nucleiwere obtained from washed cell pellets by lysis in 1%Nonidet P-40 and centrifugation at 500 x g at 4°C for 5 min.The nuclear pellet was resuspended, and DNA was releasedby treatment with proteinase K (1 mg/ml) in a buffer con-taining 100 mM NaCl, 10 mM Tris, 10 mM EDTA, and 0.5%N-laurosylsarcosine at 60°C for 2 h. The DNA was extracted

twice with phenol-chloroform, 1:1 (vol/vol), and once withchloroform and was precipitated with ethanol.

Preparation of E. histolytica cell lysate for PCR. Cells wereharvested as described above, washed in a large volume ofPBS, and centrifuged at 300 x g at 4°C for 5 min. The cellpellet was resuspended in a small volume of PBS (up to 1ml), transferred to a 1.5-ml tube, and boiled for 10 min.

Amplification procedures. Two oligonucleotide primers,P1-S17 and P1-AS20, were synthesized on an Applied Bio-systems DNA synthesizer. The sequences of the primerswere derived from two regions of the previously isolated

1234S6789101112131415161718192021222324252627282930313233343536373839404142434445464748

VOL. 29, 1991

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

252 TANNICH AND BURCHARD

cDNA clone cEh-P1 (22). These two regions were found tobe conserved in all nine E. histolytica isolates tested. P1-S17(5'-GCAACTAGTGTTAGTTA) is a 17-mer oligonucleotidederived from the sense strand, whereas P1-AS20 (5'-CCTCCAAGATATGTTTTAAC) is a 20-mer oligonucleotide fromthe antisense strand of cEh-P1. Both sequences are flankinga 482-bp fragment of cEh-P1.The amplification reactions were performed with the ther-

mostable DNA polymerase of Thermus aquaticus (Taq;Cetus Corp.) as previously described (18). Briefly, 2.5 U ofTaq polymerase was used in a 100-,u reaction volume with10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl, 200 ,uMdeoxynucleotide triphosphates (Cetus Corp.), each oligonu-cleotide primer at 1.0 ,uM, 0.01% gelatin, different amountsof whole-cell lysate or purified genomic DNA as indicated.Samples were overlaid with 100 ,ul of mineral oil to preventevaporation in 0.6-ml tubes (Sarstedt) and amplified for 25 to35 cycles in an automated thermal cycler (Perkin-Elmer-Cetus). Each cycle consisted of 1.5 min of denaturation at94°C, 2.0 min of annealing at 42°C, and 1.5 to 3.0 min ofextension at 72°C. The final extension step continued for anadditional 5 min.

Restriction fragment analysis of amplified DNA. After PCR,10 to 20 ,u of the amplified DNA was digested with therestriction endonucleases AccI, TaqI, and XmnI under con-ditions recommended by the supplier (Boehringer Mann-heim). Digested DNA was separated on 3% NuSieve-1%SeaKem (FMC Corp.) agarose gels and visualized by ethid-ium bromide staining.

RESULTS

Amplification of a 482-bp genomic DNA fragment of E.histolytica by PCR. We made use of genomic sequenceinformation derived from the previously described cDNAclones cEh-P1 and cEh-NP1, which were shown to bespecific for pathogenic and nonpathogenic isolates of E.histolytica, respectively. In cEh-P1 and cEh-NP1 we identi-fied similar segments of 482 bp that contained identicalsequences at the 5' and 3' ends but differed in internalcleavage sites for restriction endonucleases (Fig. 1). Accord-ing to the conserved flanking regions of the 482-bp frag-ments, oligonucleotide primers were constructed and desig-nated P1-S17 and P1-AS20. These primers and purifiedgenomic DNA either from the pathogenic isolate SAW755 orfrom the nonpathogenic isolate SAW760 were used in thePCR.

Analysis of the amplified material by electrophoresis inethidium bromide-containing agarose gels revealed that onlya single genomic fragment was amplified, that there was nodetectable difference in size between the fragments amplifiedfrom the DNA of pathogenic and nonpathogenic amoebae,and that the size of the amplification product (482 bp) wasconsistent with the size expected from the cloned gene (Fig.2).There was no loss of specificity when boiled cell lysates

were used instead of purified DNA. To determine thesensitivity of the assay, serial dilutions of cells were tested.After 35 PCR cycles, amplified DNA of fewer than 10amoebae was detectable (Fig. 3). There was no amplificationof any fragment when purified human DNA, bacterial DNA,or DNA from Entamoeba invadens (Entamoeba speciesfound in reptiles) was used in this assay.

Differentiation between pathogenic and nonpathogenic E.histolytica by restriction fragment analysis. The amplifiedDNA was subjected to endonuclease digestion. Within the

I----P1-817-----IcEh-P1 ----- GCAACTAGTGTTAGTTATACTATTAAGTCTGGATTAACTAAAGGAAAATTAG

11111111111111111 I1 11111 11111Hilll1111111111 IIIclh-NPI ----- GCAACTAGTGTTAGTTACACCATTAAATCTGGTTTAACTAAAGGAAAGTTAG

AACGAGTTGAAGACAATGTTTATGACTATACACCATTCTTTGGAATAGAAGAAAATG1111111111!11111111111111111111111111111

AACAAGTTGAAGAAAATGTTTATGATTATACACCAAACTTTGGAGCAGATGAAAATG

TaqIATACATTTGTTTTAAATATTGATTGTGTTGTTAATGGAGAAAAAGTACATATCGAACli1 11111111 IIIIIIIIIIIII IIIIIIIIIIIIII 11111111 li1ATACTTTTGTTTTGAATATTGATTGTATCGTTAATGGAGAAAAGGTACATATTGAAC

AAGAAGGAACATTTGAATTAGATCCACATCAAGTAGAATATGAAGTTTATAAAGATGli1 II111111111 li1ii11111111111 1111111111111111111AAGACGGAACATTTGAACTAGACCCACATCAAGTAGAGTATGAAGTTTATAAAGATG

TTCAAACAAGAGATATGGCACAAGCTCTTAATATTATTCAGAATAAAACTGCTAATG11 11111 11111111 11111111111111 1111111111111111 11111TTAAAACAAAAGATATGGAACAAGCTCTTAATACTATTCAGAATAAAACTTCTAATT

1--Imn--ATACAGGAAGGGCTTCATTCTTTGGAATTGGAACATACAATGATGGATCAATGCAAT1111 11 1 111 IIIII1111111111111 11 11111111 111111111ATACTGGTACGTCTACATTCTTTGGAATTGGAAATTATGATGATGGAACAATGCAAT

|AcCI|CAATGTTAGTAGAAAAAGGTAAATTGATAGTTCCAAAATCTGGATATTATACATTGT11111111111111111111111111111 111II 1111111111111111

CAATGTTAGTAGAAAAAGGTAAACTGATAGTTCCAACATCAGGATATTATACATTGT

TTATGAAAGCAGATGATTTAGGAAGATTGTTATTGAATATTACTGGAGAGTATGAAC

1111111111111111111111111A1111111 111 111 1111111TTATGAAAGCAGATGATTTAGGAAGGTTGTTGTTAAATGTTAATGGAGAGTATGAAC

11111111 11111111111111111111rTGGAG---------------------------AATTATTAAATGTTAAAACATATCTTGGAGG--------------I.-----P1-A820.------I

FIG. 1. Comparison of nucleic acid sequences derived from thecDNA clones cEh-Pl and cEh-NP1. Identical residues are indicatedby vertical dashes. Shown are the homologous 482-bp fragments ofboth clones selected for in vitro amplification. Oligonucleotideprimers (P1-S17 and P1-AS20) used for PCR are indicated as well asthe restriction sites selected for sequence-specific fragmentation.

482-bp DNA fragment, the sequence differences betweencEh-P1 and cEh-NP1 were predicted to lead to recognitionsites for the restriction endonucleases XmnI, TaqI, and AccIthat were specific for pathogenic and nonpathogenic E.histolytica (Fig. 1).When the amplified DNA of the pathogenic strain

SAW755 was digested with XmnI and TaqI, two fragmentseach were detected (291 and 191 bp for XmnI and 321 and161 bp for TaqI), whereas the DNA derived from thenonpathogenic strain SAW760 was not cleaved by theseenzymes. In contrast, the amplified DNA of SAW760 wascleaved into two fragments by AccI (292 and 190 bp), butthere was no fragmentation of the amplified DNA fromSAW755 (Fig. 4). Thus, the fragmentation patterns obtainedcorresponded to those predicted from the sequence analysisof cEh-Pl and cEh-NP1 and are suitable to distinguish thepathogenic strain SAW755 from the nonpathogenic strainSAW760.

Correlation of restriction fragment analysis with the clinicalstatus of 48 infected individuals. E. histolytica isolates werederived from 48 individuals who had acquired the infectionin various parts of the world. Thirteen had never beenoutside Europe; they are male homosexuals. Twelve of the48 infected persons had clinical symptoms compatible withinvasive amebiasis, whereas the remaining 36 were appar-ently healthy, so-called asymptomatic carriers.For the determination of antiamoeba antibodies, an

ELISA was used. Serum samples from 39 persons, amongthem 8 patients with clinical symptoms, were available. Allof these were serologically positive, but none of the asymp-tomatic carriers tested was positive.

J. CLIN. MICROBIOL.

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA 253

Xmnl TaqI AccIp np p np p np

1350

1080--870 --

600

310280 ---270

230-

190

120

FIG. 2. Detection of a 482-bp genomic DNA fragment from E.histolytica. One nanogram of purified genomic DNA prepared fromthe pathogenic strain SAW755 (p) and the nonpathogenic strainSAW760 (np) was subjected to PCR. Ten percent of the amplifiedmaterial was applied to an ethidium bromide-stained agarose gel.Numbers refer to the length of fragments (in base pairs) deducedfrom size markers (+X174 DNA digested with the restriction en-zyme HaeIII).

All 48 E. histolytica isolates were characterized by hex-okinase isoenzyme determinations. All isolates from patientswith symptoms showed a pathogenic pattern, and all fromasymptomatic carriers showed a nonpathogenic one.

0 0 0 0 0 0O O O LO9e§ 0 0 UZ -r

O LO

1350-1080--870--

600---

310-275-230--190-

FIG. 3. Sensitivity of E. histolytica DNA detection. A serialdilution of E. histolytica cell lysate (10 to 10,000 cells) was used forin vitro DNA amplification, and 10% of the reaction mixtures wassubsequently loaded onto an ethidium bromide-stained agarose gel.The number of cells used for each assay and the size markers (inbase pairs) are indicated.

70- -

FIG. 4. Differentiation of E. histolytica strains by PCR andsubsequent restriction fragment analysis. Whole-cell lysates of thepathogenic strain SAW755 (p) and the nonpathogenic strainSAW760 (np) were subjected to the DNA amplification procedure.Aliquots of the amplified material were digested with the restrictionendonuclease XmnI, TaqI, or Accl as indicated. The digested DNAswere separated on an ethidium bromide-stained agarose gel. Sizemarkers (in base pairs) are indicated.

As summarized in Table 2, these data correlated well withthe results obtained by PCR and subsequent restrictionfragment analysis: all 36 isolates from asymptomatic carriershad the same restriction pattern as that seen with thenonpathogenic reference strain SAW760, and 11 of 12 iso-lates from patients with symptoms revealed the same patternas that obtained with the pathogenic strain SAW755 (Fig. 4 ).In one case, DNA analysis did not correlate to clinical dataand isoenzyme determinations (case no. 10). The isolate wasderived from a European patient returning from Nepal withchronic diarrhea; she was positive for antiamoeba antibod-ies.

DISCUSSION

The results presented here support the view that twogenetically distinct subspecies of E. histolytica infect hu-mans. We recently reported on two cDNA clones represent-ing coding genomic sequences that allow the distinctionbetween pathogenic and nonpathogenic forms (22). Initially,

TABLE 2. Genetic analyses compared to standard isoenzymedeterminations in the differentiation between pathogenic

and nonpathogenic E. histolytica

No. of E. histolytica isolates ascharacterized by:

Presence of symptoms Hexokinase Restriction fragmentof invasive isoenzyme pattern of amplifiedamebiasis pattern gene(n)_

Patho- Non- Patho- Non-genic pathogenic genic pathogenic

Present (12) 12 0 11 1Absent (36) 0 36 0 36

p np

VOL. 29, 1991

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

254 TANNICH AND BURCHARD

these clones were used to test several laboratory strains ofE. histolytica. We now extend this analysis to a number offresh clinical isolates and find a nearly complete correlationto the clinical status of the infected individuals and to othermarkers of pathogenicity. DNA analysis apparently failed inone case. Unfortunately, additional samples from the same

patient were not available to repeat the assay and to even-

tually study the biological properties of the isolate more

thoroughly (with regard to a possible mixed infection). Wetend to believe that an erroneous switch of samples causedthis failure. It seems noteworthy that our study includedsamples from 13 male homosexuals; all of these isolatesexhibited a nonpathogenic isoenzyme pattern and a nonpath-ogenic DNA restriction fragment pattern. This finding sup-

ports previous reports on the prevalence of nonpathogenicE. histolytica in American and European homosexual men

(1, 11, 14).Taken together, increasing evidence suggests that E. his-

tolytica can be separated into two distinct subspecies, one ofwhich is pathogenic to humans and the other of which is not.A rapid and sensitive diagnostic procedure which allows thedistinction between the two forms would obviously be ofconsiderable medical importance. So far, specialized labora-tories use isoenzymes of the carbohydrate metabolism toapproach the distinction between pathogenic and nonpatho-genic isolates. However, this assay needs cell lysates ofapproximately 106 amoebae, which requires cultivation ofthe isolate for several days. In addition, it has been ques-

tioned whether the isoenzyme pattern of a particular strain isstable over time (15, 19).As an alternative, DNA probes have already been applied

to the classification of E. histolytica. Garfinkel et al. isolatedprobes from tandemly repeated sequences, which are foundin highly amplified circular DNA of amoebae. One of theprobes selectively hybridized to the DNA of apparentlypathogenic E. histolytica, whereas the other one was specificfor isolates from asymptomatic carriers (9). However, thistechnique also depends on cultured amoebae and still needsradioactively labeled probes, which limits its use to speciallyequipped and licensed laboratories.

In recent years, the PCR has been widely used as an invitro method for detecting specific DNA from minuteamounts of starting material (3, 7, 12, 17, 23). Here we

present an application of this technique for the distinctionbetween pathogenic and nonpathogenic E. histolytica. Theassay does not require radioactivity. In principle, it could beperformed within 1 day, because its high sensitivity makescultivation unnecessary. As yet, we have not used a simpleextract of feces as starting material for the PCR. Therefore,a short-term culture of the sample is still needed. We and

others are currently working on procedures to amplify E.histolytica DNA directly out of stool specimens (18a). Com-bining the two technical approaches, a rapid and sensi-tive assay for the detection of E. histolytica and the identi-fication of pathogenic forms in fecal samples may be devel-oped.

REFERENCES

1. Allason-Jones, E., A. Mindel, P. G. Sargeaunt, and P. Williams.

1986. Entamoeba histolytica as a commensal intestinal parasite

in homosexual men. N. Engl. J. Med. 315:353-356.

2. Burg, J. L., C. M. Grover, P. Pouletty, and J. C. Boothroyd.

1989. Direct and sensitive detection of a pathogenic protozoan,Toxoplasma gondii, by polymerase chain reaction. J. Clin.Microbiol. 27:1787-1792.

3. Chehab, F. F., M. Doherty, S. Cai, Y. W. Kan, S. Cooper, andE. M. Rubin. 1987. Detection of sickle cell anaemia and thalas-saemia. Nature (London) 329:293-294.

4. Diamond, L. S. 1982. A new liquid medium for xenic cultivationof Entamoeba histolytica and other lumen dwelling protozoa. J.Parasitol. 68:958-959.

5. Diamond, L. S., D. R. Hariow, and C. C. Cunnick. 1978. A newmedium for the axenic cultivation of Entamoeba histolytica andother Entamoeba. Trans. R. Soc. Trop. Med. Hyg. 72:431-432.

6. Dobell, C., and P. P. Laidlaw. 1926. On the cultivation ofEntamoeba histolytica and some other entozoic amoebae. Par-asitology 18:283-318.

7. Embury, S. H., S. J. Scarf, R. K. Saiki, M. A. Gholson, M.Golbus, N. A. Arnheim, and H. A. Erlich. 1987. Rapid prenataldiagnosis of sickle anemia by a new method of DNA analysis.N. Engl. J. Med. 316:656-661.

8. Funke, M., P. Feigner, and R. Geister. 1981. Quantification ofamebae specific antibodies as multiple of normal activity with astandardized enzyme immunoassay. Zentralbl. Bakteriol. Hyg.Mikrobiol. Abt. 1 Orig. A 251:126-133.

9. Garfinkel, L. I., M. Giladi, M. Huber, C. Gitler, D. Mirelman,M. Revel, and S. Rozenblatt. 1989. DNA probes specific forEntamoeba histolytica possessing pathogenic and nonpatho-genic zymodemes. Infect. Immun. 57:926-931.

10. Knobloch, J., and E. Mannweiler. 1983. Development andpersistence of antibodies to Entamoeba histolytica in patientswith amebic liver abscess. Analysis of 216 cases. Am. J. Trop.Med. Hyg. 32:727-732.

11. Laughon, B. E., D. A. Druckman, A. Vernon, T. C. Quinn, B. F.Polk, J. F. Modin, R. H. Yolken, and J. G. Bartlett. 1988.Prevalence of enteric pathogens in homosexual men with andwithout acquired immunodeficiency syndrome. Gastroenterol-ogy 94:984-993.

12. Lench, N., P. Stanier, and R. Williamson. 1988. Simple nonin-vasive method to obtain DNA for gene analysis. Lancet i:1356-1358.

13. Mattern, C. F. T., D. B. Keister, and P. A. Caspar. 1978.Experimental amebiasis. III. A rapid in vitro assay for virulenceof Entamoeba histolytica. Am. J. Trop. Med. Hyg. 27:882-887.

14. Matthews, H. M., D. M. Moss, G. R. Healy, and D. Mildvan.1986. Entamoeba histolytica isolated from homosexual men. J.Infect. Dis. 153:793-795.

15. Mirelman, D. 1987. Effect of culture conditions and bacterialassociates on the zymodemes of Entamoeba histolytica. Para-sitol. Today 3:37-40.

16. Mirelman, D., R. Bracha, A. Wexler, and A. Chayen. 1986.Changes in isoenzyme patterns of a cloned culture of nonpath-ogenic Entamoeba histolytica during axenization. Infect. Im-mun. 54:827-832.

17. Ou, C.-Y., S. Kwok, and S. W. Mitchell. 1988. DNA amplifica-tion for direct detection of HIV-1 in DNA of peripheral bloodmononuclear cells. Science 239:295-297.

18. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi,G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primerdirected enzymatic amplification of DNA with a thermostableDNA polymerase. Science 230:487-491.

18a.Samuelson, J. Personal communication.19. Sargeaunt, P. G. 1987. The reliability of Entamoeba histolytica

zymodemes in clinical diagnosis. Parasitol. Today 3:40-43.20. Sargeaunt, P. G., J. E. Williams, and J. D. Green. 1978. The

differentiation of invasive and non-invasive Entamoeba histolyt-ica isolates by isoenzyme electrophoresis. Trans. R. Soc. Trop.Med. Hyg. 72:519-521.

21. Strachan, W. D., W. M. Spice, P. L. Chiodini, A. H. Moody, andJ. P. Ackers. 1988. Immunological differentiation of pathogenicand nonpathogenic isolates of Entamoeba histolytica. Lancetii:561-562.

22. Tannich, E., R. D. Horstmann, J. Knobloch, and H. H. Arnold.1989. Genomic DNA differences between pathogenic and non-

J. CLIN. MICROBIOL.

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

VOL. 29, 1991 PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA 255

pathogenic Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 24. Voller, A., A. Bartlett, and D. E. Bidwell. 1976. Enzyme86:5118-5122. immunoassays for parasitic diseases. Trans. R. Soc. Trop. Med.

23. Ulrich, P. P., R. A. Bhat, B. Seto, D. Mack, J. Sninsky, and Hyg. 70:98-106.G. N. Vyas. 1989. Enzymatic amplification of Hepatitis B virus 25. Walsh, J. A. 1986. Problems in recognition and diagnosis ofDNA in serum compared with infectivity testing in chimpan- amebiasis. Estimates of the global magnitude of morbidity andzees. J. Infect. Dis. 160:37-43. mortality. Rev. Infect. Dis. 8:228-238.

on June 12, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from