Embed Size (px)
Citation preview
Aus dem Department für Nutztiere und öffentliches
Gesundheitswesen in der Veterinärmedizin der
Veterinärmedizinischen Universität Wien
(Departmentsprecher: Univ. Prof. Dr. med.vet. Michael HESS)
Institut für Milchhygiene, Milchtechnologie und
Lebensmittelwissenschaften
Cooling dynamics and microbiological quality of bulk tank milk collected in Styrian small scale dairy farms
Diplomarbeit zur Erlangung der Würde einer
MAGISTRA MEDICINAE VETERINARIAE der Veterinärmedizinischen Universität Wien
Vorgelegt von Andrea Pölzl
Wien, im September 2013
2
Betreuer/in
Dr. med. vet. Beatrix Steßl
Department/Universitätsklinik für Nutztiere und öffentliches Gesundheitswesen in der
Veterinärmedizin der Veterinärmedizinischen Universität Wien
Institut für Milchhygiene, Milchtechnologie und Lebensmittelwissenschaften
Begutachter
Prof. Dr. med. vet. Josef Köfer
Department/Universitätsklinik für Nutztiere und öffentliches Gesundheitswesen in der
Veterinärmedizin
Institut für Öffentliches Veterinärwesen
This work has been part of the project BIOTRACER and was presented at the DVG Congress
in Garmisch-Partenkirchen, Germany with following title:
Cooling dynamics and bacterial counts of bulk tank milk collected in small scale dairy farms. Authors: Pölzl, A., Klinger, S., Wagner, M., Stessl, B.
3
ABBREVIATIONS
°C degree centigrade M molarity μl microliter M. Mycobacterium μM micro-mole MAP Mycobacterium avium subsp. paratuberculosis A. Arthrobacter mg milligram AMC Aerobic mesophilic counts min. minute API Analytical Profile Index MKTTn Muller-Kauffmann Tetrathionate-Novobiocin broth Aqua bidest. aqua bidestillata ml millilitre(s) Aqua dest. aqua destillata mM milli-mole aw water activity mm millimetre B. Bacillus MPN most probable number BCS body condition score MRSA methicillin-resistant Staphylococcus aureus BHI-Y Brain Heart Infusion broth plus 0.6% yeast extract MYP Mannitol Egg Yolk Polymyxin BP Baird Parker NaCl sodium chloride BPW Buffered Peptone Water nM nano-mole BTM bulk tank milk nm nanometer BTSCC bulk tank somatic cell count no. number C. Corynebacterium PC psychrotrophic counts CC coliform counts PCA plate count agar cfu colony forming unit PCR Polymerase Chain Reaction CNS coagulase-negative staphylococci PDO Protected Designation of Origin CPS Coagulase-positive staphylococci PFGE Pulsed Field Gel Electrophoresis d´NTPs deoxynucleoside triphosphate pH pH value DNA deoxyribonucleic acid QMS quarter milk samples E. Escherichia RBCA Rose-Bengal Chloramphenicol e.g. exempli gratia rpm revolutions per minute EDTA ethylenediaminetetraacetic acid rRNA ribosomal ribonucleic acid EU European Union RT room temperature FB Fraser broth RVS Rappaport-Vassiliadis Soya Peptone broth FTIR Fourier transform infrared spectroscopy S. Staphylococcus g gram(s) Sc. Streptococcus GKZ Gesamtkeimzahl SCC somatic cell counts GSP Glutamate Starch Phenol Red SDS Sodium Dodeycl Sulfate GTB Staphylococcus aureus genotype B sec. second h hour(s) SPC standard plate counts HACCP Hazard Analysis and Critical Control Point spp. species HCl hydrochloric acid STEC Shiga toxin-encoding-positive Escherichia coli HFB Half-Fraser broth stx Shiga toxin-encoding HUS haemolytic uremic syndrome TB tuberculosis iap invasion associated gene TBC total bacterial counts IMI intramammary infections TSA-Y Tryptic soy agar plus 6% Yeast K. Klebsiella U Unit KÄ Kanamycin Aesculin Azide UV ultraviolet KBE kolonienbildende Einheiten V volt L. Listeria VRBL Violet Red Bile Lactose LAB lactic acid bacteria VTEC verotoxin producing Escherichia coli
LPC laboratory pasteurization counts XLD Xylose-Lysine-Deoxycholate agar
4
INDEX
1 INTRODUCTION ...........................................................................................................6
1.1 MICROFLORA IN RAW COW MILK ..........................................................................6 1.2 TEAT AND UDDER SURFACE ...................................................................................7 1.3 BOVINE MASTITIS .................................................................................................8 1.4 MICROBIOLOGICAL QUALITY OF BULK TANK MILK SAMPLES ................................ 10 1.5 ZOONOTIC AGENTS IN BULK TANK MILK .............................................................. 11 1.6 LEGAL REGULATIONS FOR RAW MILK AND NATIONAL DATA ................................. 13
2 AIM OF THIS WORK ................................................................................................... 15
3 MATERIALS AND METHODS ....................................................................................... 16
3.1 MATERIALS ......................................................................................................... 16 3.2 METHODS ........................................................................................................... 19
3.2.1 FARM CHARACTERISTICS AND SAMPLING ..................................................... 19 3.2.2 HYGIENE INDICATOR AND POTENTIAL PATHOGEN MICROORGANISMS .......... 21 3.2.3 LACTIC ACID BACTERIAL MILK FLORA ............................................................ 21 3.2.4 IDENTIFICATION OF HYGIENE INDICATORS AND POTENTIAL PATHOGENS ...... 23 3.2.5 DIFFERENTIATION OF ISOLATES FOR CONFIRMATION .................................... 24 3.2.5.1 GRAM STAINING .................................................................................................. 24 3.2.5.2 OXIDASE REACTION ............................................................................................. 24 3.2.5.2 CATALASE REACTION ........................................................................................... 25 3.2.6 STAPHYLOCOCCUS AUREUS .......................................................................... 25 3.2.7 BACILLUS CEREUS ......................................................................................... 26 3.2.8 COLIFORMS INCLUDING E.COLI ..................................................................... 26 3.2.9 POLYMERASE CHAIN REACTION (PCR) CONFIRMATION FOR POTENTIAL
PATHOGENS ................................................................................................. 26 3.2.10 MOLECULAR EPIDEMIOLOGICAL COMPARISON OF S.AUREUS ........................ 29 3.2.11 FOODBORNE PATHOGENS ............................................................................ 30 3.2.12 PHENOTYPICAL CONFIRMATION FOR SALMONELLA SPP. ............................... 31 3.2.13 PCR CONFIRMATION FOR FOODBORNE PATHOGENS ..................................... 32 3.2.14 MOLECULAR EPIDEMIOLOGICAL COMPARISON OF L. MONOCYTOGENES. ...... 34
5
4 RESULTS .................................................................................................................... 37
4.1 FARM CHARACTERISTICS ..................................................................................... 37 4.2 MILK COOLING DYNAMICS .................................................................................. 40 4.3 HYGIENE INDICATORS AND INTRINSIC FLORA ...................................................... 40 4.4 DETECTION OF THE POTENTIAL PATHOGENS B. CEREUS AND S. AUREUS ............... 42 4.5 DETECTION OF THE FOODBORNE PATHOGENS SALMONELLA SPP. AND L.
