Detection and Characterization of Conjugative Degradative ... · with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments Hybridization

JOURNAL OF BACTERIOLOGY, June 2004, p. 3862–3872 Vol. 186, No. 120021-9193/04/$08.00�0 DOI: 10.1128/JB.186.12.3862–3872.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Detection and Characterization of Conjugative Degradative Plasmidsin Xenobiotic-Degrading Sphingomonas Strains

Tamara Basta,1 Andreas Keck,2† Joachim Klein,2‡ and Andreas Stolz1*Institut fur Mikrobiologie1 and Institut fur Industrielle Genetik,2 Universitat Stuttgart,

Allmandring 31, 70569 Stuttgart, Germany

Received 8 January 2004/Accepted 5 March 2004

A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strainswas performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb weredetected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treatedwith S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experimentswith labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin,dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6,respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene byS. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifi-cally labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids wasattempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmidpBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. Theconjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it wastransferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbi-cidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transferof plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for thetransfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained.

The genus Sphingomonas accommodates strictly aerobic,chemoheterotrophic, gram-negative, rod-shaped, usually yel-low-pigmented bacteria that contain glycosphingolipids as cellenvelope components and belong to the �-4-subgroup of theProteobacteria (62). Sphingomonas strains appear to be widelydistributed in various aquatic and terrestrial environments.They have been isolated from anthropogenic polluted riverwater and sediments (17, 45, 67) and medical material (69),and they constitute an important part of the marine bacterialplankton (11). Recently, sphingomonads have also been de-tected in rather high cell densities on the surfaces of variousplants (31) and in biofilms found in drinking water supplies(32). Furthermore, they have been repeatedly isolated fromextreme environments such as arctic and antarctic soils anddeeply buried (�200 m) sediments (2, 3, 13, 56). The genusSphingomonas is becoming increasingly interesting in environ-mental microbiology because various xenobiotic-degrading or-ganisms belong to this group. Previously, Sphingomonas strainshave been described that degrade compounds such as biphenyl,(substituted) naphthalene(s), fluorene, (substituted) phenan-threne(s), pyrene, (chlorinated) diphenylether(s), (chlori-nated) furan(s), (chlorinated) dibenzo-p-dioxin(s), carbazole,polyethylene glycols, chlorinated phenols, and different herbi-cides and pesticides (e.g., references 10, 13, 20, 28, 34, 39, 40,41, 42, 45, 55, 59, 60, 61, 64, 66, 71, 72, and 73).

The isolation of various Sphingomonas strains which harbordifferent metabolic pathways for the degradation of a widerange of xenobiotic compounds suggests that the members ofthis genus have the ability to adapt more quickly or moreefficiently to the degradation of new compounds in the envi-ronment than members of other bacterial genera. This abilitydoes not seem to be related to different general strategies inthe degradative pathways used for the mineralization of xeno-biotic compounds, because previous studies about the physiol-ogy and enzymology of a number of degradative pathways [e.g.,those for (substituted) naphthalene(s) or biphenyl] did notdemonstrate any significant differences between sphin-gomonads and other bacteria (30, 59, 61). However, a compar-ison of the genes encoding the degradation of 2,4-dichlorophe-noxyacetate or biphenyl suggested that usually only a lowdegree of sequence similarity is found between the sphin-gomonads and other Proteobacteria (e.g., authentic pseudo-monads) (15, 16). This indicated that in the evolution of deg-radative pathways, some kind of barriers must have existedbetween sphingomonads and other Proteobacteria.

Currently, the major known difference between Sphingomo-nas strains and other gram-negative bacteria is a frequentlyobserved unusual organization of the degradative genes in thesphingomonads. Previous studies with authentic pseudo-monads suggested that the genes which encode catabolic en-zymes are often organized in operons and are coordinatelyregulated. Classical examples for such a genetic organizationare meta-cleavage pathways from the TOL or NAH plasmids,modified ortho-cleavage pathways for chlorocatechols fromvarious plasmids, or the chromosomally encoded �-ketoadi-pate pathway (19, 21, 70). In contrast, it is becoming increas-ingly evident that the genes for catabolic pathways in Sphin-

* Corresponding author. Mailing address: Institut fur Mikrobiolo-gie, Universitat Stuttgart, Allmandring 31, D-70569 Stuttgart, Ger-many. Phone: 49 (711) 685 5489. Fax: 49 (711) 685 5725. E-mail:[email protected].

† Present address: Febit, 68167 Mannheim, Germany.‡ Present address: Lonza AG, 3930 Visp, Switzerland.

3862

on August 28, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

gomonas strains are often localized separately from each otheror are at least not organized in coordinately regulated operons.This has been described, e.g., for the genes involved in thedegradation of �-hexachlorocyclohexane (lindane) by S. pauci-mobilis UT26 (39, 41), pentachlorophenol by S. chlorophe-nolica (5), protocatechuate by S. paucimobilis SYK-6 (37),naphthalene, biphenyl, and toluene by S. yanoikuyae B1 and S.aromaticivorans F199 (52, 73), and dibenzo-p-dioxin by S. wit-tichii RW1 (1). (For a current review see reference 50.)

There are several reports which indicate that large plasmidsmay be important for the degradation of xenobiotic com-pounds by Sphingomonas strains. Thus, in S. aromaticivoransF199 and some other sphingomonads isolated from the samelocation, the genes encoding the degradative pathways for bi-phenyl, naphthalene, m-xylene, and p-cresol were detected onlarge plasmids (29, 52). There is also some evidence that thegenes for the degradation of carbazole by some other sphin-gomonads (e.g., Sphingomonas CF06) are also (at least in part)encoded on plasmids (12, 47).

A detailed analysis of the naphthalenesulfonate-degradingstrain S. xenophaga BN6 has previously been performed, and inthe course of these investigations, various tools for the molec-ular analysis of sphingomonads were established (e.g., refer-ences 27, 33, 51, and 59). In the present study it was thereforeattempted to localize the genes for the degradation of naph-thalenesulfonates in the genome of strain BN6 and to obtainmore general information about the presence, importance, andhost range of plasmids in xenobiotic-degrading sphin-gomonads.

MATERIALS AND METHODS

Bacterial strains and media. The sphingomonads studied and some charac-teristic compounds which are degraded by the respective strains are shown inTable 1. The members of the former genus Sphingomonas sensu lato wereclassified in Table 1 according to the suggestion of Takeuchi et al. (62) asmembers of the newly created genera Sphingomonas, Sphingobium, Novosphin-gobium, or Sphingopyxis. For some strains indicated in Table 1, no valid newdescriptions have been performed, but according to their 16S rDNA, most ofthem probably belong to the genera Sphingobium or Novosphingobium and donot belong to the newly defined genus Sphingomonas sensu stricto. In order tocircumvent these taxonomical problems, the older nomenclature is used and allof the strains are referred to as Sphingomonas sensu lato throughout this report.

The non-Sphingomonas strains which were used for the conjugation experi-ments were obtained from the DSMZ (Deutsche Sammlung von Mikroorganis-men und Zellkulturen, Braunschweig, Germany). These bacteria were cultivatedin the media suggested by the DSMZ.

For the plasmid detection experiments, the bacterial strains were routinelysubcultured on nutrient broth (NB) or R2A medium (Difco, Becton Dickinson,Sparks, Md.). A mineral medium described by Dorn et al. (9) was used asselection medium for the curing and conjugation experiments. The followingcarbon and energy sources were added for the selection of transconjugants orcured mutants: malate (5 mM) and glucose (0.5%, wt/vol) were from aqueousstock solutions, 2(2,4-dichlorophenoxy)propionate was supplied from a stocksolution in acetone (363 mg/ml) to a final concentration of 640 mg/liter, anddibenzofuran and diphenylether were added as solid particles in the lid ofmineral agar plates.

Escherichia coli strains DH5� (Gibco, Eggenstein, Germany) and S17.1 (57)were used for recombinant DNA work.

Molecular techniques for the manipulation of recombinant E. coli strains.Plasmid DNA was isolated from E. coli DH5� with a Gfx-Micro plasmid prep kitfrom Amersham Biosciences (Freiburg, Germany). Digestion of DNA with re-striction endonucleases (MBI Fermentas, St. Leon-Rot, Germany), electro-phoresis, DNA purification, alkaline phosphatase treatment, and ligation with T4

TABLE 1. Sphingomonas strains analyzed during the present study

Straina Compounds degraded Reference(s)

Sphingomonas (Sphingobium) yanoikuyae B1DSM 6900

Toluene, biphenyl, naphthalene, anthracene, phenanthrene 69

Sphingomonas (Sphingobium) herbicidovoransDSM 11019

2-(2,4-Dichlorophenoxy) propioniate, 2,4-dichlorophenoxypropionic acid, mecoprop

72

Sphingomonas (Sphingobium) chlorophenolicaATCC 33790

Pentachlorophenol, 2,4,6-trichlorophenol 44

“Sphingomonas paucimobilis” Q1 Toluene, xylene, naphthalene, biphenyl, anthracene 17“Sphingomonas” wittichii RW1 DSM 6014 (Chlorinated) dibenzo-p-dioxin(s), dibenzofuran(s) 67, 68“Sphingomonas” sp. HH69 DSM 7135 (Acetoxy-, hydroxy-) dibenzofuran(s) 20“Sphingomonas” sp. SS3 DSM 6432 (4-Chloro-, 4-fluoro-) diphenylether 55“Sphingomonas” sp. EPA505 DSM 7526 Fluoranthene, (substituted) naphthalene(s), phenanthrene,

anthracene40

“Sphingomonas” sp. A175 DSM 13477 Benzene, 1,4-dichlorobenzene 43“Sphingomonas” sp. K39 2,3,4,6-Tetrachlorophenol 64“Sphingomonas” xenophaga BN6 DSM 6383 (Substituted) naphthalene-2-sulfonate(s) 45, 58Sphingomonas (Sphingopyxis) macrogoltabidus

