Vol. 173, No. 14

Conjugative Transposition of Tn916 Requires the Excisive andIntegrative Activities of the Transposon-Encoded Integrase

MICHELE J. STORRS,t CLAIRE POYART-SALMERON,t PATRICK TRIEU-CUOT,* AND PATRICE COURVALIN

Unite des Agents Antibacteriens, Institut Pasteur, 28 rue du Dr. Roux, 75724 Paris Cedex 15, France

Received 26 December 1990/Accepted 29 April 1991

Transposon Tn916 is a 16.4-kb broad-host-range conjugative transposon originally detected in the chromo-some of Enterococcus faecalis DS16. Transposition of Tn916 and related transposons involves excision of a free,nonreplicative, covalently closed circular intermediate that is substrate for integration. Excisive recombinationrequires two transposon-encoded proteins, Xis-Tn and Int-Tn, whereas the latter protein alone is sufficient forintegration. Here we report that conjugative transposition of Tn916 requires the presence of a functionalintegrase in both donor and recipient strains. We have constructed a mutant, designated Tn916-intl, byreplacing the gene directing synthesis of Int-Tn by an allele inactivated in vitro. In mating experiments,transfer of Tn916-intl from Bacillus subtilis to E. faecalis was detected only when the transposon-encodedintegrase was supplied by trans-complementation in both the donor and the recipient. These results suggest thatconjugative transposition of Tn916 requires circularization of the element in the donor followed by transfer andintegration of the nonreplicative intermediate in the recipient.

Antibiotic resistance involving conjugative transposonshas been described in various gram-positive gener Entero-coccus, Streptococcus, and Clostridium (7, 11, 15-17, 20).Conjugal transfer of these elements, referred to as conjuga-tive transposition, consists of the movement of the transpo-son from a site in the genome of the donor to a new locationin the genome of the recipient. Conjugative transposonshave a broad host range: donor and recipient need not be ofthe same species or even of the same genus. These elementsare large DNA segments, ranging in size from 16 to >60 kb,and all contain the tetracycline resistance determinant tetMeither alone or associated with other resistance genes. Theyare generally found on the host chromosome, although theymay transpose intracellularly to resident plasmids. The roleof conjugative transposons in dissemination of drug resis-tance in clinically significant bacteria is thought, in somespecies, to be as important as that of resistance plasmids(10).The two elements that have been best characterized are

the 16.4-kb transposon Tn9O6, first detected in the chromo-some of Enterococcus faecalis DS16 (17), and the 25.3-kbtransposon Tn1545, originally found in the multiply antibiot-ic-resistant Streptococcus pneumoniae BM4200 (11). Thesetransposons transfer by conjugation to a large variety ofgram-positive bacteria, in which they integrate at variousloci in the genome of the recipient. Both elements alsotranspose after cloning in Escherichia coli, but conjugaltransfer does not seem to occur between gram-negativebacteria (10, 12). Tn9O6 and Tn1545 appear to be related onthe basis of restriction endonuclease analysis and functionalproperties (4, 10, 12, 29). The nucleotide sequences at theirextremities are nearly identical for at least 250 bp (5, 8).These elements are flanked by terminal imperfect (20 of 26bp) inverted repeated sequences but, unlike most trans-posons, they do not generate a duplication of the target DNA

* Corresponding author.t Present address: Department of Food Microbiology, University

College, Cork, Ireland.t Present address: Laboratoire de Microbiologie, H6pital Necler-

Enfants Malades, 75730 Paris Cedex 15, France.

upon insertion. Transposition of these elements proceeds byway of excision of a free, nonreplicative, covalently closedcircular intermediate that is substrate for integration (28).The integration-excision system of these transposons isstructurally and functionally related to that of lambdoidphages (24, 25). Excision and integration occur by reciprocalsite-specific recombination between nonhomologous DNAsequences of 6 or 7 bp designated coupling or overlapsequences (6, 24, 25). Excisive recombination requires twotransposon-encoded proteins, an excisionase (Xis-Tn) andan integrase (Int-Tn), whereas Int-Tn only is required forintegration (25).

In this report, we demonstrate that conjugative transposi-tion of Tn9J6 requires the presence of a functional integrasein both donor and recipient. We have constructed a mutantof Tn916, designated Tn916-intl, by replacing the genedirecting synthesis of Int-Tn by an allele inactivated in vitro.This mutant is defective for both excision and integration. Inmating experiments, transfer of Tn916-intl from Bacillussubtilis to E. faecalis was detected only when the transpo-son-encoded integrase was provided in trans in both donorand recipient. These results suggest that conjugative trans-position of Tn9J6 and related elements involves circulariza-tion of the transposon in the donor, transfer, and integrationof the nonreplicative intermediate in the recipient.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media. The bacterialstrains and plasmids used in this study are listed in Table 1.E. coli strains were grown in brain heart infusion broth or onMueller-Hinton agar. B. subtilis was grown in Luria-Bertanibroth and agar, and E. faecalis was grown in brain heartinfusion broth and agar. Antibiotics were used at the follow-ing concentrations (in micrograms per milliliter): for E.coli-ampicillin, 100; erythromycin (Em), 180; and kanamy-cin (Km), 20; for B. subtilis-chloramphenicol (Cm), 5;erythromycin, 10; kanamycin, 20; streptomycin (Sm), 1,000;and tetracycline (Tc), 10; for E. faecalis-erythromycin, 10;kanamycin, 1,000; streptomycin, 1,000; and tetracycline, 10.

Transformation and mating procedures. Recombinant plas-

4347

JOURNAL OF BACTERIOLOGY, JUlY 1991, p. 4347-43520021-9193/91/144347-06$02.00/0Copyright C) 1991, American Society for Microbiology

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

4348 STORRS ET AL.

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Relevant properties Reference(s)or source

StrainE. coliC600 F- thi-J thr-J leuB6 lacYl tonA21 supE44 1HB101 F- hsd-20 recAJ3 ara-14 proA2 lacYl galK2 rpsL20 (Str) xyl-5 mtl-l supE44 2

B. subtilisMarburg W168 trp Str 21CKS102 W168::Tn9l6 28BM4184 W168::Tn916-intl This study

E. faecalis BM4110 Str 11

PlasmidpRK24 Apr Tcr; Tra+ Mob' IncP; trpE 31pDH88 Apr Cmr; multiple cloning site downstream from Pspac 36pBGS18+ Kmr; lacPOZ'; multiple cloning site 30pAT187-1 Kmr Mob'; shuttle vector 3, 33pAM120 Apr Tcr; pGL101 with a 16.4-kb EcoRI fragment carrying Tn9O6 19pAT110 Apr Emr; pUC19 with a 1.2-kb ClaI-DdeI fragment carrying erm 34pAT143 Kmr; pBGS18+ with a 3-kb EcoRI-HindIII fragment carrying intl-Tn (int-TnQlerm) This studypAT144 Apr Cmr; pDH88 with a 4-kb BanI fragment carrying int-Tn This studypAT145 Kmr; pAT187-1 with a 2.2-kb EcoRI fragment carrying int-Tn This studypAT301 Cmr Kmr; pACYC184 with a 2.4-kb HindlIl fragment carrying the sealed extremities of TnJ545 25

mids were introduced by transformation into E. coli (27) andB. subtilis (13), as described previously. Filter matingsbetween B. subtilis and E. faecalis (11) and between E. coliand E. faecalis (33) were as described before. Transferfrequency was expressed as the number of transconjugantsper donor CFU after mating.

Plasmid and DNA manipulations. Large-scale and small-scale preparations of plasmid DNA from E. coli were asdescribed previously (27). For B. subtilis and E. faecalis,lysis was carried out at 37°C for 15 min in 100 ,ul ofTE buffer(25 mM Tris HCl, 10 mM EDTA, pH 8.0) containing sucrose(25%) and lysozyme (20 mg/ml). Cleavage of DNA withrestriction endonucleases, purification of DNA fragmentsfrom agarose gels, conversion of recessed DNA ends toblunt ends, and ligation with T4 ligase were performed bystandard methods (27).

Purification of total DNA from B. subtilis. Cells from 5-mlovernight cultures were harvested by centrifugation andresuspended in 400 ,ul ofTE buffer containing sucrose (25%)and lysozyme (20 mg/ml). After 15 min of incubation at 37°C,an equal volume of TE buffer containing sodium dodecylsulfate (1%) was added and the mixture was gently mixeduntil clearing. Proteinase K (100 ,ul; 5 mg/ml) and RNase (100,ul; 5 mglml) were then added, and the solution was incu-bated at 37°C for 4 h. Total DNA was extracted twice with anequal volume of phenol-chloroform and once with chloro-form. The aqueous phase was mixed with an equal volume ofisopropanol and cooled to -20°C for 1 h. The DNA pelletwas recovered by centrifugation and suspended in 100 ,ul ofTE buffer.

Southern blot analysis. Total DNA from B. subtilis strainswas digested with HindlIl and separated by agarose gelelectrophoresis. Blotting (27) and hybridization (28) were asdescribed previously.DNA amplification and sequence determination. Thirty-five

cycles of polymerase chain reaction were performed asdescribed before (26), using as primers two 21-mer oligonu-cleotides specific, respectively, for the left 5'-d[GGATAA

ATCGTCGTATCAAAG]-3' and the right 5'-d[CGTGAAGTATCTTCCTACAGT]-3' extremities of Tn916 and TnJ545(25). The resulting fragments were separated by electropho-resis through a 1% agarose gel. DNA sequence determina-tion was performed on a purified double-stranded DNAtemplate as described previously (22), using the two syn-thetic oligonucleotides.

Construction of plasmids. Plasmid pAT143 was con-structed as follows. The 1.8-kb EcoRI-HindIII fragmentcontaining int-Tn1545 from pAT294 was purified (24) andinserted into pBGS18+ digested with EcoRI plus HindIII,giving rise to pAT142. This plasmid has a unique DraI site inint-Tn1545 that was used to inactivate this gene by insertionof the 1.2-kb BamHI-KpnI erm cassette purified frompAT110 (34). The resulting plasmid was designated pAT143.

Plasmid pAT144 was obtained by cloning the purified4.0-kb BanI fragment of pAT142 containing int-Tn1545 intothe HindIII site of pDH88 (36). The 2.5-kb PstI-EcoRIfragment of pAT144 containing int-Tn1545 downstream fromthe spac promoter of pDH88 was cloned into the EcoRI siteof the mobilizable shuttle vector pAT187-1 (3, 33) followingaddition of an EcoRI-PstI linker. The structure of the result-ing plasmid, pAT145, is shown in Fig. 1. This hybrid shuttlereplicon contains the origin of transfer of the IncP plasmidRK2 and can be transferred by conjugation to variousgram-positive bacteria, provided that the E. coli donorcontains a coresident self-transferable plasmid belonging tothe IncP incompatibility group (33).

In cloning experiments, noncohesive restriction sites weremade blunt ended before ligation unless linkers were used.Enzymes and biochemicals. Restriction enzymes BanI and

DraI were from New England BioLabs, Inc., Beverly, Mass.Other restriction and modifying enzymes, [t-32P]dCTP, and[a-35S]dATP were obtained from Amersham, SA, Les Ulis,France. The Sequenase kit was purchased from US Bio-chemical Corp., Cleveland, Ohio. The random priming kitwas from Amersham, SA. Luria-Bertani broth was fromDifco Laboratories, Detroit, Mich. Other bacteriological

J. BACTERIOL.

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Tn9J6 CONJUGAL TRANSPOSITION 4349

A BEA '

kb

9.4 -_6.7 -_

-

. p ; pAT145RKZ 12.6 kb E

Oda

r phA-3 i"^ \pBR322 =,

FIG. 1. Structure of the mobilizable shuttle plasmid pAT145.Abbreviations: aphA-3, 3'-aminoglycoside phosphotransferase typeIII; int-Tnl545, integrase of Tnl545; oriR, origin of replication; oriT,origin of transfer; Pspac, promoter spac. Single arrows indicatedirection of transcription. E, EcoRI; P, PstI. The EcoRI siteremoved by filling in a partial EcoRI digest of pAT187 to give rise topAT187-1 is indicated in parentheses. The dashed-line arrow repre-sents the pAT187-1 portion of pAT145.

supplies were from Diagnostics Pasteur, Marnes-La-Co-quette, France. Antibiotics were provided by the followingmanufacturers: ampicillin and kanamycin, Bristol, Paris,France; chloramphenicol and erythromycin, Roussel-Uclaf,Romainville, France; streptomycin, Pfizer, Paris-La Dd-fense, France; and tetracycline, Rh6ne-Poulenc, Vitry,France.

RESULTS

Construction of Tn916-intl. Plasmid pAT143 (Table 1)does not replicate in gram-positive bacteria and containsint-Tn1545 insertionally inactivated by an erythromycin re-sistance gene known to be expressed in both gram-negativeand gram-positive bacteria. This allele was designated intl-Tn. The genes coding for Xis-Tn and Int-Tn in Tn1545 andTn916 are almost identical (9). We took advantage of thisclose structural relationship to replace, in Tn916, int-Tn916by intl-Tn following homologous recombination. Competentcells of B. subtilis CKS102, which contains a single copy ofTn916 (28), were transformed with pAT143 DNA, and trans-formants resistant to erythromycin were selected. TotalDNA from 10 randomly selected transformants was digestedwith HindlIl and analyzed by Southern hybridization, using32P-labeled pAM120 as a probe to detect Tn916 sequences.Tn9J6 contains a single Hindlll site (18). In CKS102, theHindIll-generated restriction fragments exhibiting homologywith Tn916 have sizes of 14 and 5 kb (Fig. 2), the smallerfragment containing int-Tn916 (28). The hybridization pat-terns of the 10 transformants were indistinguishable andshowed a size increase of about 1.4 kb of the smaller HindIllfragment (Fig. 2 shows part of this analysis). This size

5 -_ -

FIG. 2. Comparison of total DNA from B. subtilis BM4184 (laneA) and CKS102 (lane B) digested with Hindlll and probed with invitro 32P-labeled pAM120 (pGLlOlQTn916) (14). Molecular sizesare indicated on the right.

increase corresponds roughly to the size (1.2 kb) of the ermcassette, which suggests that a double crossing-over eventoccurred leading to the replacement of int-Tn9J6 by intl-Tn.One of the transformants, BM4184 (Fig. 3), was selected forfurther studies, and the absence of the pBGS18+ sequencein this strain was confirmed by dot blot hybridization (datanot shown). Tn916-intl is expected to be defective for bothexcision and integration.Complementation of Tn916-intl for excision. It was dem-

onstrated recently that TnJ545-encoded Int-Tn and Xis-Tnare trans-acting proteins that are able to catalyze in vivoexcision (Int-Tn and Xis-Tn) and integration (Int-Tn) of adeletion derivative of Tnl545 defective for both functions(24, 25). Plasmid pAT145 (Fig. 1) directs synthesis of a singletransposon-encoded protein, Int-Tn, and was designed totrans-complement Tn9l6-intl in gram-positive bacteria. Thismobilizable shuttle vector was introduced by transformationinto B. subtilis CKS102 and BM4184 and by conjugation intoE. faecalis BM4110, using the mobilizing E. coli strainHB101/pRK24 (31) as a donor. In each experiment, onetransconjugant resistant to kanamycin and containingpAT145 was selected for further studies.The polymerase chain reaction allows detection of circular

intermediates of Tn1545 produced after excision in E. coli(25). Thus, the 21-mer oligonucleotides specific for the leftand the right termini of Tn9J6 and Tn1545 were used toamplify the 240-bp DNA fragment spanning the joined ex-tremities of the circular intermediates of Tn916 and of itsderivative Tn9J6-intl. Total DNA extracted from CKS102,BM4184, and BM4184 harboring pAT145 was used as sub-strate for amplification, and the products of the reactionwere analyzed by agarose gel electrophoresis. As expected,the 240-bp fragment corresponding to the sealed extremitiesof Tn916 was detected with the DNA templates of CKS102and BM4184/pAT145 but not with that of BM4184 (Fig. 4).Specificity of the 240-bp amplification products obtainedfrom Tn916 in CKS102 and from Tn916-intl in BM4184/pAT145 was confirmed by sequence determination (data notshown). DNAs from B. subtilis WS168 and from pAT301, apACYC184 derivative containing the sealed extremities ofTn1545 (25), were used as negative and positive controls,respectively (Fig. 4). This analysis confirms that Tn916-intlis defective for excision and indicates that Int-Tn frompAT145 restores the capacity of Tn9l6-intl to excise in B.subtilis BM4184.

Conjugal transfer of Tn916-intl from B. subtilis to E.faecalis. To determine whether Int-Tn is required for conju-gal transfer of Tn916, B. subtilis CKS102 and BM4184 wereused as donors in mating experiments. Because natural

VOL. 173, 1991

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

4350 STORRS ET AL.

int-Ta (iait-Ta1S45al.vmI

Transoming frmentof pAT143

H

CKS102chromosome

BM4184chromosome

h-Tnvgl 1"

Resident T9l6Eiythroumycln selection

vr--4-tl-Tn kM T n9lE-

FIG. 3. Construction of B. subtilis BM4184. The selected transformant resulted from a double crossing-over event involving Tn916sequences present in the chromosome of CKS102 and their counterparts in pAT143 (black boxes). DNA from Tn916, int-Tn916, and erm isrepresented by open, black, and stippled segments, respectively. Chromosomal DNA and the pBGS18+ portion of pAT143 are depicted bythin and dashed lines, respectively. erm, erythromycin resistance methylase; intl-Tn, integrase of Tn1545 insertionally inactivated with erm;int-Tn916 and int-Tnl545, integrases of Tn916 and TnlS45, respectively. Horizontal arrows indicate direction of transcription.

competence has not been demonstrated in E. faecalis, thisspecies, rather than B. subtilis, was chosen as a recipient toavoid the possibility of transfer by transformation. In filtermatings between B. subtilis CKS102 and E. faecalisBM4110, Tn9O6 transferred at a frequency of 10', whereas,under similar conditions, transfer of Tn9J6-intl from B.subtilis BM4184 to E. faecalis BM4110 was never observed(<10-8) (Table 2). Transfer of the mutant element was notdetected (<10-8) when int-Tn1545 was provided in trans ineither the donor or the recipient. By contrast, transfer ofTn9J6-intl from B. subtilis BM4184 to E. faecalis BM4110

1 2 3 4 5 X

FIG. 4. Agarose gel electrophoresis of polymerase chain reac-

tion products obtained by using primers homologous to the left and

right ends of TnJS45 and Tn9J6. The substrates were as follows:

lane 1, pAT3O1 DNA; lanes 2 to 5', total DNA from B. subtilis W168,

CKS102, BM4184, and BM4184/pAT145. Horizontal arrow indi-

cates the 240-bp DNA fragment corresponding to the joined ends of

the transposon. Bacteriophage lambda (X) DNA digested with Pstlwas used as a molecular size standard.

was detected at a frequency (10-5) similar to that of thewild-type transposon when int-Tn1545 was provided in transin both donor and recipient. Subsequent retransfer of Tn916-intl among E. faecalis strains also depended on the presenceof pAT145 in both donor and recipient cells. This observa-tion, combined with the fact that transfer of pAT145 from B.subtilis CKS102 to E. faecalis BM4110 was never detected(<10-8), indicates that conjugal transposition of Tn916-intlis not due to homologous recombination between the mutantelement and pAT145. The presence of pAT145 in the donordid not alter the transfer frequency of Tn916 from B. subtilisCKS102 to E. faecalis BM4110 (Table 2).

DISCUSSIONThe current model for the nature of the movements

(transposition and conjugation) of conjugative transposonssuch as Tn9J6 and Tnl545 of gram-positive cocci is that,following excision, a circular intermediate of the element canundergo intracellular transposition to a new site; can beconjugatively transferred to a new host, where it transposes;or can be lost from the progeny during cell division (18, 19).This model implies that, regardless of whether donor andrecipient replicons are within the same cell, excision fromthe donor replicon represents the initial and rate-limitingstep for transposition. In support of this model, a super-coiled intermediate of Tn916 produced in vivo in E. coli wasidentified by restriction endonuclease digestion and bySouthern hybridization (28). The purified circular form ofTn916 was used to transform B. subtilis protoplasts and wasfound to retain all of its original properties: it inserted atrandom into B. subtilis chromosome and was able to pro-mote conjugal transposition to Streptococcus pyogenes (28).We demonstrated recently that excision of these elements

requires two transposon-encoded proteins, Xis-Tn and Int-Tn, whereas Int-Tn is sufficient for integration (25). To testfurther the model described above, we have studied theconjugative ability of Tn9J6-intl, a Tn916 mutant with an

J. BACTERIOL.

ALA

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Tn916 CONJUGAL TRANSPOSITION 4351

TABLE 2. Transfer of Tn9O6 and Tn916-intl from B. subtilis to E. faecalis

Antibiotic selection TransferDonor Recipient (10 g/l)aT frequencyb

CKS102 BM4110 Sm (1,000), Tc (8) 3 X 1-CKS102/pAT145c BM4110 Sm (1,000), Tc (8) 1 x io-5

Sm (1,000), Km (1,000) <10-8CKS102 BM4100/pAT145 Sm (1,000), Tc (8) 2 x 10-5BM4184 BM4110 Sm (1,000), Em (8) <10-8BM4184 BM4110/pAT145 Sm (1,000), Em (8) <10-8BM4184/pAT145C BM4110 Sm (1,000), Em (8) <lo-8BM4184/pAT145C BM4110/pAT145 Sm (1,000), Em (8) 2 x 10-5BM4184/pAT187C BM4110/pAT145 Sm (1,000), Em (8) <10-8

a Sm, streptomycin; Tc, tetracycline; Km, kanamycin; Em, erythromycin.b Transfer frequencies are means of three independent mating experiments and were reproducible within 1 order of magnitude.c Matings were carried out on brain heart infusion agar containing kanamycin (20 jLg/ml).

inactivated int-Tn allele (Fig. 3). The mutant element wasfound to be defective for excision, and we have shown thatthe excisive activity can be restored by trans-complementa-tion with a plasmid encoding Int-Tn (Fig. 1). These resultsdemonstrate the absolute requirement of Int-Tn for excisionof this class of transposons. In mating experiments, transferof Tn916-intl from B. subtilis to E. faecalis was detectedonly when int-Tn1545 was provided in trans in both donorand recipient strains. In these conditions, Tn916-intl trans-ferred at a frequency similar to that of wild-type Tn9O6. Themost likely explanation is that conjugative transposition ofTn916 and related transposons involves circularization(Xis-Tn and Int-Tn activities) of the element in the donor andthen transfer, followed by integration (Int-Tn activity) of thenonreplicative intermediate in the recipient. This modelimplies that, as anticipated, Tn916-intl is also defective forintegration. Finally, it should be noted that our results do notexclude the possibility that Tn9O6 can promote conjugationsimilarly to F in an Hfr donor strain (35). In this case, onlythe portion of Tn9O6 functionally homologous to the 5'leading strand is transferred into the recipient bacteria, andits rescue depends on the recombination functions of thehost.There is circumstancial evidence that conjugation of

Tn925, an element closely related to Tn9J6, proceedsthrough cell fusion in B. subtilis and in E. faecalis (32). Thisprocess leads to the formation of a transient diploid cell inwhich there is no distinction between donor and recipient.However, the absolute requirement for a functional inte-grase in both strains of the mating pair and the fact thattransfer of plasmid pAT145 was not detected when B.subtilis CKS102 was crossed with E. faecalis BM4110 (Table2) rule out the possibility that transposon-mediated cellfusion occurred under our experimental conditions. It hasbeen reported that Tn9O6 can mobilize certain (pC194 andpUB110), but not all (pE194), nonconjugative plasmids inmatings between B. subtilis and B. thuringiensis (23). Mobi-lization of pAD2 by Tn916 was never observed in E. faecalis(10, 17). That mobilization depends on the nature of thecoresident plasmid indicates that Tn916-promoted cell fusiondid not occur at a detectable frequency in these matingsystems.

ACKNOWLEDGMENTS

We thank J. R. Scott for her participation in the beginning of thiswork and for helpful discussions.M. J. Storrs was a recipient of a European Commission grant

under the BAP program and of a Wellcome Trust travel grant.

REFERENCES1. Appleyard, R. K. 1954. Segregation of new lysogenic types

during growth of a doubly lysogenic strain derived from Esch-erichia coli K-12. Genetics 39:440-452.

2. Boyer, H. W., and D. Rouliand-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

3. Brisson-Noel, A., S. Dutka-Malen, C. Molinas, R. Leclerq, andP. Courvalin. 1990. Cloning and heterospecific expression of theresistance determinant vanA encoding high-level resistance toglycopeptides in Enterococcus faecium BM4247. Antimicrob.Agents Chemother. 39:924-927.

4. Caillaud, F., C. Carlier, and P. Courvalin. 1987. Physicalanalysis of the conjugative shuttle transposon Tn1545. Plasmid17:58-60.

5. Caillaud, F., and P. Courvalin. 1987. Nucleotide sequence of theends of the conjugative shuttle transposon Tnl545. Mol. Gen.Genet. 209:110-115.

6. Caparon, M. G., and J. R. Scott. 1989. Excision and insertion ofthe conjugative transposon Tn916 involves a novel recombina-tion mechanism. Cell 59:1027-1034.

7. Christie, P. J., R. Z. Korman, S. A. Zahler, J. C. Adsit, andG. M. Dunny. 1987. Two conjugation systems associated withthe Streptococcus faecalis plasmid pCF10: identification of aconjugative transposon that transfers between S. faecalis andBacillus subtilis. J. Bacteriol. 169:2529-2536.

8. Clewell, D. B., S. E. Flanagan, Y. Ike, J. M. Jones, and C.Gawron-Burke. 1988. Sequence analysis of termini of the con-jugative transposon Tn916. J. Bacteriol. 170:3046-3052.

9. Clewell, D. B., S. E. Flanagan, L. A. Zitzow, Y. A. Su, P. He, E.Senghas, and K. E. Weaver. 1991. Properties of conjugativetransposon Tn916, p. 39-44. In G. M. Dunny, P. P. Cleary, andL. L. McKay (ed.), Genetics and molecular biology of strepto-cocci, lactococci, and enterococci. American Society for Micro-biology, Washington, D.C.

10. Cleweli, D. B., and C. Gawron-Burke. 1986. Conjugative trans-posons and the dissemination of antibiotic resistance. Annu.Rev. Microbiol. 40:635-659.

11. Courvalin, P., and C. Carlier. 1986. Transposable multipleantibiotic resistance in Streptococcus pneumoniae. Mol. Gen.Genet. 205:291-297.

12. Courvalin, P., and C. Carlier. 1987. Tn1545: a conjugativeshuttle transposon. Mol. Gen. Genet. 206:259-264.

13. Ehrlich, S. D. 1978. DNA cloning in Bacillus subtilis. Proc.Natl. Acad. Sci. USA 75:1433-1436.

14. Feinberg, A. P., and B. Vogelstein. 1983. A technique forradiolabelling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 132:6-13.

15. Fitzgerald, G. F., and D. B. Clewell. 1985. A conjugativetransposon (Tn919) in Streptococcus sanguis. Infect. Immun.47:415-420.

16. Fletcher, H. M., L. Marri, and L. Daneo-Moore. 1989. Trans-poson-916-like elements in clinical isolates of Enterococcusfaecium. J. Gen. Microbiol. 135:3067-3077.

VOL. 173, 1991

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

4352 STORRS ET AL.

17. Franke, A. E., and D. B. Clewell. 1981. Evidence for a chromo-some borne resistance transposon (Tn916) in Streptococcusfaecalis that is capable of "conjugal" transfer in the absence ofconjugative plasmid. J. Bacteriol. 145:494-502.

18. Gawron-Burke, C., and D. B.- Clewell. 1982. A transposon inStreptococcus faecalis with fertility properties. Nature (Lon-don) 300:281-284.

19. Gawron-Burke, C., and D. B. Clewell. 1984. Regeneration ofinsertionally inactivated streptococcal DNA fragments afterexcision of transposon Tn916 in Escherichia coli: strategy fortargeting and cloning genes from gram-positive bacteria. J.Bacteriol. 159:214-221.

20. Hachler, H., F. H. Kayser, and B. Berger-Bachi. 1987. Homol-ogy of a transferable tetracycline resistance determinant ofClostridium difficile with Streptococcus (Enteroco;cus) faecalistransposon Tn9O6. Antimicrob. Agents Chemother. 31:1033-1038.

21. lonesco, H., J. Michel, B. Cami, and P. Schaeffer. 1970. Geneticsof sporulation in Bacillus subtilis Marburg. J. Appl. Bacteriol.33:13-24.

22. Mabilat, C., S. Goussard, W. Sougakoff, R. Spencer, and P.Courvalin. 1990. Direct sequencing of the amplified structuralgene and promoter for the extended-broad-spectrum 1-lacta-mase TEM-9 (RHH-1) of Klebsiella pneumoniae. Plasmid 23:27-34.

23. Naglich, J. G., and R. E. Andrews, Jr. 1988. Tn916-dependentconjugal transfer of pC194 and pUB110 from Bacillus thuring-iensis subsp. israelensis. Plasmid 20:113-126.

24. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courva-lin. 1989. Molecular characterization of two proteins involved inthe excision of the conjugative transposon TnJS45: homologieswith other site-specific recombinases. EMBO J. 8:2425-2433.

25. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courva-lin. 1990. The integration-excision system of the conjugativetransposon TnJS45 is structurally and functionally related tothose of lambdoid phages. Mol. Microbiol. 4:1513-1521.

26. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi,

G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostableDNA polymerase. Science 239:487-494.

27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

28. Scott, J. R., P. Kirchman, and M. G. Caparon. 1988. Anintermediate in transposition of the conjugative transposonTn916. Proc. Natl. Acad. Sci. USA 85:4809-4813.

29. Senghas, E., J. M. Jones, M. Yamamoto, C. Gawron-Burke, andD. B. Clewell. 1988. Genetic organization of the bacterialconjugative transposon Tn9O6. J. Bacteriol. 170:245-249.

30. Spratt, B. G., P. J. Hedge, S. te Heesen, A. Edelman, and J.Broome-Smith. 1986. Kanamycin-resistant vectors that are an-alogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9.Gene 41:337-342.

31. Thomas, C. M., and C. A. Smith. 1987. Incompatibility group Pplasmids: genetics, evolution, and use in genetic manipulation.Annu. Rev. Microbiol. 41:77-101.

32. Torres, 0. R., R. Z. Korman, S. A. Zahler, and G. M. Dunny.1991. The conjugative transposon Tn925: enhancement of con-jugal transfer by tetracycline in Enterococcus faecalis andmobilization of chromosomal genes in Bacillus subtilis and E.faecalis. Mol. Gen. Genet. 225:395-400.

33. Trieu-Cuot, P., C. Carlier, P. Martin, and P. Courvalin. 1987.Plasmid transfer by conjugation from Escherichia coli to gram-positive bacteria. FEMS Microbiol. Lett. 48:289-294.

34. Trieu-Cuot, P., C. Poyart-Salmeron, C. Carlier, and P. Courva-lin. 1990. Nucleotide sequence of the erythromycin resistancegene of the conjugative transposon Tn1545. Nucleic Acids Res.18:3660.

35. Willetts, N., and B. Wilidns. 1984. Processing of plasmid DNAduring bacterial conjugation. Microbiol. Rev. 48:24-41.

36. Yansura, D. G., and D. J. Henner. 1984. Use of the Escherichiacoli lac repressor and operator to control gene expression inBacillus subtilis. Proc. Natl. Acad. Sci. USA 81:439-443.

J. BACTERIOL.

on February 26, 2021 by guest

http://jb.asm.org/

Dow

nloaded from