MONOCYTOGENES .............................................................................................. 45
5 DISCUSSION AND CONCLUSION ................................................................................. 46
6 EXTENDED SUMMARY ............................................................................................... 51
7 ZUSAMMENFASSUNG ............................................................................................... 52
8 REFERENCES .............................................................................................................. 54
9 APPENDIX ................................................................................................................. 62
6
1 INTRODUCTION
1.1 MICROFLORA IN RAW COW MILK The milk of healthy cows is nearly sterile, it contains relatively few bacteria (102–103 /ml), originating
from the surface of the udder and the teats, the lying surface (litter), feed and silage, the milker
hands, the air, the water that is used for cleaning the udder, and from the surfaces of the milking
equipment (TOLLE, 1980; KURZWEIL,1973;http://www.fao.org/docrep/004/t0218e/t0218e03.htm;
http://www.uoguelph.ca/foodsafetynetwork/raw-milk; accessed: 01.07.2013; Figure 1).
The high nutrient content (proteins, fats, carbohydrates, minerals, vitamins) and the physico-
chemical parameters as a pH near neutral and a high water activity (aW: 1.0) favours the growth of
many microorganisms (FRANK, 1997).
Figure 1. Sources of microbiological contamination for raw milk
Lactic acid bacteria (LAB), a group of bacteria that ferment lactose to lactate, are the dominant
population in raw bovine milk including the most important genera: Lactococcus, Lactobacillus,
Leuconostoc, Streptococcus and Enterococcus. Further frequently isolated germs are psychrothrophs
7
(Pseudomonas, Acinetobacter spp.) also growing during cold storage, aerobe-sporeformers (Bacilli)
and yeasts and moulds (http://www.extension.org/pages/11811/sources-and-causes-of-high-
bacteria-counts-in-raw-milk:-an-abbreviated-review; accessed: 01.07.2013; QUIGLEY et al., 2011).
1.2 TEAT AND UDDER SURFACE The surface of the cow's udder and teats can be heavily populated with skin-, mucosal commensal
flora (basically representatives of the group of gram-positive bacteria) and microorganisms from the
direct environment (manure, feed, and bedding). BRAEM et al. (2012) explored the teat apex
microflora applying the culture-independent 16S rRNA gene sequencing for bacterial identification.
Firmicutes and Actinobacteria comprised the majority of bacterial phyla (32% and 42% respectively),
followed by Proteobacteria and Bacteroidetes. Opportunistic pathogens were mainly represented by
a large variety of Corynebacterium, Staphylococcus, Acinetobacter, Aerococcus and Psychrobacter.
The diverse microbial population of the cow teat skin (lactic acid bacteria, Staphylococcus,
Enterococcus, Pediococcus, Enterobacter, Pantoea, Aerococcus, and Actinobacteria) has a major
impact on the flavour and quality of further processed milk and products. VERDIER-METZ et al.
(2012) observed a breakdown of microbial flow from animal to milk when detecting bacterial species
as Staphylococcus (S.) auricularis, S. devriesei, Streptococcus (Sc.) bovis, Sc. equinus, or Arthrobacter
(A.) gandavensis.
When the legs and teat ends are soiled with feces the gram-negative microflora, especially coliforms
(e. g. Escherichia (E.) coli, Klebsiella spp., Enterobacter spp., Proteus spp.) are dominating the skin
surface. MUNOZ et al. (2008) studied the cleanliness and Klebsiella spp. contamination status before
and after premilking udder preparation. Klebsiella spp. was still isolable from the teat surface after
preliminary cleaning before milking, when udders were heavily soiled with mud and feces. In a follow
up study, the same scientific research group suggested to hold alleyways and holding pens in a good
hygiene condition, to control the latter opportunistic udder pathogens Klebsiella (K.) oxytoca and
Klebsiella (K.) pneumoniae (ZADOKS et al., 2011).
8
1.3 BOVINE MASTITIS
Healthy dairy cows are not the main source of high aerobic mesophilic counts (AMC) in bulk tank
milk, but cows affected by mastitis are capable of shedding large numbers (up to 107colony forming
units (cfu) per ml) of udder pathogens and potential zoonotic agents into the milk supply. The
intensity of the bulk milk contamination depends on the stage of infection, the microorganism and
the dispersion in the dairy herd (BRAMLEY AND MCKINNON, 1990). A special burden for the dairy
production, causing substantial economic losses to the industry worldwide, is when dairy cattle are
suffering from undiscovered subclinical mastitis, masked by fluctuating somatic cell counts (SCC)
(BRAMLEY et al., 1996). Subclinical mastitis indicates inflammation but not necessarily infection of
the udder (International Dairy Federation (IDF), 1987).
Abnormal mastitis milk is defined by the presence of flakes, clots, or other serious changes in the
milk character of quarter milk samples (QMS). Milk samples which are tested positive in the
bacteriological investigation do not mandatory require a reference to higher SCC. Despite this fact,
SCC of clinical quarters will almost always be ≥200,000 cells/ml (NATIONAL MASTITIS COUNCIL
(NMC), 2001; http://nmconline.org/docs/abnmilk.pdf. accessed on: 17.09.2013).