DSM 8826Polyethylene glycol 4000 62, 63

Sphingomonas (Novosphingobium) subterraneaDSM 12447

Naphthalene, toluene, biphenyl, dibenzothiophene, fluorene 2, 62

Sphingomonas (Novosphingobium)aromaticivorans F199 DSM 12444

Naphthalene, toluene, cresoles, biphenyl, dibenzothiophene,fluorene

2, 62

Sphingomonas (Novosphingobium)aromaticivorans B0695

2-Methylnaphthalene, acenaphthene, anthracene, fluoranthene,phenanthrene

56

Sphingomonas (Novosphingobium) subarcticaKF1 DSM 10700

2,3,4,6-Tetrachlorophenol, 2,4,6-trichlorophenol 43

62Sphingomonas (Novosphingobium) stygia DSM

12445Toluene, biphenyl, dibenzothiophene, fluorene 62

Sphingomonas paucimobilis DSM 1098 Cannot degrade aromatic hydrocarbons 69

a Quotation marks indicate strains for which no valid new descriptions have been performed.

VOL. 186, 2004 DEGRADATIVE PLASMIDS IN SPHINGOMONADS 3863


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

DNA ligase were performed according to the standard procedures (54). Trans-formation of E. coli was done by the method of Chung et al. (7).

Preparation of genomic DNA from sphingomonads for the detection ofmegaplasmids. The different Sphingomonas strains were usually grown overnightat 30°C in 20 ml of NB, and the plasmids were prepared basically as previouslydescribed by Barton et al. (4). Approximately 4 � 109 cells were harvested bycentrifugation, washed with 1 ml of 1 M NaCl in 10 mM Tris-HCl (pH 7.6), andresuspended in 500 �l of EC buffer (1 M NaCl, 100 mM EDTA, 6 mM Tris-HCl[pH 7.6], 0.5% [wt/vol] Brij 58, 0.2% [wt/vol] deoxycholate, 0.5% [wt/vol] N-lauroylsarcosine). The cell suspensions were thoroughly mixed with an equalvolume of InCert agarose (10 mg/ml in EC buffer; BMA, Rockland, Maine)which was melted and maintained at 85°C in a thermomixer (Eppendorf, Ham-burg, Germany). Two hundred microliters of each of the preparations was im-mediately transferred into the plug molds. The molder was put on ice for 15 minto allow the plugs to solidify. The solidified plugs were transferred into 2-mlEppendorf tubes and incubated at 37°C in 1 ml of EC buffer, which additionallycontained 20 �g of RNase/ml and 1 mg of lysozyme/ml until the cells were lysed.The complete clearance of plugs could be observed usually after 45 to 60 min ofincubation. Subsequently, the plugs were incubated overnight at 50°C in ESbuffer (1% [wt/vol] N-lauroylsarcosine, 0.5 M EDTA [pH 8.0]) supplementedwith 1 mg of proteinase K/ml (Gerbu, Gaiberg, Germany). The ES buffer and theproteinase K were incubated together at 37°C for 2 h before usage. Finally, theproteinase K was inactivated by incubating the plugs in 1 ml of 1 mM phenyl-methylsulfonyl fluoride in TE buffer (10 mM Tris [pH 7.5], 1 mM EDTA) for 45min at 37°C. The plugs were then incubated twice in 1 ml of TE buffer (45 mineach) to remove traces of phenylmethylsulfonyl fluoride. The agarose plugsprepared in this way could be stored at least for 2 weeks at 4°C.

In order to linearize circular megaplasmids, slices of 2 to 3 mm were cut outof each plug, and the incorporated DNA was digested for 10 min at 37°C with 1U of Aspergillus oryzae S1 nuclease (MBI Fermentas) in 200 �l of S1 buffer (50mM NaCl, 30 mM sodium acetate [pH 4.5], 5 mM ZnSO4). The reactions werestopped by transferring the slices into 100 �l of ice-cold ES buffer. After 15 minof incubation on ice, the slices were loaded separately on the teeth of a gel comb,and the comb with the attached gel slices was transferred to the horizontal gelmounting chamber (14 by 14 by 1 cm). The comb with the attached gel slices wasembedded in 100 ml of 1% agarose (molecular biology grade; Eurogentec,Herstal, Belgium) prepared in 0.5� TBE buffer (45 mM Tris-HCl, 45 mM boricacid, 1 mM EDTA [pH 8.0]). The comb was removed from the gel after solid-ification of the agarose, leaving the DNA-containing plugs within the agarose.Finally, the pulsed-field gel electrophoresis (PFGE) was run in a clamped ho-mogenous electric field apparatus (CHEF Mapper; Bio-Rad Laboratories, Rich-mond, Calif.) in 0.5� TBE buffer at 14°C at 6 V/cm with linearly increasing pulsetimes from 7.23 to 24 s for 26 h. �-DNA concatemers (1 �g) were used as sizestandards (New England Biolabs, Beverly, Mass.). The gels were subsequently

stained with ethidium bromide and documented by using an image documenta-tion system (Raytest, Straubenhardt, Germany).

PCR experiments. PCR experiments were performed in a Genius thermalcycler (Techne, Cambridge, United Kingdom). The PCR mixtures contained, ina volume of 30 �l, 50 to 200 ng of DNA, 0.3 �M of each forward and reverseprimer (Eurogentec), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM magne-sium acetate, 0.2 mM dNTP (Eppendorf), and 0.5 to 1 U of Taq DNA polymer-ase (Eppendorf) under the conditions indicated below.

The primers for the preparation of the pcpB and pcpC probes (Table 2) werederived from the corresponding nucleotide sequences from S. chlorophenolicaATCC 33790 and ATCC 39723 deposited at the NCBI databases. The followingPCR program was used for the amplification of the indicated regions of pcpB andpcpC: an initial denaturation (3 min, 94°C) was followed by 30 cycles consistingof annealing at 60°C (30 s), polymerization at 72°C (40 s), and denaturation at94°C (30 s). The last polymerization step was extended to 5 min.

The primers for the amplification of dxnA1A2 (large and small subunit of thedioxin dioxygenase) were derived from published nucleotide sequences obtainedfrom S. wittichii RW1 (Table 2). The PCR program applied consisted of an initialdenaturation (3 min, 94°C), followed by 30 cycles of annealing at 60°C (30 s),polymerization at 72°C (90 s), and denaturation at 94°C (30 s). The last poly-merization step was extended to 5 min.

Hybridization procedures. A digoxigenin (DIG) DNA labeling and detectionkit was used according to the instructions of the supplier (Roche, Mannheim,Germany). The pcpB, pcpC, and dxnA1A2 probes were prepared by PCR usingthe known gene sequences as described above.

Plasmid pAKE3/5 (26) was used for the localization of the genes participatingin the degradation of naphthalenesulfonates in S. xenophaga BN6. This recom-binant plasmid contained a 12-kb insert encoding several genes of the naphtha-lenesulfonate degradative pathway (e.g., 1,2-dihydroxynaphthalene dioxygenaseand 2-hydroxybenzalpyruvate aldolase-hydratase). The insert in pAKE3/5 cor-responded to the 16.2-kb fragment deposited at the NCBI database as U65001,without the terminal 1.5-kb PstI fragment at the 3 end and a terminal 3-kbHindIII fragment at the 5 end.

The hybridization temperatures in the experiments with the dxnA1A2, pcpB,and pcpC probes and the 12-kb fragment from pAKE3/5 were set to 60, 62, 58,and 68°C, respectively.

Introduction of a kanamycin resistance cassette into plasmid pNL1. Thesuicide vector pTB200 which carried a fusion between the 5- and 3-flankingregion of an open reading frame (ORF) of unknown function (ORF363) onplasmid pNL1 and a kanamycin resistance (neo) gene was constructed by insert-ing the neo gene into the respective ORF using splicing by overlap extension(SOE) (24). The oligonucleotides PrimerA-Km and PrimerB-Km (for the nu-cleotide sequences of all oligonucleotides, see Table 2) were used to amplify an845-bp fragment of the 5-flanking region of ORF363 by PCR, and the oligonu-

TABLE 2. Oligonucleotides used for the amplification of specific gene probes and construction of hybrid DNA molecules

Primer Sequencea Location in the relevant gene NCBI no.

