Deoxyribose Nucleic Acid - Biology Things8/25/2017 1 Chapter 6 DNA: The Molecule of Life: • 6.1 DNA intro • 6.2 DNA replication • 6.3 DNA directs the production of proteins •

8/25/2017

1

Chapter 6 DNA: The Molecule of Life:

• 6.1 DNA intro

• 6.2 DNA replication

• 6.3 DNA directs the production of

proteins

• 6.4 Flow from DNA to RNA to

protein

• 6.5 Transcription

• 6.6 Translation part one

• 6.7 Translation part two

• 6.8 Gene expression regulation

• 6.9 Signal transduction

• 6.10 Mutations effects

© 2017 Pearson Education, Inc.

• 6.11 Cancer part one

• 6.12 Cancer part two

• 6.13 Genetic engineering

• 6.14 DNA manipulation

• 6.15 Genetically modified organisms

• 6.16 PCR

• 6.17 DNA profiles

• 6.18 Genome mapping

• 6.19 Gene therapy

6.1 Opening Questions: What molecule

holds the instructions for living things?

Aquatic Algae

Protist

Elephant

CaterpillarMushroom

Flower Human

Do these organisms all share the same

genetic code? Explain.

Chapter Table of Contents© 2017 Pearson Education, Inc.

6.1 DNA is the molecule that holds the

instructions for all living things.

• DNA is shorthand for

Deoxyribose Nucleic Acid

• A DNA molecule is a

double helix with two

strands made up of a long

string of nucleotides.


6.1 Each nucleotide consists of a sugar,

a phosphate, and a base.


6.1 In a DNA molecule there are four bases

with specific pairing rules.

• Adenine (A) can

only bond with

thymine (T).

• Guanine (G) can

only bond with

cytosine (C).A - T

C - G

Each strand of DNA

in a double helix is

complementary.


6.2 Opening Questions: Can you build a

DNA molecule?

• In a DNA double helix,

adenine (A) can only

bond with thymine (T)

and guanine (G) can only

bond with cytosine (C).

• Given a half strand of

DNA, build the other

strand.

A • ?

T • ?

C • ?

A • ?

C • ?

G • ?

C • ?

T

A

G

T

G

C

G


8/25/2017

2

6.2 What makes DNA a great molecule for

hereditary information?

• DNA strands are complementary!

– If you know ½ of the molecule, you can build

the other.

• To replicate, the DNA molecule unzips.

• Each strand serves as a template to build

a new strand following the base-pairing

rules.

Genetic instructions are passed

down via DNA replication.


6.2 During DNA replication, a cell duplicates

its chromosomes.

• New DNA molecules

are made up of one

of the original

parental strands

plus a new half.

• As a result, DNA

replication is called

semi-conservative.


6.2 The process of DNA replication:


6.3 Opening Questions: True or false?

• True or false. DNA codes for all the information

needed to make up an organism uses only four

building blocks (A,T,C,G).

• True or false. All the DNA molecules in your

body put end to end would reach from the Earth

to the Sun and back over 600 times.

• True or false. Typing 60 words per minute, eight

hours a day, it would take about 50 years to type

the human genome.

• True or false. Humans and bananas share

about 50% common DNA.

All true!Chapter Table of Contents© 2017 Pearson Education, Inc.

6.3 DNA directs the production of proteins

via an intermediate molecule of RNA.

• RNA is also a nucleic acid (like DNA):

Ribonucleic Acid

• RNA has three major differences:

1. It is single-stranded (not a helix)

2. Sugar in RNA is ribose.

3. Thymine (T) is replaced by

uracil (U).


6.3 DNA holds information on how to

produce proteins.

• DNA is able to act as the molecule of heredity because it can direct the production of proteins.

• DNA first directs the production of RNA, which in turn controls the manufacture of proteins.

• Proteins then perform the majority of cellular functions and control physical traits.

DNA

RNA

Proteins


8/25/2017

3

6.3 The flow of genetic information.


6.4 Opening Questions: How does DNA

make brown eyes?

• What color are your eyes?

• What color are your neighbor’s eyes?

• How might your DNA instructions for eye

color vary from your neighbor’s?

• How are the instructions in DNA turned

into the physical pigment in your eye?


6.4 Genetic information flows from DNA to

RNA to protein in two steps.


6.4 Transcription rewrites the DNA code

into RNA, which then leaves the nucleus.

• Transcription follows

the DNA base-pairing

rules with one

exception:

– Uracil (U) is used

instead of thymine (T).

• The molecule that

results from transcription

is called messenger RNA (mRNA).


6.4 In translation, the RNA molecule serves

as instructions for making a protein.