From the clinician's perspective following organisms are known as major mastitis pathogens: S.
aureus, Sc. agalactiae, Sc. uberis, Sc. dysgalactiae, and coliforms (e.g. E. coli, K. pneumoniae, Serratia
(S.) marcescens, Enterobacter (E.) cloacae). They are usually considered as more virulent and have a
higher damaging effect on the udder tissue than minor mastitis pathogens such as Corynebacterium
(C.) bovis and coagulase-negative staphylococci (CNS) (REYHER et al., 2012; SCHUKKEN et al., 2012).
Premilking udder hygiene plays an important part in reducing opportunistic mastitis organisms
(PANKEY, 1989; ELLIS et al., 2007).
Cow and udder hygiene is directly affected by the standing and lying behaviour of cows and their
environment. Frequently cleaning of the lying areas and the passages should improve cow hygiene
and reduce the risk for S. aureus, Sc. uberis and coliform infections (DEVRIES et al., 2012; PADUCH et
al., 2013).
Additionally, season has a major impact on udder and milk hygiene in combination with milking
routine and cow cleanliness: A study of the University of Milano showed that AMC, coliform counts
(CC) and SCC significantly increased during summer. Coagulase-positive staphylococci (CPS) were
more detected during cold seasons. Cow-cleanliness was directly influencing the isolation of
9
psychrotrophic bacteria and CC in bulk tank milk samples. Farms including forestripping, pre-dipping
and post-dipping had lower teat contamination and hygiene indicator bacteria counts in the foremilk
(ZUCALI et al., 2011).
Teat-end condition is a further important factor influencing udder health and milk hygiene. Milk cows
with very rough teat end rings (teat score 3-4) and very dirty udders (udder hygiene score 3-4) have a
greater predisposition for intramammary infections (IMI) (DE PINHO MANZI et al., 2012;
http://www.dairyco.org.uk/technical-information/animal-health-welfare/mastitis/symptoms-of-
mastitis/teat-physiology/teat-scoring/;
http://milkquality.wisc.edu/wpcontent/uploads/2011/09/udder-hygiene-scoring-chart.pdf.;
accessed: 02.08.2013).
Many experts are determining the quarter and cow risk factor for IMI in association with SCC
>100,000 cells/ml. BREEN et al. (2009) included factors as cow hygiene status, teat-end defects as
callosity and hyperkeratosis, body condition score (BCS) and milk yield and quality. A lack in these
individual quarter and cow-level factors, advanced stage of lactation, SCC ≥200,000 cells/ml in the
previous lactation period and an energy deficiency or oversupply are influencing the risk of IMI
during lactation.
A special focus in mastitis prevention is laid on analyzing the risk factors of heifers to suffer from IMI.
PIEPERS et al. (2011) described following factors supporting the risk of IMI caused by the contagious
major pathogens: a higher SCC (>200,000 cells/ml), ineffective fly control, contact to lactating cows in
the pre-phase of calving and serious udder edemata. A lack in udder and milking hygiene and
ineffective mineral and vitamin supplementation for primiparous cows increased the infection risk
caused by environmental major pathogens.
An interesting finding was published by MØRK et al. (2012) who investigated the reservoir and routes
of S. aureus transmission in sheep and dairy cattle. The latter organism was found to be frequently
present in the nasal cavity of sheep, but the prevalence was notably lower in bovine nares.
PICCININI et al. (2009) underlined the special role of teat skin as a potential S. aureus reservoir in
dairy cows. The research group showed that the genetic fingerprinting patterns of S. aureus isolated
from teat, milk and curd samples, analyzed by pulse field gel electrophoresis (PFGE), were identical,
and hypothesized that some strains are stronger related to the udder and also increase the risk for
contamination of milk products. HAVERI et al. (2008) investigated IMI caused by S. aureus and
extramammary sites as teat skin, skin lesions, teatcups, hands and nostrils of the farmers. S. aureus
isolated from infected glands and extramammary sites shared to a majority the same PFGE pattern.
Each investigated cow herd had its own predominant S. aureus clone.
10
1.4 MICROBIOLOGICAL QUALITY OF BULK TANK MILK SAMPLES
A major impact on AMC and CC has the degree of teat soiling prior to milking, clipping of the udder
hair, udder preparation including cleaning followed by drying, manual cleaning of the milk tank with
low water temperature and the application of specific detergents. A negative influence on the bulk
milk quality is related with plate cooling systems. The design of plate coolers hampers effective
cleaning and remaining debris facilitate the formation of bacterial biofilms. A further risk factor for
low milk quality is an infrequent acid wash of the milking equipment (ELMOSLEMANY et al. 2009;
ELMOSLEMANY et al., 2010). A study focused on the bacteriological quality of Italian bulk tank milk
published by BAVA et al. (2011) showed that the water temperature during the cleaning cycles of the
milking equipment was often <45°C and supported the multiplication of psychrothrophic bacteria
and coliforms in post-rinse water. Increased total bacterial counts (TBC) are strongly related with
increased CC and laboratory pasteurization counts (LPC). Failures in milk hygiene are often linked to
the presence of biofilms (chronic problem) rather than an exceptional error such as milk incubation
in the milk line (PANTOJA et al., 2009).
KELLY et al. (2009) showed in their analysis of herd management practices in Irish dairy farms, that
the application of heated water in the milking parlour, the participation in a milk recording scheme,
tail clipping of cows several times per year, and generally a high hygiene level in the parlour and
cubicles had an immediate effect to decrease TBC. Managing and monitoring of cluster washes, rate
of milking units fall-offs, and in-line CC could marginally improve the bacteriological quality of bulk
tank milk (PANTOJA et al., 2011).
JAYARAO et al. (2004) investigated bulk tank milk samples of 126 dairy farms in 14 counties of
Pennsylvania to develop guidelines for SCC and bacterial counts (BC) bulk tank milk monitoring. The
authors showed that the mastitis associated bacteria S. aureus and Sc. agalactiae were closely
associated with an increased bulk tank somatic cell count (BTSCC), but coliform counts were not
correlating with an increased SCC and BC. Herd size and farm management practices had a major
influence on the bacterial quality and SCC of bulk tank milk.
A French survey on raw milk further processed to manufacture Protected Designation of Origin (PDO)
raw cow milk cheeses revealed that coliforms, somatic cells, and CPS showed no seasonal variation.
Pseudomonads were highly variable and were detected in potable water and when a few isolated
failures during cleaning and rinsing of the dairy equipment occurred (LERICHE and FAYOLLE 2012).
11
Recently, GARGOURI et al. (2013) investigated the influence of psychrotrophic counts (PC) and SCC
on lipolysis during milk reception and further cold storage. Initially, lipolysis was closely related to
SCC and PC counts. During storage the effects of SCC and PC on lipolysis decreased. The initial
lipolysis level and intrinsic milk lipoprotein lipase had the strongest influence on lipolysis.
OLIVEIRA et al., (2011b) detected a high amount of enterotoxigenic Staphylococci in Brazilian cow´s
raw milk. Most of the strains were able to produce enterotoxin D (68%) and 12.8% also produced
enterotoxin A. The authors stated the risk of both, CPS and coagulase negative Staphylococci (CNS),
and suggested to generally focus on Staphylococcus with enterotoxigenic potential.
1.5 ZOONOTIC AGENTS IN BULK TANK MILK Milk and dairy products are generally healthy components of our alimentation and heat treatment as
pasteurization is the most effective method to destroy pathogen organisms. Further national raw
milk surveillance systems at the farm level have decreased the shedding of zoonotic pathogens by
ruminants, but the fully elimination is not possible. A major risk is introduced in the dairy chain via
environmental contamination and recontamination during the processing of raw milk (ANGULO et
al., 2009; NMC, 2009; http://nmconline.org/docs/RawMilkStatement.pdf.; Tiergesundheitsdienst
Austria ("TGD"); http://www.tgd.at; both accessed on: 18.09.2013; OLIVER et al., 2009).
RUUSUNEN et al. (2013) determined the pathogenic status in Finnish bulk tank milk samples. CPS
were present in 34.4% and representatives of the Bacillus (B.) cereus group were detected in 20.8%
of the samples. Furthermore, 5.5% of the raw milk samples were positive for Listeria (L.)
monocytogenes and 2.7% Shiga toxin–encoding (stx)-positive E. coli (STEC) respectively. Generally,
TBC were low in the bulk tank milk samples and no relation to pathogen detection could be found.
Therefore, pathogens could also be found in farms with high levels of hygiene, are able to multiply at
refrigeration temperatures and pose a potential risk for human health.
VAN KESSEL et al. (2011) collected bulk tank milk and in-line milk filters in the United States and
found 28.1% Salmonella enterica, 7.1% L. monocytogenes, and 51.0% stx genes mainly in milk filters.
The authors confirmed that the consumption of raw milk poses a certain health risk.
Recently, the occurrence of foodborne pathogens in in-line filters was determined by polymerase
chain-reaction (PCR) in Northern Italy by GIACOMETTI et al., 2012. The multivariate data analysis
revealed that Campylobacter spp. and verotoxin producing E. coli (VTEC) was related with inadequate
cleanliness of bedding and milk tank and a lack in forestripping.
12
Apparently, raw milk samples for artisan cheese making and 60-day aged raw milk cheeses meet in
the majority of the cases the threshold limits for microbial contamination (BROOKS et al., 2012;
D’AMICO and DONNELLY, 2010). D’AMICO and DONNELLY (2010) reported that 86% of samples had
standard plate counts (SPC) below 10,000 cfu/ml, and 98% of the cow milk samples met the critera of
United States’ Grade A Pasteurized Milk Ordinance for SCC. L. monocytogenes, Salmonella spp., and
E. coli O157:H7 were absent in the investigated samples. Furthermore, S. aureus was detected in 38%
of the samples at a very low amount (20 cfu/ml).
The prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in German bulk tank milk
samples was investigated by KREAUSUKON et al. (2012). Thirty-six isolates from dairy herds were
assigned to clonal complex CC398 and had similar strain features as strains from pigs. HUBER et al.
(2011) compared MRSA strains from livestock and veterinarians and found in a genotypical analysis
that one separate cluster consisted of all MRSA ST 398 strains including isolates from pigs, cattle and
veterinarians.
Coxiella (C.) burnetii, the agent of Q fever, was detected in 42.9% of commercially available raw milk
samples (LOFTIS et al., 2010). TILBURG et al. (2012) showed that the widespread presence of C.
burnetii in milk samples was linked to a predominant genotype in the dairy cattle population.
The zoonotic potential of bovine tuberculosis (TB) caused by Mycobacterium (M.) bovis remains a
major public health problem in both developing and European countries. Especially the wildlife was
recognized to interfere with the spread of the disease, as badgers were identified as vector (RU et al.,
2013). A further zoonotic agent, which can be detected in milk of bovine origin, is Mycobacterium
avium subsp. paratuberculosis (MAP), related to Crohn's disease in humans, a type of inflammatory
bowel disease. Milk is contaminated directly via excretion of MAP from the udder, or via feces. The
bottleneck in the disease detection is the poor sensitivity of test methods and that MAP is difficultly
cultivable. A modeling approach showed that MAPs could be fecally excreted by very few “high
shedders” (ELTHOTH et al., 2009; OKURA et al., 2013).
JAYARO et al. (2006) published a survey focused on the risk of exposure of dairy producers in
Pennsylvania due to the consumption of raw milk. Farmers who were not aware of the risk of
foodborne pathogens consumed two-fold more likely raw milk. Thirteen percent of the investigated
samples contained more than one zoonotic agent.
Several recent foodborne outbreaks have been linked to the consumption of raw milk and raw milk
cheeses.
GUH et al. (2010) reported an Escherichia coli O157 outbreak in Connecticut due to the consumption
of raw milk, with complications for three patients suffering from haemolytic uremic syndrome (HUS).
13
HEUVELINK et al. (2009) described two milk-associated Campylobacter enteritis outbreaks in the
Netherlands. The raw milk was fecally contaminated with C. jejuni and resulted in diarrhoea in a
group of school children after consumption. A second case of Campylobacteriosis was also linked to
the consumption of raw milk (84% of adults had become ill).
Sporadically farm outbreaks have been caused by M. bovis. DORAN et al. (2009) published data on
the herd incidence (5%) and the transmission from cattle to humans (two children). The main source
of transmission was a seven-year old cow with tuberculous lesions in the udder. The milk was fed to
the calves and consumed by the family without heat treatment.
Salmonella spp., L. monocytogenes outbreaks, and S. aureus intoxications of the last years were most
often linked to raw milk cheeses (VAN DUYNHOVEN et al., 2009; JACKSON et al., 2011; OSTYN et al.,
2010). A seldom reported S. aureus intoxication transmitted via pasteurized milk occurred in 2007 in
Austria. Elementary school children were affected after the consumption of school milk products.
The outbreak was traced back to a processing failure, where pasteurized milk was prolonged stored
and was recontaminated during a further pasteurization step. The dairy cattle of the milk supplying
farm were found to be the main reservoir (SCHMID et al., 2009).
1.6 LEGAL REGULATIONS FOR RAW MILK AND NATIONAL DATA According to Regulation (EC) No. 853/2004 of the European parliament and the council from 29th
April 2004 raw milk has to be cooled down to a maximum of +8 °C when collected on a daily base,
and to a maximum of +6 °C by a collection on every second day . During transport the temperature
should not exceed 10°C (EUROPEAN COMMISSION (EC), 2004).
The mesophilic standard plate counts (SPC; 30 °C) per ml should be ≤ 100,000 (minimum two
samplings per month, geometric mean over two months). The somatic cells counts (SCC) (per ml)
must be ≤ 400,000 (minimum one sampling per month, geometric mean over 3 months).
In Austria the national raw milk regulation (BGBI. II No. 106/2006) prescribes SPC ≤ 50,000/ml and
the SCC ≤ 400,000/ml at farm level (ANONYMOUS, 2006).
According to the quality characteristics, raw milk can be classified in three major groups (Table 1).
The classification according to the national milk quota regulation (BGBl. II No. 209/2007) serves as a
reference for the milk price calculation (ANONYMOUS, 2007).
14
Table 1. Classification of raw milk according to the determined milk quality (cfu/ml).
In 2013, 81.90-90.31% of the Austrian raw milk producers supplied a raw milk quality classified
according to S-class (Agrarmarkt Austria (AMA); Market report for milk and milk products 2013;
http://www.ama.at/Portal.Node/public?gentics.am=PCP&p.contentid=10007.27060; accessed on:
17.09.2013).
Food safety criteria for raw milk (including pathogenic organisms) according to the European
Commission Regulation (EC) No. 2073/2005 are listed in Table 2.
MICROORGANISM SAMPLING PLAN
LIMITS ANALYTICAL REFERENCE METHOD
CRITERION STAGE
n c
Salmonella spp. 5 0 absent in 25 g EN/ISO 6579 products placed on the
market during their shelf-life
Listeria monocytogenes 5 0 absent in 25 g EN/ISO 11290-1 at the date of delivery
n: number of samples; c: number of samples with values between m and M.
S-CLASS 1ST DEGREE 2ND DEGREE Plate counts ≤ 50,000 ≤ 100,000 > 100,000 Somatic cells ≤ 250,000 ≤ 400,000 > 400,000
15
2 AIM OF THE WORK Raw milk can be a vehicle of zoonotic agents. Usually raw milk is pasteurized to prevent the
consumption of pathogen organisms, but there are also some products made directly from raw milk.
The aim of this work was:
1. To determine the influence of cooling conditions on the microbiological quality of raw milk.
Therefore we determined the cooling dynamics on 18 small scale farms in Styria, Austria.
Measurements have been made in winter and in summer to see if the outdoor temperature
had a seasonal influence.
2. To determine the hygiene status of the collected milk samples (70) in respect of hygiene
indicator organisms (AMC, CC, yeast and moulds, pseudomonads, enterococci) intrinsic lactic
acid flora, pathogenic microorganisms (L. monocytogenes, Salmonella spp.) and potential
pathogens (S. aureus, Bacillus (B.) cereus).
3. To illustrate the molecular epidemiology of two selected organisms, S. aureus and L.
monocytogenes.
16
3 MATERIALS AND METHODS 3.1 MATERIALS
Table 3. List of equipment and consumables. EQUIPMENT
Chef DR III Bio-Rad, Hercules, CA, USA
Datalogger TFA Log 110 TFA Dostmann GmbH & Co. KG, Wertheim, Germany
Electrophoresis equipment Bio-Rad, Hercules, CA, USA
Freezer-80°C SANYO Electric Co., Ltd.; Panasonic Germany, Hamburg, Germany
Gel Doc imaging system 2000 Bio-Rad, Hercules, CA, USA
Incubator 25°C; 30°C; 37°C Ehret, Emmendingen, Germany
Inoculation loops Sarstedt AG & Co., Nümbrecht, Germany
Nalgene® Polypropylen bottles Thermo Fisher Scientific, Vienna, Austria
Pasteur pipette Karl Hecht Ges.mbh, Fritzens, Austria
Petri dishes (Ø 90 mm) STERILIN Ltd., Newport, UK
Pipettes Eppendorf Austria GmbH, Vienna, Austria
Refrigerator + 4°; Freezer-20°C Liebherr-International AG, Bulle, Schweiz
Shaking water bath GFL, Burgwedel, Germany
Stomacher bag Seward Ltd., Worthing, United Kingdom
Thermocycler Eppendorf AG, Vienna, Austria
Thermomixer Eppendorf AG, Vienna, Austria
CHEMICALS AND REAGENTS
Aqua bidest. Mayrhofer Pharmazeutik, Leonding, Austria
Boric acid Sigma Aldrich, Vienna, Austria
Ethylenediaminetetraacetic acid (EDTA) Sigma Aldrich, Vienna, Austria
Glycerol Merck KGaA, Darmstadt, Germany
Hydrochloric Acid (HCl) Sigma-Aldrich, Vienna, Austria
N-Lauroylsarcosine sodium salt Sigma-Aldrich, Vienna, Austria
Sodium deoxycholate Sigma-Aldrich, Vienna, Austria
Sodium dodecyl sulfate (SDS) Sigma Aldrich, Vienna, Austria
Sodiumchlorid (NaCl) Merck KGaA, Darmstadt, Germany
Tris(hydroxymethyl)-aminomethan (Tris) Sigma-Aldrich, Vienna, Austria
17
Table 3 continued. List of equipment and consumables. BUFFERS AND SOLUTIONS Physiological Saline Baxter GmbH, Vienna, Austria Ringer solution tablets Oxoid Ltd., Basingstoke, UK DISINFECTANT
Mikrozid Schülke&Mayr, Norderstedt, Germany
REAGENTS FOR DNA EXTRACTION
0.1M TrisHCl Sigma-Aldrich, Vienna, Austria
Chelex® 100 Resin Bio-Rad Laboratories, Marnes-la-Coquette, France
REAGENTS FOR PCR ANALYSIS Deionized, diethylpyrocarbonate (DEPC)-water MBI Fermentas, St. Leon-Rot, Germany dNTP Mix Thermo Fisher Scientific, Vienna, Austria PCR Primer Eurofins MWG Operon, Ebersberg, Germany Platinum ® Taq DNA Polymerase Invitrogen, Lofer, Austria REAGENTS FOR ELECTROPHORESIS Agarose Sigma Aldrich, Vienna, Austria Gene Ruler 100bp DNA ladder MBI Fermentas, St. Leon-Rot, Germany Gene Ruler 1kb DNA ladder MBI Fermentas, St. Leon-Rot, Germany Loading Dye Solution MBI Fermentas, St. Leon-Rot, Germany Sybr Safe Invitrogen, Lofer, Austria TBE-Puffer 10x (Tris-Borat-EDTA-Puffer) Sigma Aldrich, Vienna, Austria REAGENTS FOR PFGE TYPING Apa I MBI Fermentas, St. Leon-Rot, Germany Asc I MBI Fermentas, St. Leon-Rot, Germany Lysostaphin from Staphylococcus simulans Sigma Aldrich, Vienna, Austria Lysozyme Sigma Aldrich, Vienna, Austria Proteinase K Roche Diagnostics GmbH, Applied Science, Vienna, Austria RNAse Qiagen GmbH, Hilden, Germany Seakem Gold Agarose Lonza Group Ltd., Basel, Switzerland Sma I MBI Fermentas, St. Leon-Rot, Germany Xba I MBI Fermentas, St. Leon-Rot, Germany
18
Table 3 continued. List of equipment and consumables. ENRICHMENT MEDIA
Brain Heart Infusion plus 6% Yeast (BHI-Y) Merck KGaA, Darmstadt, Germany
Buffered Peptone Water (BPW) Oxoid Ltd., Basingstoke, UK
Fraser broth (FB) Merck KGaA, Darmstadt, Germany
Half-Fraser broth (HFB) Biokar Diagnostics, France
Muller-Kauffmann Tetrathionate-Novobiocin broth (MKTTn) Oxoid Ltd., Basingstoke, UK
Rappaport-Vassiliadis Soya Peptone (RVS) broth Oxoid Ltd., Basingstoke, UK
SELECTIVE PLATING MEDIA Aloa agar (Chromogenic Listeria-selective agar acc. to Ottaviani and Agosti)
Merck KGaA, Darmstadt, Germany
Baird Parker agar (BP) Merck KGaA, Darmstadt, Germany GSP agar (Glutamate Starch Phenol Red agar) Merck KGaA, Darmstadt, Germany Kanamycin Aesculin Azide agar (KÄ) Oxoid Ltd., Basingstoke, UK M17 agar Oxoid Ltd., Basingstoke, UK Mannitol Egg Yolk Polymyxin agar (MYP) Oxoid Ltd., Basingstoke, UK MRS agar Oxoid Ltd., Basingstoke, UK Palcam agar Biokar Diagnostics, Beauvais Cedex, France Plate Count agar (Tryptone Glucose Yeast agar) Oxoid Ltd., Basingstoke, UK Rose-Bengal Chloramphenicol agar (RBCA) Merck KGaA, Darmstadt, Germany Tryptic soy agar plus 6% Yeast (TSA-Y) Merck KGaA, Darmstadt, Germany Violet Red Bile Lactose agar (VRBL) Oxoid Ltd., Basingstoke, UK Xylose-Lysine-Deoxycholate (XLD) agar bioMérieux sa, Marcy l'Etoile, France
REAGENTS FOR MICROBIOLOGIAL CONFIRMATION API 50 CH bioMérieux sa, Marcy l'Etoile, France API ID 32 E bioMérieux sa, Marcy l'Etoile, France API Listeria bioMérieux sa, Marcy l'Etoile, France API rapid ID 32 E bioMérieux sa, Marcy l'Etoile, France API Staph bioMérieux sa, Marcy l'Etoile, France Coagulase Plasma (Rabbit plasma w/EDTA) Remel,Lenexa, USA Oxidase test bioMérieux sa, Marcy l'Etoile, France Oxoid Salmonella Latex Test Oxoid Ltd., Basingstoke, UK
19
3.2 METHODS
3.2.1 FARM CHARACTERISTICS AND SAMPLING Eighteen dairy farms in Styria were visited for the sampling of bulk tank milk (BTM) and the
determination of physico-chemical parameters (pH and temperature) during two sampling events in
winter and summer 2011. The cooling dynamics of raw milk stored in different models of bulk tanks
were recorded by data logging and seasonal fluctuations were recorded. Therefore the dairy farms
were visited and sampled at the beginning of the cooling process and additionally before milk
collection by the district dairy, which was generally two days later. The data logger recording started
at the beginning of milking, and respectively when the cooling of raw milk started, and ended when
the programmed cooling temperature was achieved. An additional record was taken two days later
when the raw milk was collected by the district dairy.
To determine the microbiological hygiene and pathogen status of the raw milk samples, 500 ml were
collected twice (at the beginning of milk storage and two days later) at each dairy farm. Therefore
the raw milk samples were collected aseptically in sterile Polypropylen bottles (NALGENE®, Thermo
Fisher Scientific, Vienna, Austria). The latter samples were transported immediately in a cooling box
at 4°C to the laboratory of investigation (Institute for Milk hygiene, Milk technology and Food science
(IMMF), Vetmeduni, Vienna, Austria).
A checklist/questionnaire including farm relevant data was prepared according to Table 4.
1ST VISIT date, time_________________________________________________________________________ outdoor temperature_______ °C FARM DATA farm______________________________________________________________________________ LIVE STOCK cattle breed □ Brown Swiss □ Holstein-Friesian □ Simmental FLeckvieh □ _______________ cattles total______________________ dairy cows_______________________ lactating cows_____________ other animals_____________________ Ø milk quantity____________________
20
MILKING TECHNIQUE stable temperature____________ °C milking equipment, type, brand_______________________ COOLING TECHNIQUE cooling chamber temperature_________ °C bulk tank model_______________________ __________ kW COOLING DYNAMICS final temperature____________ °C (by data logger) final temperature by milk tank display_____________ °C pH of raw milk______________ MICROBIOLOGY (INFORMATION BY FARMER) *BTM-SCC_______________ **BTM-AMC_____________________ dairy _____________________ 2ND VISIT date, time______________________________ outside temperature_______ °C COOLING DYNAMICS final temperature___________ °C (by data logger) final temperature by milk tank display_____________ °C pH of raw milk______________ Abbreviations: *bulk tank milk somatic cell counts (BTM-SCC) **bulk tank milk aerobic mesophilic counts (BTM-AMC)
21
3.2.2 HYGIENE INDICATOR AND POTENTIAL PATHOGEN MICROORGANISMS The total aerobic mesophilic counts (AMC) were determined by pour plate technique according to
ISO 4833 (2003). Therefore 10 ml raw milk samples were serially diluted in sterile Ringer´s solution
(Oxoid Ltd., Basingstoke, UK) in 10-fold steps up to dilution -5. From each dilution 1 ml were
transferred in duplicates to sterile Standard Petri dishes (Ø 90 mm) (STERILIN Ltd., Newport, UK).
Subsequently, melted Plate Count agar with Antibiotic free Skim Milk (PCA) was cooled down to 48°C
in a water bath (GFL, Burgwedel, Germany). Fifteen ml of PCA agar was gently mixed with 1 ml of the
corresponding dilution. The dilution series was further applied for the enumeration of coliforms and
yeast and moulds.
For the enumeration of coliforms Violet Red Bile Lactose (VRBL) agar was used following the
instructions of ISO 4832 (2006). Yeasts and moulds counts were determined on Rose-Bengal
Chloramphenicol (RBCA) agar, both by pour plate technique (Figure 2). The enumeration of
Enterococci, Pseudomonas spp. and the potential pathogenic bacteria S. aureus and B. cereus was
performed by spatula method on Kanamycin Aesculin Azide agar (KÄ), Glutamate Starch Phenol Red
(GSP) Baird Parker (BP) agar (ISO 6888-1, 1999) and Mannitol Egg Yolk Polymyxin (MYP) agar. The
latter four detection methods were performed by surface plating method. Therefore, 1 ml sample
was examined directly on three selective agar plates. Further dilutions were plated onto the
appropriate selective agar by spreading each 100 μl evenly with a sterile Pasteur pipette (Karl Hecht
Ges.mbh, Fritzens, Austria) formed to a spatula (Figure 3). All selective agar media of this section
were prepared according to the manufacturer´s instruction (Merck KGaA, Darmstadt, Germany;
Oxoid Ltd.).
3.2.3 LACTIC ACID BACTERIAL MILK FLORA For the enumeration of Lactobacilli a serial dilution (1:10) up to -2 was plated in duplicates onto MRS
agar acc. to de Man, Rogosa and Sharpe and for counting lactic acid Streptococci on M17 agar acc. to
Terzaghi (Figure 2).
22
Figure 2. Work flow for enumeration of hygiene indicators in raw milk samples acc. to pour plate method.
Abbreviations: PC, Plate Count agar; VRB, Violet Red Bile Lactose agar; RBC, Rose-Bengal Chloramphenicol agar Dil, Dilution; MRS agar acc. to de Man, Rogosa and Sharpe; M17 agar acc. to Terzaghi;
23
Figure 3. Work flow for enumeration of hygiene indicator bacteria in raw milk samples acc. to surface plating method.
Abbreviations: BP, Baird Parker; KÄ, Kanamycin Aesculin; MYP, Mannitol Egg Yolk Polymyxin; GSP, Pseudomonas spp. and Aeromonas spp. selective agar according to KIELWEIN;
3.2.4 IDENTIFICATION OF HYGIENE INDICATORS AND POTENTIAL PATHOGENS After incubation of the agar media at each mandatory time and temperature (Table 4), colonies were
identified on agar media according to the manufacturer´s instructions (Table 10) and enumerated
according to the formula (weighted arithmetic mean):
∑ C = Amount of all colonies on all agar-plates counted n1 = Number of agar-plates in first dilution counted n2 = Number of agar-plates in second dilution counted d = Dilution factor of first dilution counted Only plates (or replicate plates from the same dilution) with 10-300 colonies were counted.
24
Table 4. Incubation time and temperature for the target organisms included in this study. TARGET MICROORGANISM
AGAR INCUBATION TEMPERATURE
INCUBATION TIME
AMC Plate Count (PC) 30°C 24-72 hours Coliforms Violet Red Bile Lactose (VRBL) 30°C 24 hours Yeasts and Moulds Rose-Bengal Cloramphenicol
(RBC) 25°C 3-5 days
Lactobacilli MRS 37°C 24-48 hours Lactic Acid Streptococci M17 37°C 24-48 hours Pseudomonas spp. GSP 25°C 24-48 hours Enterococci Kanamycin Aesculin Azide (KÄ) 37°C 24-48 hours S. aureus Baird Parker (BP) 37°C 24-48 hours B. cereus Mannitol Egg Yolk Polymyxin
(MYP) 30°C 24-48 hours
Abbreviations: AMC, aerobic mesophilic counts;
3.2.5 DIFFERENTIATION OF ISOLATES FOR CONFIRMATION
3.2.5.1 GRAM STAINING To differentiate gram-positive (violet) from gram-negative (red) bacteria, gram staining on object
slides was performed. To prepare the bacteria of interest for staining on the slide, the suspicious
colonies were distributed in one drop of physiological saline solution (Merck KGaA), air-dried and
heat-fixed by moving the slide gently through a flame. The object slide with the fixed bacteria smear
was immersed into crystal violet (Merck KGaA) for 1 minute to stain gram-positive bacteria, followed
by Lugol´s solution (Merck KGaA) for 1 minute to form a complex that is water-insoluble but soluble
in ethanol. By immerse the slide into ethanol for 1 minute the complex was extracted from gram-
negative bacteria. To stain gram-negative bacteria, the slide was immersed in Safranin solution
(Merck KGaA) for 1 minute, followed by washing the slide with deionised water.
3.2.5.2 OXIDASE REACTION A sterile test strip was moistened with two or three drops of Oxidase reagent (bioMérieux SA). A loop
of the test organism was applied on the reaction zone. Due to the presence of cytochromoxidase, the
result was recorded as positive, when the test zone changed the colour to dark-violet within twenty
seconds.
25
3.2.5.3 CATALASE REACTION Suspicious colonies were mixed gently with one drop of 3 % hydrogen peroxide solution (H2O2; Sigma
Aldrich). Catalase positive isolates hydrolyzed to water and oxygen causing bubbles.
Further differentiation was performed according to Figure 4.
3.2.6 STAPHYLOCOCCUS AUREUS The lecithinase-positive Staphylococci were enumerated on Baird Parker agar (BP) according to ISO
6888-1. Up to five suspicious colonies were sub cultivated and purified for further confirmatory steps
on Tryptic soy agar plus 0.6% Yeast (TSA-Y; Merck KGaA) and incubated for 24h at 37°C.
Clumping factor was performed on sterile microscopic slides (Menzel, Braunschweig, Germany) by
gently mixing a loopful of the test isolate with one drop of Coagulase Plasma (Rabbit plasma with
EDTA; Remel, Lenexa, USA). If clumps appeared within ten seconds the clumping factor test was
estimated positive.
For the tube coagulase reaction, colonies were incubated in Brain Heart Infusion broth plus 0.6%
yeast extract (BHI-Y) for 18-24 hours at 37°C. In a small sterile glass tube, 0.5ml of each liquid culture
and coagulase plasma were mixed gently. The tube was closed with Parafilm and incubated at 37°C.
The tubes were controlled for clots after 2, 4 and 24 hours.
Atypical isolates suspicious for S. aureus were further confirmed by API Staph (bioMérieux SA). A
homogenous bacterial suspension with a turbidity equivalent to 0.5 McFarland was made in API
Staph cell suspension (with colonies on TSA-Y for 24 hours at 37°C). All microtubes were filled with
the medium. The microtubes for ADH (L-arginine) and URE (Urea) were covered with mineral oil and
the incubation box was closed with a lid. During incubation, metabolism produces colour changes
26
that are either spontaneous or revealed by the addition of reagents. The reactions were read
according to the Reading Table and the identification was obtained by referring to the Analytical
Profile index or using the identification software (apiweb; bioMerieux SA). After the incubation for 24
hours at 37°C following reactions were completed: Voges Proskauer reaction for the detection of
acetoin, potassium nitrate reduction, and the β-naphthyl phosphate (PAL) for the detection of
alkaline phosphatase.
3.2.7 BACILLUS CEREUS For the phenotypical confirmation of B. cereus the API 50 CH/B was applied. The suspicious isolates
were streaked on TSA-Y agar and incubated at 30°C for 24 hours. One colony was dissolved in CHB
medium and each microtube was filled. The strip, that enables the study of the metabolism of 49
different carbohydrates, was covered with a lid an incubated at 30°C. The results were recorded after
24 hours and after 48 hours.
3.2.8 COLIFORMS INCLUDING E. COLI The confirmation of E. coli was performed using the API rapid ID 32 E system (bioMerieux SA).
Biochemical reactions are listed in Table 5.
TEST REACTION TEST REACTION ODC Ornithine decarboxylase IND Indole production ADH Arginine dihydrolase ßNAG N-acetyl-β-glucosaminidase LDC Lysine decarboxylase ßGAL β-Galactosidase URE Urease GLU Glucose LARL L-Arabitol SAC Saccharose/sucrose GAT Galacturonate LARA L-Arabinose 5KG 5 Ketoglutarate DARL D-Arabitol LIP Lipase αGLU α-Glucosidase RP Phenol red αGAL α-Galactosidase ßGLU β-Glucosidase TRE Trehalose MAN Mannitol RHA Rhamnose MAL Maltose INO Inositol ADO Adonitol CEL Cellobiose PLE Palatinose SOR Sorbitol ßGUR β-Glucuronidase αMAL α-Maltosidase MNT Malonate AspA L-Aspartic acid arylamidase
3.2.9 POLYMERASE CHAIN REACTION (PCR) CONFIRMATION FOR POTENTIAL PATHOGENS DNA extraction was performed according to the “Chelex 100” extraction protocol (WALSH et al.,
1991). Suspicious colonies were taken from the plate with an inoculation loop, added to 1 ml 0.01 M
27
Tris HCl in a 2 ml tube and vortexed well. After centrifugation for 5 minutes at 8,000 g the
supernatant was discarded. 100 μl 0.01 M Tris-HCl were added to the pellet, mixed and vortexed to
dissolve the pellet. 400 μl of Chelex Resin (Chelex© 100 Resin; Bio-Rad Laboratories, Marnes-la-
Coquette, France) were added, vortexed and incubated for 10 minutes at 100°C on a thermomixer
(Eppendorf AG, Vienne, Austria), followed by centrifugation for 5 seconds at 15,000 g. 100 μl of the
supernatant were transferred to a new tube and stored ad -20°C for further processing.
Targeting the nuc gene, presumptive S. aureus colonies were confirmed with a S. aureus PCR
(BRAKSTAD et al., 1992). The reaction volume for one PCR tube was 25 μl (20 μl Mastermix and 5 μl
Template; Table 6).
Table6. S. aureus PCR acc. to BRAKSTAD (1992).
Sequences of oligonucleotide primers PRIMER SEQUENCE (5'-3') nucA1 GCGATTGATGGTGATACGGTT nucA2 AGCCAAGCCTTGACGAACTAAAGC
PCR-Mastermix COMPONENTS FINAL CONCENTRATION STOCK CONCENTRATION μL/TUBE Aqua dest. 11.45 10x buffer 1x 2.5 MgCl2 1.5 mM 50 mM 0.75 nucA1 400 nM 5,000 nM 2 nucA2 400 nM 5,000 nM 2 dNTP`s 200 μM 5,000 μM 1 Taq polymerase (Platinum) 1.5 U 5 U/μl 0.3 Total 20 Template 5 Reaction volume 25
PCR conditions (37 cycles*)
PCR STEP TEMPERATURE TIME Initialization 94°C 2 min. Denaturation 94°C 30 sec.* Annealing 55°C 30 sec.* Elongation 72°C 1.5 min.* Final Elongation 72°C 3.5 min. 4°C ∞
The separation of the DNA fragments after PCR was performed in a gel electrophoresis chamber with
a 1.5% Agarose gel (Biorad); at 120 V for 30 min. