101

ORIGINAL ARTICLE

Acta Medica Indonesiana - The Indonesian Journal of Internal Medicine

Detection of Carbapenemase Encoding Genes in Enterobacteriace, Pseudomonas aeruginosa, and Acinetobacter baumanii Isolated from Patients at Intensive Care Unit Cipto Mangunkusumo Hospital in 2011

Anis Karuniawati, Yulia R. Saharman, Delly C. LestariDepartment of Microbiology, Fauclty of Medicine, University of Indonesia, Jakarta, Indonesia.

Correspondence mail: Department of Microbiology, Fauclty of Medicine, University of Indonesia. Jl. Pegangsaan Timur 16, Jakarta 10430, Indonesia. email: akaruniawati@yahoo.com.

ABSTRAKTujuan: untuk menentukan prevalensi gen yang mengode karbapenemase (blaIMP-1, blaVIM-2,

blaKPC-2, blaOXA-48, dan blaNDM-1) pada mikroorganisme patogen resisten terhadap karbapenem, yakni Enterobacteriaceae, Pseudomonas aeruginosa dan Acinetobacter baumanii yang diisolasi dari pasien di ICU RSCM pada tahun 2011. Metode: gen pengode karbapenemase diperiksa di laboratorium mikrobiologi klinik (LMK) FKUI/RSCM. Untuk mendeteksi gen yang resisten, digunakan metode PCR dupleks dan simpleks. Hasil: ditemukan bahwa 4 (5%) galur P. aeruginosa membawa gen blaIMP-1 dan seluruhnya diisolasi dari sputum. Prevalensi resistensi karbapenem pada bakteri Gram-negatif yang diisolasi dari ICU RSCM adalah 27,6% untuk Enterobacteriaceae, 21,9% untuk P. aeruginosa dan 50,5% untuk A. baumannii. Gen pengode metallo-β-laktamase New Delhi ditemukan pada 1 sediaan K. pneumonia yang juga diisolasi dari sputum. Gen lainnya, yakni blaKPC-2, blaVIM-2, dan blaOXA-48 tidak ditemukan pada isolasi apa pun. Tidak adanya gen lain menunjukkan bahwa mekanisme lain mungkin berperan dalam terjadinya resistensi karbapenem pada mikroorganisme pathogen yang diisolasi dari ICU-RSCM. Penelitian ini membuktikan bahwa prevalensi bakteri Gram-negatif yang resisten terhadap karbapenem di ICU RSCM pada tahun 2011 ternyata cukup tinggi. Gen pengode karbapenemase, yang ditemukan pada bakteri Gram-negatif yang resisten terhadap karbapenem adalah blaIMP-1 dan blaNDM-1.

Kata kunci: Enterobacteriaceae, P. aeruginosa, A. baumanii, gen pengode karbapenemase.

ABSTRACTAim: to determine the prevalence of carbapenemase encoding genes (blaIMP-1, blaVIM-2, blaKPC-2,

blaOXA-48, and blaNDM-1) of carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumanii isolated from the intensive care unit patients as pathogens, in Cipto Mangunkusumo hospital (ICU-RSCM) in 2011. Methods: we examined the carbapenemase encoding genes in the clinical microbiology laboratory (LMK FKUI/RSCM). Duplex- and simplex PCR methods were conducted to detect the resistant genes. Results: we found 4 (5%) P. aeruginosa strains carry blaIMP-1 gene and all were isolated from sputum specimens. The prevalence of carbapenem resistant among Gram-negative bacilli isolated from ICU-RSCM, are Enterobacteriaceae 27.6%, P. aeruginosa 21.9%, and A. baumannii 50.5%. The New Delhi Metallo-β-lactamase encoding gene (blaNDM-1) was detected in 1 K. pneumonia isolated from sputum as well. The other genes, i.e. blaKPC-2, blaVIM-2, and blaOXA-48 were not found in any isolates. The absence of other genes indicated that other mechanisms may play a role in the occurrence of carbapenem resistance in pathogens isolated in ICU-RSCM. Conclusion: this study confirmed that the prevalence of carbapenems resistant Gram-negative bacilli in

Anis Karuniawati Acta Med Indones-Indones J Intern Med

102

INTRODUCTIONAntibiotic use and misuse are particularly high

in hospitals where doctors treat many patients without any indication of infection or suspected infection. In many cases, patients are treated without proper microbiological diagnosis, so the attending doctor does not really know what the cause of the patient’s illness is.1 In the past few decades an alarming increase in the prevalence of resistant antimicrobial pathogens of serious hospital acquired infections has been shown worldwide, including Indonesia. The prevalence of multidrug-resistant organisms isolated in the intensive care unit (ICU) setting may be significantly higher than in other hospital wards.2

Cipto Mangunkusumo Hospital is a 1,200 bed academic hospital, affiliated to the Faculty of Medicine, Universitas Indonesia. It is generally considered to be the top referral centre of specialist medical care and of specialist training in all medical disciplines in Indonesia. ICU is one of the facilities with 80 admissions of critically ill patients per month. In 2008, many of microorganisms causing infection in the ICU are multidrug-resistant organisms (MDROs) including methicillin resistant Staphylococcus aureus (MRSA, 8.8%) and extended spectrum β-lactamase (ESBL) producing Gram-negative bacilli (16.5%).3

Currently the use of broad spectrum antibiotics, especially carbapenems, is increasing due to the high prevalence of multidrug resistant pathogens. The data on the prevalence of carbapenem resistant and the carbapenemase encoding genes in Indonesia is not yet available. The objectives of study is to determine the prevalence of carbapenem resistant organisms and the carbapenemase encoding genes (blaIMP-1, blaVIM-2, blaKPC-2, blaOXA-48, and blaNDM-1) of Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumanii isolated from patients in the intensive care unit of Cipto Mangunkusumo Hospital (ICU-RSCM) in 2011,

were examined in the clinical microbiology laboratory, Department of Microbiology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo Hospital (LMK FKUI/RSCM).

METHODSBacteria. For optimization and control

positive of the multiplex-PCR, we used some well characterized strains. The strains were Klebsiella pneumoniae carrying blaNDM-1; Pseudomonas aeruginosa carrying blaVIM-2; Enterobacter cloacae carrying blaOXA-48; and Klebsiella pneumoniae carrying blaIMP-1. Those strains were purchased from Service de Bactériologie-Virologie, INSERM U914 “Emerging Resistance to Antibiotics”, Hôpital de Bicêtre, Assistance Publique/Hôpitaux de Paris, Faculté de Médecine Paris-Sud, Université Paris XI, 94275 K.-Bicêtre, France, through the correspondence with Dr. Laurent Poirel. The positive control used for blaKPC-1 gene was Klebsiella pneumoniae ATCC BAA 1708 (Oxoid).

The clinical species from the family Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumanii were recultured from the stock collection of the clinical microbiology laboratory, Department of Microbiology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo Hospital (LMK FKUI/RSCM).All those Gram-negative bacilli were isolated from patients in ICU-RSCM in 2011. All bacteria were reidentified biochemically and retested for the drug susceptibility tests using disk diffusion methods according to updated CLSI.

Prevalence of carbapenems resistant Gram-negative bacilli. Data about isolates and the susceptibility tests were retrieved from the WHONET 5.6 software used in LMK-FKUI/RSCM. The stocks used in this study were only the carbapenem-resistant strains.

DNA extraction. The DNA extraction was performed from fresh culture using boiling techniques.

ICU-RSCM in 2011 was high. The carbapenemase encoding genes, which were detected among the carbapenems resistant Gram-negative bacilli, were blaIMP-1 and blaNDM-1.

Key words: Enterobacteriaceae, P. aeruginosa, A. baumanii, carbapenemase encoding genes.

Vol 45 • Number 2 • April 2013 Detection of Carbapenemase encoding genes in ICU patients

103

PCR method. The primers used in this study (Table 1) are based on primers published by Poirel et al.4 The PCR mixtures were 10X PCR Buffer 2.5 μl, 25 mM MgCl2 1 μl, 10 mM dNTPmix 0.6 μl, 5XQ solution 5 μl, 100 μM each primers 1 μl (except OXA 0.4 μl), Hotstar DNA polymerase 0.15 μl, DNA sample 2 μl, and DNase free water. The thermal cycling conditions of each reactions are stated in Table 2. The amplicon were analyzed by electrophoresis in a 1.5% agarose gel.

Ethical ClearanceThis study has passed ethical evaluation by

the Faculty of Medicine, Universitas Indonesia and Cipto Mangunkusumo Hospital Ethics

Committee (Letter no. 705/H2.F1/ETIK/2012).

Role of The Funding SourceThe sponsor of the study had no role in

study design, data collection, data analysis, data interpretation or writing of the report. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.

RESULTSEighty one strains from the stock collection

were reconfirmed as Gram-negative bacilli and resistant to at least one agent of carbapenem class (imipenem or meropenem or doripenem). The strains were collected from hospital- acquired infection cases in the ICU of Cipto Mangunkusumo Hosiptal in 2011 with the specimens types stated in Table 3. Most of the bacteria were isolated from sputum (61) of patients with pneumonia.

Based on the data retrieved from the WHONET 5.6 software used in LMK-FKUI/RSCM, the prevalence of carbapenems (imipenem/meropenem/doripenem) resistance among Gram-negative bacilli isolated from ICU-RSCM, were Enterobacteriaceae 27.6%, Pseudomonas aeruginosa 21.9%, and of Acinetobacter baumanii 50.5%.

Positive controls yielded expected bands and confirmed the specificity of the PCR primers used (Figure 1). The primer pairs were tested in simplex PCR (only one gene screened, for blaNDM-1 gene) and with a multiplex approach. We could not use all primers in single reaction

Table1. Oligonucleotides used in this study3

Primers Sequences Genes Size (bp)

IMP-F GGAATAGAGTGGCTTAAYTCT blaIMP-1 232

IMP-R CGGTTTAAYAAAACAACCACC

VIM-F GATGGTGTTTGGTCGCATA blaVIM-2 390

VIM-R CGAATGCGCAGCACCAG

KPC-Fm CGTCTAGTTCTGCTGTCTTG blaKPC-2 798

KPC-Rm CTTGTCATCCTTGTTAGGCG

OXA-F GCGTGGTTAAGGATGAACAC blaOXA-48 438

OXA-R CATCAAGTTCAACCCAACCG

NDM-F GGTTTGGCGATCTGGTTTTC blaNDM-1 621

NDM-R CGGAATGGCTCATCACGATC

Table 2. The thermal cycling conditions used in the amplification reactions

Primers Temperature Time Cycle

IMP and VIM 950C 15 minutes 1x

940C 30 seconds 36x

530C 20 seconds

720C 50 seconds

720C 5 minutes 1x

KPC and OXA 950C 15 minutes 1x

940C 30 seconds 40x

500C 30 seconds

720C 50 seconds

750C 5 minutes 1x

NDM 950C 15 minutes 1x

940C 30 seconds 40x

500C 30 seconds

720C 50 seconds

750C 5 minutes 1x

Anis Karuniawati Acta Med Indones-Indones J Intern Med

104

Table 3. Number of bacteria and the specimen types from which the bacteria were isolated

Bacteria No. of isolates Specimen types No. of speciments

Enterobacteriaceae

- Klebsiella pneumonia 18 Sputum 11

Intra Abdominal 1

Urine 2

Swab 1

Tissue 3

- Escherichia coli 2 Urine 2

- Klebsiella oxytoca 1 Sputum 1

- Enterobacter cloacae 1 Swab 1

- Citrobacter freundii 1 Sputum 1

- Proteus mirabilis 1 Pus 1

- Salmonella arizonae 1 Blood 1

- Serratia odorifera 1 Lokhia 1

- Edwardsiella tarda 1 Swab 1

Pseudomonas aeruginosa 21 Sputum 16

Tissue 1

Urine 2

Wound swab 1

Cerebrospinal fluid 1

Acinetobacter baumanii 42 Sputum 34

Blood 6

Urine 1

Tissue 1

232bp

390bp

438bp

bp

798bp

bp

621bp

A B C

Figure 1. Agarose gel electrophoresis (2%) used for separation of the different multiplex PCR products. Lanes labeled K- correspond to blank controls. (A) Results of multiplex no. 1 detecting blaIMP-1 and blaVIM-2 genes; lane “multi”, the DNA sample was containing both genes. (B) Results of multiplex no. 2 detecting blaKPC-2 and blaOXA-48 genes;. (C) Results of multiplex no. 3 detecting blaNDM-1 gene. The size of each amplicon is indicated on the right. The ladder used is the 100 kb DNA ladder (Thermo Scientific).

Vol 45 • Number 2 • April 2013 Detection of Carbapenemase encoding genes in ICU patients

105

but should be separated in three conditions.We found 4 (5%) isolates carry blaIMP-1

gene and all of them are Pseudomonas aeruginosa. From these 4-blaIMP-1-positives Pseudomonas aeruginosa, all were isolated from sputum specimens. The New Delhi metallo-β-lactamase (blaNDM-1) gene was found in 1 Klebsiella pneumonia, which is isolated from sputum specimen. None of other genes, blaVIM-2; blaKPC-2; and blaOXA-48, were identified in all bacteria investigated in this study.

DISCUSSIONResistance rates are increasing among several

Gram-negative bacteria, especially in the family Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumanii. The presence of these resistant organisms has been limited the choice of appropriate antibiotic therapy. There are three mechanism of resistance against ß-lactam antibiotic, including carbapenems. These mechanisms are the production of ß-lactamase which cleave the amide bond of the ß-lactam ring, the possession of an altered or acquired penicillin binding protein with low affinity for ß-lactams and over expression of efflux pump mechanism.4

T h e p r o d u c t i o n o f ß - l a c t a m a s e (carbapenemase) enzyme is the most common mechanism of resistance. There are many genes responsible for this and the most frequent genes are carried by class 1 integrons, i.e. serine-β-lactamase class A (KPC), serine-β-lactamase class D (OXA), and metallo-β-lactamase class B (VIM, IMP, NDM, and NDM-1). Among those genes, IMP and VIM types have been identified distantly related geographical areas among many different Enterobacteriacea and Pseudomonas spp. The emergence of the Ambler class A KPC β-lactamase is mostly reported in Klebsiella pneumonia, but it could be found also in Pseudomonas aeruginosa, Escherichia coli, and Acinetobacter baumannii in the United States, Israel, and Greece.2

There are limited studies about molecular epidemiology of resistance pathogens in Asia, particularly in Indonesia. This study is the first investigation about the genotype prevalence of carbapenems resistant Gram-negative bacilli in Indonesia. Based on the disk diffusion methods

(CLSI, 2012), the prevalence of carbapenems resistance among Gram-negative bacilli isolated from ICU-RSCM in 2011, are Enterobacteriaceae 27.6%, Pseudomonas aeruginosa 21.9%, and of Acinetobacter baumanii 50.5%. A study conducted in National Taiwan University Hospital in 2005 reported that 49% from 81 Acinetobacter spp. from clinical specimens were carbapenem- resistant.5

Simplex- and Duplex-PCR methods were conducted to find the resistant genes, and we found 4 (5%) isolates carry blaIMP-1 gene and all of them are Pseudomonas aeruginosa. Plasmid-mediated imipenem (IMP)-type carbapenemases is a form of metallo-β-lactamse, which consists of nearly 20 varieties currently. These enzymes were established in Japan in the 1990s, in Enterobacteriaceae, Pseudomonas sp., and Acinetobacter sp. and had emerged widely throughout Asia, Europe, and America. The enzymes hydrolyze all β-lactams except monobactams, and evade all β-lactam inhibitors currently available.6

The New Delhi metallo-β-lactamase (blaNDM-1) gene was found in 1 Klebsiella pneumonia, which is isolated from sputum specimen. The blaNDM-1 gene was originally described in Klebsiella pneumoniae from New Delhi in 2009. Currently the gene widespread in other Enterobacteriaceae and Acinetobacter baumannii, and in other countries including United States and United Kingdom.5,6

No other genes were identified in all samples. The absence of other genes indicate that other mechanisms play a role in the occurrence of carbapenems resistance in pathogens isolated in ICU-RSCM. The DNA of all bacterial isolates should be sequenced to know the exact resistance mechanisms.

CONCLUSIONThis study confirmed that the prevalence of

carbapenem-resistant Gram-negative bacilli in ICU-RSCM in 2011 is high. The carbapenemase encoding genes, which were detected among the carbapenems resistant Gram- negative bacilli, were blaIMP-1 and blaNDM-1. Further studies should be done to elucidate the resistance mechanisms occurring in other isolates.

Anis Karuniawati Acta Med Indones-Indones J Intern Med

106

ACKNOWLEDGMENTS

This work was fully supported by Universitas Indonesia research grant (Hibah Madya UI 2012).

REFFERENCES 1. Lestari ES. Antimicrobial resistance in Indonesia;

Prevalence, determinant and genetic basis. Rotterdam: Erasmus University; 2009. Dissertation.

2. Siege JD, Jackson M. Healthcare infection control practices advisory committee. Management of multidrug-resistant organisms in health care settings. Am J Infect Control. 2007;35 (10 Suppl 2):S165-93.

3. Saharman YR. Bakteri orofaring dan bakteri lingkungan sebagai penyebab ventilator associated pneumonia (VAP) di ruang ICU/HCU RSUPN-CM. Jakarta: Universitas Indonesia; 2008.

4. Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diag Microbiol Infect Dis. 2011;70:119–23.

5. Lin Yu-Chi, Sheng WH, Chen YC, et al. Differences in carbapenem resistance genes among Acinetobacter baumannii, Acinetobacter genospecies 3 and Acinetobacter genospecies 13TU in Taiwan. Int J Antimicrobiol Agents. 2010;35:439–43.

6. Barie PS. Multidrud-resistant organisms and antibiotic management. Surg Clin N Am. 2012;92:345–91.