• At the ribosomes in the cytoplasm, each

mRNA codon is translated into an amino

acid to build a protein.


6.5 Opening Questions: What is a gene?

• How would you define a gene?

• Write your answer down and then share it

with your neighbor.

• Are your answers the same?


8/25/2017

4

6.5 Transcription creates a molecule of

RNA from a molecule of DNA.

• During transcription,

the DNA double

helix separates.

• One strand of DNA

is used to generate

a molecule of RNA.

• The RNA is processed to become

messenger RNA, which then exits the

nucleus via a nuclear pore.


6.5 Steps of transcription:


6.5 Review Question: What is a gene?

• There is no simple, agreed-upon definition

that accurately describes all known genes.

– Is it a stretch of DNA?

– Does it produce a protein?

– What if a protein is made from two different

genes?

• As we study the genome, it actually becomes

harder to find one definition.

• For now, we can define a gene as a discrete

unit of hereditary information consisting of a

specific nucleotide sequence in DNA.Chapter Table of Contents© 2017 Pearson Education, Inc.

6.6 Opening Questions: DNA and you.

• Would you get a personal DNA

test if you could?

– Why or why not?

• Would you get a personal DNA

test before you had a baby?

– Why or why not?

• Should we run personal DNA

tests on newborn babies?

– Why or why not?


6.6 Translation involves three kinds of

RNA: rRNA, mRNA, and tRNA.

• Translation of the mRNA takes place in

the cytoplasm within ribosomes.

• Ribosomes are made from proteins and

ribosomal RNA (rRNA).

• Transfer RNA (tRNA) molecules carry

amino acids to the ribosome.


6.6 Within each ribosomes are binding

sites for the mRNA and for tRNA.

• One end of a tRNA has an anticodon that

matches up with the mRNA.

• The other end holds an amino acid.


8/25/2017

5

6.6 The genetic code uses triplet codons.


6.7 Opening Questions: Can you translate

the genetic code?

• What amino acid would be produced from

an mRNA with the sequence:

AUG-ACU-AAA-GAG-UCA-UAA

Hint: Use your genetic code table!

Met-Thr-Asn-Glu-SerChapter Table of Contents© 2017 Pearson Education, Inc.

6.7 Translation creates a molecule of

protein via the genetic code.

• Translation is divided

into three phases:

– Initiation

– Elongation

– Termination

• Translation begins when two subunits of a

ribosome assemble on an mRNA.

• A tRNA then brings in amino acids that

match the codon in the mRNA.


6.7 Translation results in a polypeptide.

• Elongation continues until the ribosome reaches a stop codon on the mRNA.

• The ribosome machinery then disassembles.

• The completed polypeptide is now available to be used or modified by the cell into a functioning protein. Amino acid

Polypeptide


6.8 Opening Questions: Are you your

genes?

• What are ways your physical or behavioral

traits might be influenced by your genes,

your environment, or both?


6.8 Gene expression, the production of

proteins, is regulated in several ways.

• Gene regulation is the process of turning

genes on and off.

• Different cell types express different

genes.

– For example, not all cells need lactase

(an enzyme that digests milk).

In what cell types would you expect

lactase gene expression?


8/25/2017

6

6.8 X-chromosome inactivation is an

extreme case of gene regulation.

• In female mammals, one X chromosome

in each body cell is highly compacted and

almost entirely inactive.


6.8 There are several points along the path

from DNA to protein that can be regulated.

1. Special transcription factors must bind

to DNA to “turn on” transcription.


6.8 After transcription, the RNA may be

altered in several ways.

2. Before leaving the nucleus, the RNA is

modified:

– A cap and tail are added.

– Non-coding introns may be removed.

– Protein-coding exons may be rearranged.


6.8 Translation offers more opportunities

for gene regulation.

3. The cell can control the

following:

– Whether translation proceeds

– How proteins are modified

after translation

– When proteins are broken

down


6.9 Opening Questions: Are all your cells

the same?

• All the cells in your body contain the same

DNA. But do all the cells make the same

proteins?

• How might the following cell types differ in

the functions of proteins produced? How

might they be similar?

– Liver cell

– Brain cell

– Stomach cell


6.9 Cell-to-cell communication can control

gene expression.

• Multicellular life depends on

cell-to-cell signaling.

• Molecules exit one cell and

bind to a receptor protein on

the outside of another cell.

• This binding triggers a signal

transduction pathway.


8/25/2017

7

6.9 A signal from another cell can regulate

genes (turn on or off) in the receiving cell.

Signal molecule

from another cell


Gene regulation

New protein made

6.9 Cell-to-cell communication is

particularly important in a developing

embryo.

• Development involves frequent cell

division (to increase body size) that must

be carefully coordinated.


6.9 Cell-to-cell communication is

particularly important in a developing

embryo.

• Inductive signals can cause cells to change

shape, migrate, or even destroy other cells.


6.9 Cell-to-cell communication is particularly

important in a developing embryo.

• Homeotic genes are master control genes; they

direct the location of the head and body parts.


6.10 Opening Questions: What difference

does a letter make?

• We only will make sentences with three-letter words

(triplet). Start with the sentence:

THE CAT ATE THE RAT

• Change one letter (R to H):

THE CAT ATE THE HAT

• Delete letter C and move everything over:

THE ATA TET HER AT

• Add a letter B in the sixth letter place:

THE CAB TAT ETH ERA T


6.10 A mutation is any change in the

nucleotide sequence of DNA.

• Replacing, deleting, or adding a nucleotide

base can have a wide range of effects.

• Mutations are the raw material of evolution

by natural selection.

• However, most mutations are harmful.

What might happen to the protein product

if there is a change in the nucleotide

sequence?


8/25/2017

8

6.10 Mutations in DNA can change the

protein produced.

• Mutations can be:

– Spontaneous

– Induced by mutagens

• High-energy radiation

• Chemicals


6.10 Point mutations occur at a single

nucleotide.

ACA

ACG

UGU CYSTEINE

TCA

UGC CYSTEINE

ACT

AGU SERINE

UGA STOP

DNA RNA Amino Acid

No mutation:

Silent mutation:

Missense:

Nonsense:

Point mutations can have varying effects.


6.10 Frameshift mutations are due to the

addition or deletion of a nucleotide.

Frameshift mutations often result in different

or defective proteins.


Added A

6.11 Opening Questions: What do you

know about cancer?

• List three things you know about cancer.

• List something you want to know about

cancer.

© 2017 Pearson Education, Inc. Chapter Table of Contents

6.11 Loss of gene expression control can

result in cancer.

• Mutations can lead to a mass of body cells growing out of control, a tumor.

• If a tumor spreads to other tissues, the

person is said to have cancer.


6.11 Genes regulate the cell cycle.

• A cell cycle control system regulates the

timing of cell duplication.

• A proto-oncogene codes for proteins that

tell the cell when to duplicate.

STOPGO


8/25/2017

9

6.11 Mutations in regulator genes can lead

to an overgrowth of cells.

• A mutated proto-oncogene fails to regulate

cell division and is called an oncogene.

??Cancer is caused by out-of-control cell growth due

to a breakdown of the cell cycle control system.


6.11 Cancer can occur when proto-

oncogenes are mutated to oncogenes.

• A mutation in a growth factor

gene can produce a hyperactive

protein that promotes

unnecessary cell division.

• A mutation that deactivates a

tumor suppressor gene may

result in uncontrolled growth.STOP

GO!

XMutations may result in proteins that either don’t stop the cell cycle or stimulate growth.


6.12 Opening Questions: What is cancer?

• Imagine your cousin has just texted that

your aunt has just been diagnosed with

cancer.

• Your cousin knows you are taking a

biology course, so she asks, “What is

cancer?”

• Send a text explaining how we define

cancer.


6.12 Cancer is the result of unregulated cell

growth that is out of control.

• Cancer begins within a single cell when

proto-oncogenes mutate into oncogenes.


A benign tumor- No spreading

A malignant tumor- Spreading

6.12 A tumor is an abnormally growing

mass of body cells.

• The spread of cancer cells in the body is

called metastasis.


6.12 There are several ways to treat cancer.

Surgery can

remove a tumor.

Radiation can

disrupt cell

division locally.

Chemotherapy

drugs can disrupt

cell division

throughout the

body.

What might happen to your

normally dividing cells?© 2017 Pearson Education, Inc. Chapter Table of Contents

8/25/2017

10

6.12 There are ways to reduce cancer risk.

Healthy diet Exercise

Sun

protection

Not

smoking

Regular

screenings


6.13 Opening Questions: True or false?

• True or false. You can pay to save a sample of

your dog’s or cat’s DNA for future cloning.

• True or false. Condo associations can use DNA

to identify the proper owner of a poop sample.

• True or false. Some of us are carrying

Neanderthal DNA.

• True or false. The U.S. Supreme Court has ruled

police can take DNA upon arrest.

• True or false. DNA-based computers may one

day hold more data than our fastest server today.