pcpB-UP ACGATCAACCCGCGCTGG bp 475–492 U60175pcpB-LOW ACGGCGAATGGCAATGCG bp 916–899 U60175pcpC-UP GCGCCGTTTCGAAGCTGC bp 21171–21187 AF512952pcpC-LOW CGATGAAGACCCGTCTGGCG bp 21842–21823 AF512952dxnA1A2-UP CTCTAAGGGACGAAAATGCTGTTG bp 8783–8806 X72850dxnA1A2-LOW GCCTGGCGAGTCTGAATCCTA bp 10714–10694 X72850PrimerA-Km tatatctagaGTAATGCCCTCCCGGTGCTC 5-Flanking sequence of ORF363PrimerB-Km cttgctgtGTTGATCGGCGGCGTG Fusion of 5-flanking sequence ORF363 and 5 neo endPrimerC-Km cgatcaacACAGCAAGCGAACCGG Fusion of 5 neo end and 5-flanking sequence ORF363PrimerD-Km tcccgcgcTCAGAAGAACTCGTCAAGAAGG Fusion of 3 neo end and 3-flanking sequence ORF363PrimerE-Km tcttctgaGCGCGGGACAACGACT Fusion of 3-flanking sequence ORF363 and 3 neo endPrimerF-Km tatagtttaaacAACCGGCCTCCTCTCCCT 3-Flanking sequence of ORF363S2051 tatatctagaACATCAATCTGACGCTCGCG 5-Flanking sequence of ORF6S2052 cttgctgtTACCTGTCTCTCCCGC Fusion of 5 neo end and 5-flanking sequence of

ORF6S2053 gacaggtaACAGCAAGCGAACCGG Fusion of 5-flanking sequence ORF6 and 5 neo endS2054 gacgtcatTCAGAAGAACTCGTCA Fusion of 3-flanking sequence ORF6 and 3 neo endS2055 tcttctgaATGACGTCGATGCAAA Fusion of 3 neo end and 3-flanking sequence ORF6S2056 aataattcatatgAAGCACAACCGTGTTACCCG 3-Flanking sequence of ORF6

a Recognition sequences for restriction endonucleases NdeI, XbaI, and PmeI are underlined; lowercase characters indicate the sequences which are not homologousto the template.

3864 BASTA ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

cleotides PrimerE-Km and PrimerF-Km were used to amplify an 857-bp frag-ment of the 3-flanking region of ORF363 with genomic DNA of S. aromati-civorans F199 as template. To facilitate the further cloning of the SOE product,XbaI and PmeI restriction sites were added to the primers PrimerA-Km andPrimerF-Km, respectively. The neo gene was amplified together with its ownpromoter region using the oligonucleotides PrimerC-Km and PrimerD-Km andpUTminiTn5 (22) as template. This resulted in the amplification of a 960-bpfragment. The three PCR fragments were fused in two subsequent PCRs. In thefirst reaction, the PrimerA-Km and PrimerD-Km were used, and the fragmentobtained in the course of this PCR was finally fused to the third fragment usingPrimerA-Km and PrimerF-Km (for the primer sequences, see Table 2).

The final 2,662-bp SOE product was first introduced into pBluescriptII SK�prepared as T vector (36) to give pTB100. The SOE product was cut out ofpTB100 using XbaI and PmeI and subsequently inserted into XbaI/PmeI-cleavedplasmid pLO3 (35) to give pTB200. The correct insertion of the SOE productinto pTB200 was verified by sequencing with primers B-Seq (5 ACACGCCGGGAGCCAGAT 3) and E-Seq (5 CGGGTAACGCTTCAGGCC 3).

Plasmid pTB200 was conjugatively transferred to S. aromaticivorans F199 in aplate-mating experiment using E. coli S17.1 � pir as donor strain (8). Kanamycin(50 �g/ml)-resistant transconjugants were selected and further investigated. Inorder to obtain clones that had integrated the disrupted form of ORF363 by adouble crossover event, approximately 100 clones were transferred to agar plateswith NB plus kanamycin (50 �g/ml) and with kanamycin (50 �g/ml) plus tetra-cycline (10 �g/ml). Those clones that were kanamycin resistant and tetracyclinesensitive were further studied. In order to verify the correct insertion of the neogene into ORF363 on plasmid pNL1, a PCR experiment was performed withprimers vor363 (5 CGGCGACGACGTTGTGGC 3), which binds upstream ofORF363, and PrimerD-Km and primers hinter363 (5 GGGTGGGATCGGGACATGG 3), which binds downstream of ORF363, and PrimerC-Km. The sizesof the obtained PCR products corresponded to the expected sizes, which impli-cated the disruption of ORF363 by the neo gene. In an additional controlexperiment, the wild-type and the mutated form of pNL1 were separated fromthe chromosomal DNA of the wild-type strain or the presumed mutant of S.aromaticivorans F199 by PFGE. Genomic DNA of both strains was transferredby Southern blotting on a nylon membrane, which was hybridized against aDIG-labeled (Roche) neo probe. As expected, the neo probe hybridized onlywith the mutated form of plasmid pNL1.

Introduction of the kanamycin resistance cassette to plasmid pBN6. Thekanamycin resistance gene was inserted into the coding region (ORF6) for aputative �-subunit of a ring-hydroxylating dioxygenase located on the 180-kbplasmid of S. xenophaga BN6 by using the same SOE strategy previously de-scribed for the disruption of the 1,2-dihydroxynaphthalene dioxygenase gene(27). For this construction, the 5-flanking sequence of ORF6 (1,034 bp) wasamplified by use of the primer pair S2051 and S2052. The neo gene (960 bp) andthe 3-flanking fragment (955 bp) were amplified with the primer pairs S2053-S2054 and S2055-S2056. In the second PCR step, the 5-flanking sequence wasfused to the neo gene (primers S2051 and S2054; 1,978 bp). In the third PCR(primers S2051 and S2056), the 5-flanking sequence neo fusion was joined to the3-flanking sequence (2,917 bp). This PCR fragment was cut with NdeI and XbaIand inserted into conjugative plasmid pAKE35.1 (also cut with NdeI and XbaI),which contains the sacB gene and allows gene replacements to get pAKE36 (26).E. coli S17.1 (57) was transformed with plasmid pAKE36, and the plasmid wasconjugatively transferred to S. xenophaga BN6. Plasmid integration mutants(cointegrates) were isolated on mineral medium agar plates with glucose whichwere supplemented with kanamycin and tetracycline. To isolate integration mu-tants which had lost the vector fragment by double crossover events, the mutantsobtained were transferred to agar plates with glucose plus kanamycin and su-crose (4%, wt/vol).

Conjugative transfer of plasmids. The recipient and donor strains were grownovernight in 125-ml flasks with 20 ml of NB medium which was supplementedwith 50 �g of kanamycin/ml for the donor strains. The cells were harvested bycentrifugation (1 min, 20,000 � g), washed with 1 ml of a saline solution (0.85%[wt/vol] NaCl, 1 mM MgSO4), and resuspended in 50 �l of the saline to yield anoptical density at 546 nm of approximately 40. The donor and recipient cells weremixed and subsequently transferred to sterile filters (cellulose acetate filters,pore size 0.2 �m, 25-mm diameter; Sartorius, Gottingen, Germany) which wereplaced on NB agar plates. In control experiments, the donor and recipient cellswere transferred individually to two separate filters. The cells were incubated at30°C for 8 to 16 h on the filters and resuspended afterwards in 500 �l of saline.From these suspensions, serial dilutions (100 to 10�3) were plated on the selec-tive media. Furthermore, serial dilutions of the donor and recipient cells wereplated on both selective and nonselective agar plates, which served as negativeand positive controls, respectively. To determine the cell numbers of the donor

and recipients, dilutions of approximately 10�7 to 10�9 of donor and recipientcells were plated on NB agar plates. The colonies of the transconjugants ap-peared usually after 2 to 7 days. Some of the colonies were purified first onnonselective and subsequently on selective media and were then subjected toPCR and PFGE analysis.

The media to detect a transfer of the 2NS� (conveying the ability to convertnaphthalene-2-sulfonate) 180-kb plasmid from S. xenophaga BN6 AKE2/5 to therecipient strains contained 50 �g of kanamycin/ml plus the following carbonsources: biphenyl (for S. aromaticivorans F199), malate (for S. yanoikuyae B1 andS. subarctica KF1), and dibenzofuran (for Sphingomonas sp. HH69).

The transfer of plasmid RP1 from S. xenophaga BN6(RP1) to Pseudomonasputida was demonstrated by using Simmons agar plus 40 �g of kanamycin/ml plus10 �g of tetracycline/ml.

Enzyme assays. Naphthalenesulfonate dioxygenase, 1,2-dihydroxynaphthalenedioxygenase, 2-hydroxybenzalpyruvate aldolase-hydratase, and salicylaldehydedehydrogenase were determined as described previously (33).

Chemicals. Naphthalene-2-sulfonic acid was obtained from Bayer AG (Le-verkusen, Germany). All other chemicals were obtained from Sigma-AldrichChemie (Deisenhofen, Germany) or Merck (Darmstadt, Germany). Biochemi-cals were from Roche Diagnostics, and restriction enzymes, RNase, and DNAligase for molecular biology were from MBI Fermentas.

RESULTS

Detection of megaplasmids in different sphingomonads. Acollection of sphingomonads was analyzed which degraded awide range of different xenobiotic compounds, such as polycy-clic aromatic hydrocarbons, chlorinated and sulfonated aro-matics, herbicides, aromatic ethers, and polyethylene glycol(Table 1). The genomic DNA of the strains was analyzed usingPFGE in order to detect plasmids in these strains (Fig. 1). ThePFGE analysis demonstrated that almost all tested Sphingomo-nas strains harbored two to five plasmids with sizes of about 50to 500 kb. Furthermore, in some strains plasmids with sizessmaller than 50 kb were also detected (Table 3).

Sphingomonas plasmids are generally circular. In order toallow a reliable size determination, the plasmid preparations

FIG. 1. Detection of megaplasmids in different Sphingomonasstrains by PFGE. Lane 1, S. wittichii RW1; lane 2, Sphingomonas sp.A175; lane 3, Sphingomonas sp. SS3; lane 4, S. yanoikuyae B1; lane 5,S. paucimobilis EPA505; lane 6, S. chlorophenolica; lane 7, S. subter-ranea; lane 8, S. aromaticivorans F199; lane 9, S. stygia; lane 10, �-DNAstandard.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

for the PFGE analysis were routinely treated with S1 nucleasein order to linearize circular plasmids (see Materials andMethods). In the PFGE, the circular and linear forms of plas-mids can be readily distinguished because the supercoiledforms move slower than the linear forms. Because there wereseveral recent reports about the presence of linear plasmids invarious bacterial species (38), it was determined whether theplasmids detected during the PFGE were circular or linear invivo. Therefore, for all of the sphingomonads analyzed, theplasmid isolation procedures were performed in duplicate withor without the S1 nuclease treatment (for an example, see Fig.

2). Thus, it was found that all detected Sphingomonas plasmidswere presumably circular.

Detection of genes encoding enzymes for the degradation ofnaphthalenesulfonates and dibenzo-p-dioxin on megaplas-mids from S. xenophaga BN6 and S. wittichii RW1. The PFGEanalysis demonstrated the presence of several plasmids in S.xenophaga BN6, S. wittichii RW1, and S. chlorophenolicaATCC 33790 (Table 3). From these three organisms, differentgenes coding for enzymes involved in the degradation of naph-thalenesulfonates, dibenzo-p-dioxin, and pentachlorophenol,respectively, have been described previously by different

FIG. 2. PFGE analysis of the plasmids from different Sphingomonas strains with (a) or without (b) S1 nuclease treatment. Lane 1, S.aromaticivorans B0695; lane 2, S. xenophaga BN6; lane 3, Sphingomonas sp. K39; lane 4, S. herbicidovorans; lane 5, S. subterranea; lane 6,Sphingomonas sp. A175; lane 7, S. paucimobilis Q1; �, �-DNA standard.

TABLE 3. Numbers and sizes of plasmids detected in various Sphingomonas strains

Strain Compounds degraded No. ofplasmids

Approx size(s) ofplasmids (kb)

S. yanoikuyae B1 Toluene, biphenyl, naphthalene, anthracene,phenanthrene

1 240

S. herbicidovorans 2-(2,4-Dichlorophenoxy) propioniate, 2,4-dichlorophenoxypropionic acid, mecoprop

2 300, 160

S. chlorophenolica ATCC 33790 Pentachlorophenol, 2,4,6-trichlorophenol 4 200, 160, 50, �50S. paucimobilis Q1 Toluene, xylene, naphthalene, biphenyl,

anthracene3 240, 80, �50

S. wittichii RW1 (Chlorinated) dibenzo-p-dioxin(s),dibenzofuran(s)

2 340, 240

Sphingomonas sp. HH69 (Acetoxy-, hydroxy-) dibenzofuran(s) 5 230, 150, 70, 50, �50Sphingomonas sp. SS3 (4-Chloro-, 4-fluoro-) diphenylether 3 340, 230, �50S. paucimobilis EPA 505 Fluoranthene, (substituted) naphthalene(s),

phenanthrene, anthracene3 200, 160, 50

Sphingomonas sp. A175 Benzene, 1,4-dichlorobenzene 2 100, �50Sphingomonas sp. K39 2,3,4,6-Tetrachlorophenol 4 290, 280, 180, 120S. xenophaga BN6 (Substituted) naphthalene-2-sulfonate(s) 4 260, 180, 100, 50S. macrogoltabidus Polyethylene glycol 4000 2 450, 150S. subterranea Naphthalene, toluene, biphenyl,

dibenzothiophene, fluorene3 450, 220, 150

S. aromaticivorans F199 Naphthalene, toluene, cresoles, biphenyl,dibenzothiophene, fluorene

2 500, 180

S. aromaticivorans B0695 2-Methylnaphthalene, acenaphthene, anthracene,fluoranthene, phenanthrene

2 195, �50

S. subarctica KF1 2,4,6-Trichlorophenol, 2,3,4,6-tetrachlorophenol 2 300, 220S. stygia Toluene, biphenyl, dibenzothiophene, fluorene 2 290, 120S. paucimobilis Cannot degrade aromatic hydrocarbons 2 340, 150



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

groups (1, 10, 27). However, no further investigations regard-ing the localization of the respective genes in the genomes ofthese three strains were conducted.

The PFGE analysis of the genomic DNA of S. xenophagaBN6 showed four prominent bands which corresponded toplasmids with sizes of about 50, 100, 180, and 260 kb (Table 3).In order to localize the genes encoding the degradative path-way for naphthalenesulfonates, a 12-kb fragment was clonedand labeled which contained the genes encoding the 1,2-dihy-droxynaphthalene dioxygenase and 2-hydroxybenzalpyruvatealdolase-hydratase from the naphthalenesulfonate pathway.The subsequent hybridization experiment demonstrated thatthe genes were localized on the 180-kb plasmid.

In the following experiments, dxnA1A2 (coding for the largeand small subunits of the dibenzo-p-dioxin dioxygenase from S.wittichii RW1) and pcpB and pcpC (coding for the pentachlo-rophenol-4-monooxygenase and tetrachlorohydroquinone de-halogenase, respectively, from S. chlorophenolica ATCC33790) were amplified by PCR and labeled with DIG, andthese probes were hybridized against the genomes of the re-spective strains after PFGE. Thus, it was found that dxnA1A2was localized on an approximately 240-kb plasmid in S. wittichiiRW1 (Fig. 3). A positive hybridization signal was also observedbetween the labeled dxnA1A2 probe and a plasmid with asimilar size from the dibenzofuran-degrading strain Sphin-gomonas sp. HH69. This suggested that dibenzo-p-dioxin anddibenzofuran are oxidized by rather similar dioxygenases by S.wittichii RW1 and Sphingomonas sp. HH69, respectively. Apositive hybridization signal between another dibenzofuran-

degrading sphingomonad and a dxnA1A2 probe obtained fromS. wittichii RW1 has recently also been described by Fukuda etal. (14).

In contrast to the situation with S. xenophaga BN6 and S.wittichii RW1, the hybridization experiments with genomicDNA from S. chlorophenolica ATCC 33790 demonstrated thatpcpB and pcpC were chromosomally located.

Curing of plasmid pBN6 from S. xenophaga BN6. It waspreviously demonstrated that salicylate concentrations of �1mM almost completely inhibited growth of S. xenophaga BN6on glucose (46). This caused a strong selection pressure formutant strains of S. xenophaga which had lost the ability toconvert 2NS to salicylate using a mineral medium with glucoseplus 2NS, because under these conditions the wild-type strainsconverted 2NS to salicylate and are thus inhibited in growth.Therefore, a liquid culture of strain BN6 was grown on NBmedium for approximately 100 generations, and the culturewas then plated on mineral agar plates with glucose (0.5%,wt/vol) which were supplemented with 2NS (1 mM). This re-sulted in two different colony phenotypes: small brown colo-nies, which demonstrated the characteristic growth retardationof strain BN6 in the presence of salicylate, and large colonies(�50% of the total number of colonies), which showed thecharacteristic yellow pigmentation of S. xenophaga BN6. Fourrandom clones which showed the new phenotype (designatedas JK0.1, JK0.2, JK0.3, and JK0.4) were isolated, purified, andmaintained for further biochemical investigations. In subse-quent resting-cell experiments, it was demonstrated that themutant strains did not convert 2NS. Furthermore, no activitiesfor different key enzymes of the naphthalenesulfonate degra-dative pathway (1,2-dihydroxynaphthalene dioxygenase, 2-hy-droxybenzalpyruvate aldolase-hydratase, and salicylaldehydedehydrogenase) were detected in the mutant strains with theenzyme assays previously established (33) (data not shown),and no revertants to the wild-type phenotype could be de-tected.

The mutant strains were analyzed by PFGE, and it wasfound that the 260-, 100-, and 50-kb plasmids were still present,but the mutant strains did not contain the 180-kb plasmid.Furthermore, it was demonstrated in hybridization experi-ments with the 12-kb DNA fragment containing the genesencoding the dihydroxynaphthalene dioxygenase and 2-hy-droxybenzalpyruvate aldolase-hydratase that the mutantstrains indeed showed no hybridization signal.

Introduction of an antibiotic resistance cassette on plas-mids pNL1 from S. aromaticivorans F199 and pBN6 from S.xenophaga BN6. The plasmids from S. aromaticivorans F199and S. xenophaga BN6 were tagged with a kanamycin resis-tance gene in order to test their conjugatability using a strongselective pressure and to avoid any possible problems con-nected to the expression of the respective plasmid-encodeddegradative pathways in different genetic backgrounds. There-fore, suicide vectors were constructed carrying the levan su-crase gene (sacB) and a fusion between the 5- and 3-flankingregions of an ORF (ORF363) with unknown function fromplasmid pNL1 and a ferredoxin reductase gene from plasmidpBN6 and the neo gene from Tn5. The suicide vectors wereconjugatively transferred to S. aromaticivorans F199 and S.xenophaga BN6, respectively, and transconjugants were se-lected on agar plates with kanamycin and tetracycline. The loss

FIG. 3. PFGE analysis of the plasmid profile of S. wittichii RW1and Sphingomonas sp. HH69 (right) and hybridization of the genomicDNAs with a labeled dxnA1A2 probe (left).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

of the integrated vector DNA from plasmid pBN6 was en-forced by the addition of sucrose, as described previously byKeck et al. (27).

Transfer of plasmid pBN6 to a plasmid-free variant of S.xenophaga BN6 and to Sphingomonas sp. SS3. In order todemonstrate the principle feasibility of the attempted conju-gation experiments, a spontaneous nalidixinic acid-resistantderivative of the cured 2NS� mutant of S. xenophaga BN6described above was produced. This strain was used as a po-tential recipient in a conjugation experiment with the S. xe-nophaga BN6 derivative, which carried the kanamycin resis-tance gene, as the donor strain (BN6 AKE2/5). The kanamycinresistance was conjugatively transferred by a plate mating tothe plasmid-free nalidixin-resistant 2NS� mutant of strain BN6(JK0.1) with a conjugation rate of 1.1 � 10�6 transconjugantsper recipient.

In the following experiments, S. xenophaga BN6 AKE2/5 wasused as the donor in different conjugation experiments withdifferent sphingomonads as putative recipient strains. The se-lection for transconjugants in these experiments was per-formed using carbon sources which were only utilized by thepresumed plasmid recipient strains and the antibiotic resis-tance encoded on the recombinant derivative of plasmidpBN6. A plasmid transfer was only observed in a mating of S.xenophaga BN6 AKE2/5 with Sphingomonas sp. SS3 with aconjugation rate of 5 � 10�7 transconjugants per recipient.Transconjugants were selected for their ability to grow withdiphenylether in the presence of kanamycin, and the transferof the neo gene was additionally confirmed by PCR. S. xe-nophaga BN6 and Sphingomonas sp. SS3 could be easily dif-ferentiated by the colors of their respective colonies (brightyellow versus dark yellow). As expected, all transconjugantcolonies demonstrated the typical appearance of Sphingomo-nas sp. SS3. The subsequent PFGE analysis revealed unex-pected plasmid patterns in all of the investigated transconju-gants (Fig. 4). These PFGEs suggested that the endogenousplasmids of strain Sphingomonas sp. SS3 seemed not to haveundergone any obvious changes but that in all transconjugantsthe “incoming” plasmid from strain BN6 had undergone sig-

nificant alterations in size. In order to localize the neo genewhich had been introduced by the plasmid from strain BN6, ahybridization experiment was performed using a neo geneprobe. The probe hybridized with plasmids of significantly dif-ferent sizes, ranging from approximately 50 kb up to approxi-mately 290 kb (Fig. 4). This suggested that the plasmid pBN6in its original structure is possibly not stable in Sphingomonassp. SS3. Furthermore, out of five investigated transconjugants,four carried different plasmid patterns, suggesting that thereare different ways to stabilize the plasmid from strain BN6after transfer to strain SS3.

In further conjugation experiments with S. aromaticivoransF199, S. yanoikuyae B1, S. subarctica KF1, and Sphingomonassp. HH69, no indications for transfer of the 2NS� 180-kbplasmid from S. xenophaga BN6 AKE2/5 to the recipientstrains were detected.

Transfer of plasmid pNL1 from S. aromaticivorans F199 todifferent Sphingomonas strains. A comparison of the carbonsources utilized by S. yanoikuyae B1 and S. aromaticivoransF199 demonstrated that malate supported growth of S.yanoikuyae B1 but not of S. aromaticivorans F199. Therefore,putative transconjugants were selected on malate (5 mM) pluskanamycin (50 �g/ml). After 24 h, this selection already re-sulted in the formation of visible colonies on the selectivemedium. In contrast, no colonies were formed on the controlplates with the strains plated separately on the same medium.The conjugation frequency was estimated to be 2 � 10�4

transconjugants per recipient. The color and the morphologyof the colonies formed by the transconjugants (whitish yellow)clearly demonstrated that S. yanoikuyae B1 and not S. aromati-civorans F199 served as recipient, because the latter strainformed brighter yellow colonies on all media used. In order toprove the conjugative transfer of plasmid pNL1 to S.yanoikuyae B1, several of the presumed transconjugants wereanalyzed by PFGE, and the presence of a plasmid with theexpected size was observed for all transconjugants. It wastherefore deduced that plasmid pNL1 was indeed conjuga-tively transferable to S. yanoikuyae B1. In similar experiments,the transfer of the antibiotic resistance genes was demon-

FIG. 4. PFGE of the total DNA of different transconjugants, which were obtained after the conjugation of S. xenophaga BN6 AKE2/5 Kmr withSphingomonas sp. SS3 (right), and Southern hybridization of the gel using a neo probe (left). Lanes: 1, Sphingomonas sp. SS3; 2, S. xenophagaAKE2/5; 3 to 7. transconjugants; 8, � DNA standard.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

strated between S. aromaticivorans F199 and Sphingomonas sp.SS3 (selection for growth on diphenylether plus 50 �g of kana-mycin/ml) and S. aromaticivorans F199 and S. herbicidovorans[selection for growth on 2-(2,4-dichlorophenoxy)propionateplus 50 �g of kanamycin/ml]. Also in these experiments, atransfer of plasmid pNL1 could be confirmed by the size andcolor of the respective colonies formed by the transconjugants.The analysis of the plasmid pattern in the transconjugantsclearly demonstrated the presence of an additional plasmidwith the size of pNL1. No transfer of pNL1 could be detectedto S. wittichii RW1, S. subarctica KF1, and S. chlorophenolicaATCC 33790.

Plasmid rearrangements after the transfer of plasmid pNL1to Sphingomonas sp. HH69. A transfer of the kanamycin resis-tance gene was also detected in a conjugation experiment withS. aromaticivorans F199 and Sphingomonas sp. HH69 (select-ing for growth on dibenzofuran and 50 �g of kanamycin/ml). Incontrast to the experiments with S. yanoikuyae B1, Sphingomo-nas sp. SS3, and S. herbicidovorans, in this case massive alter-ations were observed in the plasmid pattern of the transcon-jugants (Fig. 5). An analysis of the different transconjugantssuggested that all transconjugants had lost the 240-kb plasmid,which hybridized with the dxnA1A2 gene probe (see above)and which therefore presumably coded for at least part of thedibenzofuran degradation pathway in Sphingomonas sp. HH69.It was therefore investigated, in hybridization experiments, ifthe transconjugants harbored the dxnA1A2 genes on differentloci. These experiments demonstrated that in some of thetransconjugants (e.g., the transconjugants shown in Fig. 5,lanes 4 and 5), the dxnA1A2 genes were found on the chromo-some. In contrast, in some other transconjugants (e.g., the oneshown in Fig. 5, lane 6), the gene(s) hybridizing with dxnA1A2was found on a newly formed 320-kb plasmid.

Attempts to transfer plasmid pNL1 from S. aromaticivoransF199 to bacteria not belonging to the genus Sphingomonas. Theability of a conjugative transfer of pNL1 was also tested with

different bacteria belonging to various genera within the �-, �-,and �-subgroups of Proteobacteria (Table 4). No indications fora transfer of plasmid pNL1 to bacteria belonging to the �- or�-subgroup of Proteobacteria could be detected. The only ex-ample for a transfer of plasmid pNL1 to a strain not belongingto the genus Sphingomonas was obtained with Porphyrobactersanguineus DSM 11032, which is also a member of the familySphingomonadaceae and which has been described as an aer-obic bacteriochlorophyll a-containing organism with the abilityto degrade biphenyl and dibenzofuran (23).

Transfer of plasmid RP1 from S. xenophaga BN6 to otherbacterial genera. The outer membranes of sphingomonadscontain huge amounts of sphingoglycolipids instead of lipid A,which is almost ubiquitously found among other Proteobacteria(25). This was a possible reason for the restrictions in plasmidtransfer from Sphingomonas strains to other Proteobacteria,because these differences could influence cell aggregation orchange the functionality of pili and other structures involved inthe conjugative transfer of DNA. The transfer of broad-host-range plasmids of the incompatibility group P-1 from E. coli toS. xenophaga BN6 had been previously demonstrated (53). Thetransfer of plasmid RP1 (49) from S. xenophaga BN6(RP1) toP. putida was achieved in a plate-mating experiment with aconjugation frequency of 2.3 � 10�6. Plasmid RP1 was alsosuccessfully transferred in similar conjugation experimentsfrom S. xenophaga BN6(RP1) to most of the strains tested inthe previous experiments as possible recipient strains for thetransfer of plasmid pNL1 (Table 5). This demonstrated that, inprinciple, the transfer of plasmids from Sphingomonas strainsto nonsphingomonads is possible.

DISCUSSION

The present study clearly demonstrates that large plasmidsare ubiquitous in sphingomonads and are very important forthe degradation of various harmful and/or xenobiotic com-

FIG. 5. PFGE of the total DNA of different transconjugants, which were obtained after the conjugation of S. aromaticivorans F199 Kmr withSphingomonas sp. HH69 (left) and Southern hybridization of DNA from the gel using a dxnA1A2 probe (right). Lane 1, �-DNA standard; lane 2,S. aromaticivorans F199 Kmr; lane 3, Sphingomonas sp. HH69; lane 4, Sphingomonas sp. HH69-1 transconjugant; lane 5, Sphingomonas sp. HH69-2transconjugant; lane 6, Sphingomonas sp. HH69-3 transconjugant.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

pounds by this group of organisms. In previous work, it wasreported that plasmids are presumably involved in the degra-dation of naphthalene, biphenyl, toluene, and carbazole bysphingomonads (6, 12, 47, 52). We have obtained evidence thatin different sphingomonads the degradative pathways for naph-thalenesulfonates, dibenzo-p-dioxin, and dibenzofuran are alsoencoded on plasmids. Therefore, it is very probable that withthe progress in the detection and sequencing of genes involvedin the degradation of xenobiotics by sphingomonads, the ma-jority of the genes will be detected on large plasmids similar tothose described here. The degradative plasmids in sphin-gomonads generally appear to be larger (160 to 240 kb) thanthe previously studied degradative plasmids from pseudo-monads, such as the TOL (117 kb) or NAH (usually 80 to 120kb) plasmid(s) (18, 70). This explains why Sphingomonas plas-mids are only reproducibly detected by PFGE and not bypreviously established plasmid isolation procedures, such asagarose gel electrophoresis or CsCl gradient centrifugation.

It was clearly demonstrated in the course of the presentstudy that plasmid pNL1 could be conjugatively transferredfrom S. aromaticivorans F199 to S. yanoikuyae B1, Sphingomo-nas sp. SS3, and S. herbicidovorans. These four strains belongto different subgroups within the genus Sphingomonas sensulato and would be classified in the scheme suggested by Takeu-chi et al. (62) as members of the genera Novosphingobium (S.aromaticivorans) and Sphingobium (S. yanoikuyae and S. herbi-cidovorans). The conjugatability of plasmid pNL1 was alsosuggested by the previously performed sequence analysis of the

plasmid, which demonstrated the presence of three gene clus-ters encoding homologs of the E. coli F plasmid required forconjugative sex pilus formation and mating-pair stabilization(52). In contrast, it appears that the host range of the plasmidpBN6 from S. xenophaga BN6 is much more restricted, becausefor this plasmid only a transfer to Sphingomonas sp. SS3 wasobserved.

The generally observed presence of several plasmids withinsingle isolates suggested that there are plasmids belonging toseveral incompatibility groups present in Sphingomonasstrains. The major rearrangements observed in the plasmidpattern after the attempted transfer of pNL1 to Sphingomonassp. HH69 might be an indication that a plasmid from the sameincompatibility group is present in strain HH69 and thus mayprevent the establishment of plasmid pNL1 in this host.

According to the results of the present study, the plasmidsfound within the Sphingomonas strains are transferable by con-jugation among different Sphingomonas strains (and presum-ably some closely related genera) but are presumably onlyrarely transferred to other Proteobacteria. Thus, this will resultin a reduced gene flow from the sphingomonads to other bac-teria. This is probably one of the reasons for the comparablelow degree of sequence homology between Sphingomonasgenes and those from other Proteobacteria which have beendetected during sequence analysis and hybridization experi-ments with different 2,4-dichlorophenoxyacetate- or biphenyl-degrading bacteria (15, 16, 29). A similar conclusion has re-cently also been obtained from the molecular analysis of the

TABLE 4. Bacterial strains and selection conditions used in order to demonstrate the transfer of plasmid pNL1 from S. aromaticivorans F199to nonsphingomonadsa

Strain DSM no. Taxonomical classification Selection medium Transfer frequencyof pNL1

Porphyrobacter sanguineus 11032 �-Proteobacteria; Sphingomonadales;Sphingomonadaceae

MBM � Km (200 �g/ml) 1.9 � 10�4

Rhizobium radiobacter 30147 �-Proteobacteria; Rhizobiales;Rhizobiaceae

Malate (5 mM) � Tc (10 �g/ml) No transfer

Brevundimonas subvibrioides 4375 �-Proteobacteria; Caulobacteriales;Caulobacteriaceae

MBM � Km (200 �g/ml) No transfer

Pigmentiphaga kullae 13608 �-Proteobacteria; Burkholderiales;Alcaligenaceae

Simmons agar � Km (50 �g/ml) No transfer

Burkholderia glathei 50014 �-Proteobacteria; Burkholderiales;Burkholderiaceae


Serratia proteamaculans 4597 �-Proteobacteria; Enterobacteriales;Enterobacteriaceae


Pseudomonas putida 291 �-Proteobacteria; Pseudomonadales;Pseudomonadaceae


a MBM, marine broth medium (DSMZ medium 514); Km, kanamycin; Tc, tetracycline.

TABLE 5. Transfer of plasmid RP1 from S. xenophaga BN6 to different bacterial strainsa

Recipient strain Selective mediumTransfer frequency of

RP1 (per recipientcell)

Rhizobium radiobacter MM � malate (5 mM) � Km (40 �g/ml) � Tc (10 �g/ml)b 7.2 � 10�7

Pigmentiphaga kullae Simmons agar � Km (40 �g/ml) � Tc (10 �g/ml) 1.1 � 10�4

Burkholderia glathei Simmons agar � Km (40 �g/ml) � Tc (10 �g/ml) 4 � 10�8

Serratia proteamaculans Simmons agar � Km (40 �g/ml) � Tc (10 �g/ml) 2.4 � 10�4

Pseudomonas putida Simmons agar � Km (40 �g/ml) � Tc (10 �g/ml) 2.3 � 10�6

a MBM, marine broth medium (DSMZ medium 514); Km, kanamycin; Tc, tetracycline; MM, mineral medium.b MM containing malate as a single source of carbon and energy did not support the growth of S. xenophaga BN6(RP1).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

distribution of the pcpB gene within a Finnish groundwatersupply heavily polluted with chlorinated phenols. In this study,it was demonstrated that highly similar or identical copies ofthe pcpB gene could be found among different sphingomonadsbut that homologous genes were totally absent from nonsphin-gomonads which also degraded chlorophenols (65). A possiblereason for the reduced (or maybe abolished) plasmid transferrates from Sphingomonas strains (and closely related genera)to other Proteobacteria could be that specific Sphingomonasplasmids exist which are only able to transfer among or toreplicate within Sphingomonas strains.

It was initially assumed that a further possible reason for therestrictions in plasmid transfer from Sphingomonas strains toother Proteobacteria could be due to the composition of theouter membranes of sphingomonads. These outermost cellularstructures of the sphingomonads differ from those of otherProteobacteria because they contain huge amounts of sphingo-glycolipids instead of lipid A, which is almost ubiquitouslyfound among other Proteobacteria (25). We could exclude aprinciple impediment of plasmid transfer by these differencesbecause it was possible to transfer the broad-host-range plas-mid RP1 from S. xenophaga BN6 to various Proteobacteria.Although the observed conjugation frequencies in the range of10�4 to 10�8 transconjugants per recipient appear to be ratherlow, similar conjugation frequencies have also been observedfor various intergeneric conjugation experiments with plasmidRP1 (48).

Although we could clearly demonstrate in our present studythe importance of plasmids for the degradation of xenobioticcompounds by Sphingomonas strains, it is also evident thatdegradative genes may in some cases also be found encoded onthe bacterial chromosome. Thus, it was previously found thatthe genes coding for the degradative pathways for naphtha-lene, biphenyl, and toluene are encoded on plasmid pNL1 in S.aromaticivorans F199 but that the homologous pathways arechromosomally encoded in S. yanoikuyae B1 and S. paucimo-bilis Q1 (29). A similar situation might exist for the location ofthe genes involved in the degradation of pentachlorophenol.Although we could demonstrate in the present study that thegenes coding for pentachlorophenol degradation by S. chloro-phenolica ATCC 33790 are chromosomally located, a very re-cent study presented strong evidence for a natural horizontaltransfer of the pcpB gene among different sphingomonadswithin a Finnish groundwater treatment plant (65). This mayindicate that even in the case of currently chromosomally en-coded pathways in sphingomonads, some recent plasmid ex-change events have taken place.

REFERENCES

1. Armengaud, J., B. Happe, and K. N. Timmis. 1998. Genetic analysis of dioxindioxygenase of Sphingomonas sp. RW1: catabolic genes dispersed on thegenome. J. Bacteriol. 180:3954–3966.

2. Balkwill, D. L., G. R. Drake, R. H. Reeves, J. K. Fredrickson, D. C. White,D. B. Ringelberg, D. P. Chandler, M. F. Romine, D. W. Kennedy, and C. M.Spadoni. 1997. Taxonomic study of aromatic-degrading bacteria from deep-terrestrial-subsurface sediments and description of Sphingomonas aromati-civorans sp. nov., Sphingomonas subterranea sp. nov., and Sphingomonasstygia sp. nov. Int. J. Syst. Bacteriol. 47:191–201.

3. Baraniecki, C. A., J. Aislabie, and J. M. Foght. 2002. Characterization ofSphingomonas sp. Ant 17, an aromatic hydrocarbon-degrading bacteriumisolated from Antarctic soil. Microb. Ecol. 43:44–54.

4. Barton, B. M., G. P. Hardening, and A. J. Zuccarelli. 1995. A generalmethod for detecting and sizing large plasmids. Anal. Biochem. 226:234–240.

5. Cai, M., and L. Xun. 2002. Organization and regulation of pentachlorophe-

nol-degrading genes in Sphingobium chlorophenolicum ATCC 39723. J. Bac-teriol. 184:4672–4680.

6. Cho, J. C., and S. J. Kim. 2001. Detection of mega plasmid from polycyclicaromatic hydrocarbon-degrading Sphingomonas sp. strain KS14. J. Mol. Mi-crobiol. Biotechnol. 3:503–506.

7. Chung, C. T., S. L. Niemela, and R. H. Miller. 1989. One-step preparation ofcompetent Escherichia coli: transformation and storage of bacterial cells inthe same solution. Proc. Natl. Acad. Sci. USA 86:2172–2175.

8. DeLorenzo, V., and K. N. Timmis. 1994. Analysis and construction of stablephenotypes in gram-negative bacteria with Tn5 and Tn10-derived minitrans-posons. Methods Enzymol. 235:386–405.

9. Dorn, E., M. Hellwig, W. Reineke, and H.-J. Knackmuss. 1974. Isolation andcharacterization of a 3-chlorobenzoate degrading pseudomonad. Arch. Mi-crobiol. 99:61–70.

10. Ederer, M. M., R. L. Crawford, R. P. Herwig, and C. S. Orser. 1997. PCPdegradation is mediated by closely related strains of the genus Sphingomo-nas. Mol. Ecol. 6:39–49.

11. Eguchi, M., M. Ostrowski, F. Fegatella, J. Bowman, D. Nichols, T. Nishino,and R. Cavicchioli. 2001. Sphingomonas alaskensis strain AFO1, an abundantoligotrophic ultramicrobacterium from the North Pacific. Appl. Environ.Microbiol. 67:4945–4954.

12. Feng, X., L.-T. Ou, and A. Ogram. 1997. Plasmid-mediated mineralization ofcarbofuran by Sphingomonas sp. CF-06. Appl. Environ. Microbiol. 63:1332–1337.

13. Fredrickson, J. K., D. L. Balkwill, G. R. Drake, M. F. Romine, D. B. Rin-gelberg, and D. C. White. 1995. Aromatic-degrading Sphingomonas isolatesfrom the deep surface. Appl. Environ. Microbiol. 61:1917–1922.

14. Fukuda, K., S. Nagata, and H. Taniguchi. 2002. Isolation and characteriza-tion of dibenzofuran-degrading bacteria. FEMS Microbiol. Lett. 208:179–185.

15. Fulthorpe, J. J., C. McGowan, O. V. Maltseva, W. E. Holben, and J. M.Tiedje. 1995. 2,4-Dichlorophenoxyacetic acid-degrading bacteria containmosaic of catabolic genes. Appl. Environ. Microbiol. 61:3274–3281.

16. Furukawa, K., N. Hayase, K. Taira, and N. Tomizuka. 1989. Molecularrelationship of chromosomal genes encoding biphenyl/polychlorinated bi-phenyl catabolism: some soil bacteria possess highly conserved bph operons.J. Bacteriol. 171:5467–5472.

17. Furukawa, K., J. R. Simon, and A. M. Chakrabarty. 1983. Common induc-tion and regulation of biphenyl, xylene/toluene, and salicylate catabolism inPseudomonas paucimobilis. J. Bacteriol. 154:1356–1362.

18. Greated, A., L. Lambertsen, P. A. Williams, and C. M. Thomas. 2002.Complete sequence of the IncP-9 TOL plasmid pWW0 from Pseudomonasputida. Environ. Microbiol. 4:856–871.

19. Harayama, S., and M. Rekik. 1990. The meta cleavage operon of TOLdegradative plasmid pWW0 comprises 13 genes. Mol. Gen. Genet. 221:113–120.

20. Harms, H., H. Wilkes, R.-M. Wittich, and P. Fortnagel. 1995. Metabolism ofhydroxydibenzofurans, methoxybenzofurans, acetoxydibenzofurans, and nit-rodibenzofurans by Sphingomonas sp. HH69. Appl. Environ. Microbiol. 61:2499–2505.

21. Harwood, C. S., and R. E. Parales. 1996. The �-ketoadipate pathway and thebiology of self-identity. Annu. Rev. Microbiol. 50:553–590.

22. Herrero, M., V. de Lorenzo, and K. N. Timmis. 1990. Transposon vectorscontaining non-antibiotic resistance selection markers for cloning and stablechromosomal insertion of foreign genes in gram-negative bacteria. J. Bacte-riol. 172:6557–6567.

23. Hiraishi, A., Y. Yonemitsu, M. Matsushita, Y. K. Shin, H. Kuraishi, and K.Kawahara. 2002. Characterization of Porphyrobacter sanguineus sp. nov., anaerobic bacteriophyll-containing bacterium capable of degrading biphenyland dibenzofuran. Arch. Microbiol. 178:45–52.

24. Horton, R. M., D. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989.Engineering hybrid genes without the use of restriction enzymes: gene splic-ing by overlap extension. Gene 77:61–68.

25. Kawasaki, S., R. Moriguchi, K. Sekiya, T. Nakai, E. Ono, K. Kume, and K.Kawahara. 1994. The cell envelope structure of the lipopolysaccharide-lacking gram-negative bacterium Sphingomonas paucimobilis. J. Bacteriol.176:284–290.

26. Keck, A. 2000. Conversion of azo dyes by a redox mediator dependentmechanism which is linked to the naphthalenesulfonate degradation ofSphingomonas sp. strain BN6. Ph.D. thesis. Universitat Stuttgart, Stuttgart,Germany.

27. Keck, A., J. Rau, T. Reemstma, R. Mattes, A. Stolz, and J. Klein. 2002.Identification of quinoide redox mediators that are formed during the deg-radation of naphthalene-2-sulfonate by Sphingomonas xenophaga BN6. Appl.Environ. Microbiol. 68:4341–4349.

28. Khan, A. A., R.-F. Wang, W.-W. Cao, W. Franklin, and C. E. Franklin. 1996.Reclassification of a polycyclic aromatic hydrocarbon-metabolizing bacte-rium, Beijerinckia sp. strain B1, as Sphingomonas yanoikuyae by fatty acidanalysis, protein pattern analysis, DNA-DNA hybridization, and 16S ribo-somal DNA sequencing. Int. J. Syst. Bacteriol. 46:466–469.

29. Kim, E., P. J. Aversano, M. F. Romine, R. P. Schneider, and G. J. Zylstra.1996. Homology between genes for aromatic hydrocarbon degradation in



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

surface and deep-subsurface Sphingomonas strains. Appl. Environ. Micro-biol. 62:1467–1470.

30. Kim, E., and G. J. Zylstra. 1995. Molecular and biochemical characterizationof two meta-cleavage dioxygenases involved in biphenyl and m-xylene deg-radation by Beijerinckia sp. strain B1. J. Bacteriol. 177:3095–3103.

31. Kim, H., M. Nishiyama, T. Kunito, K. Senoo, K. Kawahara, K. Murakami,and H. Oyaizu. 1998. High population of Sphingomonas species on plantsurface. J. Appl. Microbiol. 85:731–736.

32. Koskinen, R., T. Ali-Vehmas, P. Kampfer, M. Laurikkala, I. Tsitko, E.Kostyal, F. Atroshi, and M. Salkinoja-Salkonen. 2000. Characterization ofSphingomonas isolates from Finnish and Swedish drinking water distributionsystems. J. Appl. Microbiol. 89:687–696.

33. Kuhm, A. E., A. Stolz, K.-L. Ngai, and H.-J. Knackmuss. 1991. Purificationand characterization of a 1,2-dihydroxynaphthalene dioxygenase from a bac-terium that degrades naphthalenesulfonic acids. J. Bacteriol. 173:3795–3802.

34. Kumari, R., S. Subudhi, M. Suar, G. Dhingra, V. Raina, C. Dogra, S. Lal,J. R. van der Meer, C. Holliger, and R. Lal. 2002. Cloning and character-ization of lin genes responsible for the degradation of hexachlorocyclohex-ane isomers by Sphingomonas paucimobilis strain B90. Appl. Environ. Mi-crobiol. 68:6021–6028.

35. Lenz, O., E. Schwartz, J. Dernedde, M. Eitinger, and B. Friedrich. 1994. TheAlcaligenes eutrophus H16 hoxX gene participates in hydrogenase regulation.J. Bacteriol. 176:4385–4393.

36. Marchuk, D., M. Drumm, A. Saulino, and F. S. Collins. 1991. Constructionof T-vectors, a rapid and general system for direct cloning of unmodifiedPCR products. Nucleic Acids Res. 19:1154.

37. Masai, E., S. Shinohara, H. Hara, S. Nishikawa, Y. Katayama, and M.Fukuda. 1999. Genetic and biochemical characterization of a 2-pyrone-4,6-dicarboxylic acid hydrolase involved in the protocatechuate 4,5-cleavagepathway of Sphingomonas paucimobilis SYK-6. J. Bacteriol. 181:55–62.

38. Meinhardt, F., R. Schaffrath, and M. Larsen. 1997. Microbial linear plas-mids. Appl. Microbiol. Biotechnol. 47:329–336.

39. Miyauchi, K., S.-K. Suh, Y. Nagata, and M. Takagi. 1998. Cloning andsequencing of a 2,5-dichlorohydroquinone reductive dehalogenase genewhose product is involved in degradation of �-hexachlorocyclohexane bySphingomonas paucimobilis. J. Bacteriol. 180:1354–1359.

40. Mueller, J. G., R. Devereux, D. L. Santavy, S. E. Lantz, S. G. Willis, and P. H.Pritchard. 1997. Phylogenetic and physiological comparison of PAH-degrad-ing bacteria from geographically diverse soils. Antonie Leeuwenhoek 71:329–343.

41. Nagata, Y., M. Miyauchi, and M. Takagi. 1999. Complete analysis of genesand enzymes for �-hexachlorocyclohexane degradation in Sphingomonaspaucimobilis UT26. J. Ind. Microbiol. 23:380–390.

42. Nagata, Y., R. Ohtomo, K. Miyauchi, M. Fukuda, K. Yano, and M. Takagi.1994. Cloning and sequencing of a 2,5-dichloro-2,5-cyclohexadiene-1,4-dioldehydrogenase gene involved in the degradation of �-hexachlorocyclohexanein Pseudomonas paucimobilis. J. Bacteriol. 176:3117–3125.

43. Nohynek, L. J., E.-L. Nurmiaho-Lassila, E. L. Suhonen, H.-J. Busse, M.Mohammadi, J. Hantula, F. Rainey, and M. Salkinoja-Salonen. 1996. De-scription of chlorophenol-degrading Pseudomonas sp. strains KF1, KF3, andNKF1 as a new species of the genus Sphingomonas, Sphingomonas subarcticasp. nov. Int. J. Syst. Bacteriol. 46:1042–1055.

44. Nohynek, L. J., E. L. Suhonen, E.-L. Nurmiaho-Lassila, J. Hantula, and M.Salkinoja-Salonen. 1995. Description of four pentachlorophenol-degradingbacterial strains as Sphingomonas chlorophenolica sp. nov. Syst. Appl. Mi-crobiol. 18:527–538.

45. Nortemann, B., J. Baumgarten, H. G. Rast, and H.-J. Knackmuss. 1986.Bacterial communities degrading amino- and hydroxynaphthalenesulfonates.Appl. Environ. Microbiol. 52:1195–1202.

46. Nortemann, B., A. E. Kuhm, H.-J. Knackmuss, and A. Stolz. 1994. Conver-sion of substituted naphthalenesulfonates by Pseudomonas sp. BN6. Arch.Microbiol. 161:320–327.

47. Ogram, A. V., Y.-P. Duan, S. L. Trabue, X. Feng, H. Castro, and L.-T. Ou.2000. Carbofuran degradation mediated by three related plasmid systems.FEMS Microbiol. Ecol. 32:197–203.

48. Olsen, R. H., and P. Shipley. 1973. Host range and properties of the Pseudo-monas aeruginosa R factor R1822. J. Bacteriol. 113:772–780.

49. Pansegrau, W., E. Lanka, P. T. Barth, D. H. Figurski, D. G. Guiney, D. Haas,D. R. Helinski, H. Schwab, V. A. Stanisich, and C. M. Thomas. 1994.Complete nucleotide sequence of Birmingham IncP� plasmids—compilationand comparative analysis. J. Mol. Biol. 239:623–663.

50. Pinyakong, O., H. Habe, and T. Omori. 2003. The unique aromatic catabolicgenes in sphingomonads degrading polycyclic aromatic hydrocarbons.J. Gen. Appl. Microbiol. 49:1–9.

51. Riegert, U., S. Burger, and A. Stolz. 2001. Altering catalytical properties of3-chlorocatechol-oxidizing extradiol dioxygenase from Sphingomonas xe-nophaga BN6 by random mutagenesis. J. Bacteriol. 183:2322–2330.

52. Romine, M. F., L. C. Stillwell, K.-K. Wong, S. J. Thurston, E. C. Sisk, C.Sensen, T. Gaasterland, J. K. Fredrickson, and J. D. Saffer. 1999. Complete

sequence of a 184-kilobase catabolic plasmid from Sphingomonas aromati-civorans F199. J. Bacteriol. 181:1585–1602.

53. Ru�, R. 1996. Verbesserung der Abbauleistung des Bakterienstammes BN6gegenuber sulfonierten aromatischen Verbindungen-Vergleich zwischen Hy-bridorganismus und Mischkultur. Ph.D. thesis. Universitat Stuttgart, Stutt-gart, Germany.

54. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor,N.Y.

55. Schmidt, S., R.-M. Wittich, D. Erdmann, H. Wilkes, W. Francke, and P.Fortnagel. 1992. Biodegradation of diphenyl ether and its monohalogenatedderivatives by Sphingomonas sp. strain SS3. Appl. Environ. Microbiol. 58:2744–2750.

56. Shi, T., J. K. Fredrickson, and D. L. Balkwill. 2001. Biodegradation ofpolycyclic aromatic hydrocarbons by Sphingomonas strains isolated from theterrestrial subsurface. J. Ind. Microbiol. Biotechnol. 26:283–289.

57. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:784–791.

58. Stolz, A., C. Schmidt-Maag, E. B. M. Denner, H.-J. Busse, T. Egli, and P.Kampfer. 2000. Description of Sphingomonas xenophaga sp. nov. for strainsBN6T and N,N which degrade xenobiotic aromatic compounds. Int. J. Syst.Bacteriol. 50:35–41.

59. Stolz, A. 1999. Degradation of substituted naphthalenesulfonic acids bySphingomonas xenophaga BN6. J. Ind. Microbiol. Biotechnol. 23:391–399.

60. Sugimoto, M., M. Tanabe, M. Hataya, S. Enokibara, J. A. Duine, and F.Kawai. 2001. The first step in polyethylene glycol degradation by sphin-gomonads proceeds via a flavoprotein alcohol dehydrogenase containingflavin adenine dinucleotide. J. Bacteriol. 183:6694–6698.

61. Taira, K., N. Hayase, N. Arimura, S. Yamashita, T. Miyazaki, and K. Fu-rukawa. 1988. Cloning and nucleotide sequence of the 2,3-dihydroxybiphenyldioxygenase gene from the PCB-degrading strain of Pseudomonas paucimo-bilis Q1.0 Biochemistry 27:3990–3996.

62. Takeuchi, M., K. Hamana, and A. Hiraishi. 2001. Proposal of the genusSphingomonas sensu stricto and three new genera, Sphingobium, Novosphin-gobium and Sphingopyxis, on the basis of phylogenetic and chemotaxonomicanalyses. Int. J. Syst. Evol. Microbiol. 51:1405–1417.

63. Takeuchi, M., F. Kawai, Y. Shimada, and A. Yokota. 1993. Taxonomic studyof polyethylene glycol-utilizing bacteria: emended description of the genusSphingomonas and new descriptions of Sphingomonas macrogoltabidus sp.nov., Sphingomonas sanguis sp. nov. and Sphingomonas terrae sp. nov. Syst.Appl. Bacteriol. 16:2227–2238.

64. Tiirola, M. A., M. K. Mannisto, J. A. Puhakka, and M. S. Kulomaa. 2002.Isolation and characterization of Novosphingobium sp. strain MT1, a domi-nant polychlorophenol-degrading strain in a groundwater bioremediationsystem. Appl. Environ. Microbiol. 68:173–180.

65. Tiirola, M. A., H. Wang, L. Paulin, and M. S. Kulomaa. 2002. Evidence fornatural horizontal transfer of the pcpB gene in the evolution of pentachlo-rophenol-degrading sphingomonads. Appl. Environ. Microbiol. 68:4495–4501.

66. Wattiau, P., L. Bastiaens, R. van Herwijnen, L. Daal, J. R. Parsons, M.-E.Renard, D. Springael, and G. R. Cornelis. 2001. Flourene degradation bySphingomonas sp. LB126 proceeds through protocatechuic acid: a geneticanalysis. Res. Microbiol. 152:861–872.

67. Wittich, R.-M., H. Wilkes, V. Sinnwell, W. Francke, and P. Fortnagel. 1992.Metabolism of dibenzo-p-dioxin by Sphingomonas sp. strain RW1. Appl.Environ. Microbiol. 58:1005–1010.

68. Yabuuchi, E., H. Yamamoto, S. Terakubo, N. Okamura, T. Naka, N. Fuji-wara, K. Kobayashi, Y. Kosako, and A. Hiraishi. 2001. Proposal of Sphin-gomonas wittichii sp. nov. for strain RW1T, known as a dibenzo-p-dioxinmetabolizer. Int. J. Syst. Evol. Microbiol. 51:281–292.

69. Yabuuchi, E., I. Yano, H. Oyaizu, Y. Hashimoto, T. Ezaki, and H.Yamamoto. 1990. Proposals of Sphingomonas paucimobilis gen. nov. andcomb. nov., Sphingomonas parapaucimobilis sp. nov., Sphingomonasyanoikuyae sp. nov., Sphingomonas adhaesiva sp. nov., Sphingomonas capsu-lata comb. nov., and two genospecies of the genus Sphingomonas. Microbiol.Immunol. 34:99–119.

70. Yen, K.-M., and C. M. Serdar. 1988. Genetics of naphthalene catabolism inpseudomonads. Crit. Rev. Microbiol. 15:247–268.

71. Yrjala, K., S. Suomalainen, E. L. Suhonen, S. Kilpi, L. Paulin, and M.Romantschuk. 1998. Characterization and reclassification of an aromatic-and chloroaromatic-degrading Pseudomonas sp., strain HV3, as Sphingomo-nas sp. HV3. Int. J. Syst. Bacteriol. 48:1057–1062.

72. Zipper, C., K. Nickel, W. Angst, and H.-P. Kohler. 1996. Complete microbialdegradation of both enantiomers of the chiral herbicide mecoprop [(RS)-2-(4-chloro-2-methylphenoxy)propionic acid] in an enantioselective manner bySphingomonas herbicidovorans sp. nov. Appl. Environ. Microbiol. 62:4318–4322.

73. Zylstra, G. J., and E. Kim. 1997. Aromatic hydrocarbon degradation bySphingomonas yanoikuyae B1. J. Ind. Microbiol. Biotechnol. 19:408–414.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Documents

Detection and Characterization of Conjugative Degradative ... · with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments Hybridization