All true! © 2017 Pearson Education, Inc. Chapter Table of Contents

6.13 DNA can be mixed and matched.


6.13 DNA can be mixed and matched.


6.13 Genetic engineering involves

manipulating DNA for practical purposes.

Biotechnology

is the manipulation

of organisms or

their components

to make useful

products.

DNA technology

is a set of methods

for studying and

manipulating

genetic material.

Genetic

engineering

is the direct

manipulation of

genes for practical

purposes.


6.13 Gene cloning is an example of genetic

engineering.

• How can we produce

large quantities of a

protein (such as

human insulin)?

• We can insert DNA

into bacteria and

have them do the

work.PLASMID

A small circular DNA molecule

that replicates separately from

the much larger bacterial

chromosome. (The plasmid

is not drawn to scale here.)


8/25/2017

11

6.13 Cutting and pasting DNA is an

important step in genetic engineering.

• Restriction enzymes

are proteins that

cut DNA at specific

nucleotide sequences.

• The resulting fragments

are called restriction

fragments.


6.14 Opening Questions: Who owns

genes? (Part 1)

Real-World Case Study: In the 1990s a private

company discovered a set of genes associated

with an increased risk of breast and ovarian

cancers (BRCA1 and BRCA2). They received a

patent for the genes. The company earned

hundreds of millions of dollars, but the cost of

testing was out of reach for many patients.

In June 2013 the U.S. Supreme Court heard the

case about if genetic tests can be patented.

What are some pros and cons of

patenting genetic tests?


6.14 Opening Questions: Who owns

genes? (Part 2)

• In June 2013, the Supreme

Court’s ruling opinion was that

“a naturally occurring DNA

segment is a product of nature

and not patent eligible merely

because it has been isolated.”

What do you think are some

implications of the Supreme

Court ruling?


6.14 DNA may be manipulated many ways

within the laboratory.

• Scientists can now answer questions and

solve problems by manipulating DNA.

• Let’s explore some of the tools in the

genetic engineering toolbox.


6.14 DNA can be isolated from a cell and

put into a genomic library.

• A genomic library is a collection of cloned DNA fragments that includes an organism’s entire genome.

• Once created, a genomic library can be used to hunt for and manipulate any gene from the starting organism.

This collection of bacteria

constitutes a genomic

library that can be used

for later experiments.


6.14 DNA can be visualized using nucleic

acid probes.

• In order to find a gene of interest, a researcher can use a nucleic acid probe.

• A complementary molecule made using radioactive or fluorescent building blocks will bind with DNA.


8/25/2017

12

6.14 DNA can be synthesized from scratch.

• An automated DNA synthesizer machine

can quickly and accurately produce

customized DNA molecules up to lengths

of a few hundred nucleotides.


6.14 DNA produced from a cell’s mRNA

• Reverse transcriptase can synthesize

DNA from the mRNAs within the cell.

• The result is complementary DNA

(cDNA) representing the genes that were

being transcribed in the cell at the time.


6.15 Opening Questions: What is a GMO?

• Have you ever eaten a genetically

modified organism (GMO)? If yes,

describe what you’ve eaten.

• Write down a question that you have about

GMOs.

• Share your question with your neighbor.


6.15 Plants and animals can be genetically

modified.

• Genetically modified organisms

(GMOs) are ones that have acquired one

or more genes by artificial means.


6.15 GM plant crops currently make up a

significant part of our food supply.

Bt corn has been

genetically

modified to

express a protein

that acts as

an insecticide,

Hawaii papaya

is genetically

engineered to be

resistant to the

ring-spot virus.

Golden rice is a

transgenic variety,

created with genes

that produce beta-

carotene.


6.15 GM animals are not part of our food

supply (yet), but do have other uses.

• Pharmaceutical

companies have

produced various GM

animals that produce

drugs.

• The FDA (Food and Drug Administration)

is considering approval for the first GM

food, a fast-growing transgenic salmon.


8/25/2017

13

6.15 Pros and cons of GMOs

PROS CONS

Complete the comparison table:


6.16 Opening Questions: What role should

DNA play in the criminal process?

• Should DNA testing of evidence be mandatory?

• Who should pay for DNA testing in trials?

• What do you think is the responsibility of the state

for old cases? Explain.

Real-World Case Study: In 2013, a Texas man convicted in

a 1981 stabbing death was freed by DNA evidence after

serving 29 years in prison. In the original crime, the victim’s

abandoned car was found with several pieces of evidence,

including a black hairnet. In 2011, hair samples preserved

for three decades underwent DNA testing and linked the

samples to someone else. Randolph Arledge’s conviction

was overturned.


6.16 Polymerase chain reaction (PCR)

copies target DNA quickly and precisely.

• Heating splits apart DNA helix

into two complementary strands.

• A heat-stable DNA polymerase

(enzyme that synthesizes DNA)

is used to build new strands.

• Billions of gene copies are

generated in just a few hours.

Using PCR, one drop of blood can

provide enough DNA for analysis.© 2017 Pearson Education, Inc. Chapter Table of Contents

6.16 PCR involves cycles of heating and

cooling.


6.16 PCR is generally used to amplify one

region of DNA.

• Primers (short, single strands of DNA)

bind to the start and end points of the

segment of DNA being amplified.


6.17 Opening Questions: Is your DNA

showing?

• If you knowingly (or unknowingly) provide a DNA

sample, who should have access?

– You?

– Doctor?

– Insurance company?

– Police department?

– Spouse?

– Girlfriend/boyfriend?

Rank the above by their level of access.

Who else would you include or deny?© 2017 Pearson Education, Inc. Chapter Table of Contents

8/25/2017

14

6.17 DNA profiling can prove a match

between two samples.

• Imagine that you have a

sample of DNA from a

crime scene and a second

sample from a suspect.

• How can you prove they

match?

• Entire genome matching is

impractical, but we can

compare regions of DNA.

What can be

learned with

just a drop of

blood?


6.17 DNA profilers focus on specific sites

that are known to vary considerably.

• Scattered throughout the genome are

short tandem repeats (STRs) sites.

• At each STR site, a four-nucleotide

sequence is repeated many times in a

row. For example:

AGATAGATAGATAGATAGAT

• The number of repeats varies widely within

the human population.


6.17 STR analysis compares 13 sites within

the human genome.

• These sites vary so

widely that no two

humans have ever had

the same number of

repeats at all 13 sites

(except identical

twins).


6.17 Follow a crime scene blood drop.

• STR analysis can determine if the sample

matches the suspect.


6.17 Gel electrophoresis provides

comparison of DNA samples.


6.18 Opening Questions: What can we learn

from the entire genome?

• In the 1990s, scientists set out on a quest

to map the entire set of human genes.

• This quest was a huge undertaking.

What are at least three things we might be able to learn with knowledge of all the genes in the human genome?


8/25/2017

15

6.18 Whole genomes can be sequenced

and mapped.

• In 1995, a team of biologists announced

they had determined the DNA sequence of

the entire genome of Haemophilus

influenzae, a disease-causing bacterium.

• This marked the first successful

experiment in genomics, the science of

studying the complete sets of genes

(genomes) and their interactions.


6.18 The Human Genome Project was

completed in 2003.

• The human genome

contains 21,000 genes

that encode for 100,000

different proteins.

• The data are providing

insight into development,

evolution, and many

diseases.

Human Genome Facts


6.18 Genome mapping involved several

separate techniques.

• The set of techniques used to sequence

an entire genome from an organism is

called the whole-genome shotgun

method.


6.18 The field of proteomics examines the

proteins encoded by a genome.

• The number of

proteins in humans

vastly exceeds the

number of genes.

• Understanding

proteins and their

tasks is at the

forefront of

biological research.


6.19 Opening Questions: Can we fix genes?

• From what you’ve learned about DNA and

genetic information, do you think it is

possible to “fix” someone’s genes?

• Several diseases are the result of a single

gene mutation.

• How can we fix genes?

• What might be some benefits?

• What might be some risks?


6.19 Gene therapy aims to cure genetic

diseases.

• Gene therapy is the alteration of a

person’s genes in order to treat or cure a

disease by inserting the “correct” DNA into

the cell.

• As you can imagine, the easiest disorders

to “fix” are those with a single defective

gene.


8/25/2017

16


diseases.

1. Gene therapy

begins with isolation

of the normal gene

from a healthy

person.

2. Enzymes are used

to produce an RNA

version of the target

DNA gene.



diseases.

3. The RNA gene is

combined with an

infectious, but

harmless, retrovirus.

4. The virus is used to

infect a patient’s bone

marrow cells,

transferring the proper

gene to a diseased

individual.

A genetically engineered

bone marrow cell carrying

the correct version of the

gene


6.19 Gene therapy in practice

• Gene therapy has

been used to treat a

disease caused by a

defect in the genes of

the immune system.

• Some children were

cured, but others died or developed cancers.

• Although gene therapy remains promising, there

is little evidence of safe and effective application.


Documents

Deoxyribose Nucleic Acid - Biology Things8/25/2017 1 Chapter 6 DNA: The Molecule of Life: • 6.1 DNA intro • 6.2 DNA replication • 6.3 DNA directs the production of proteins •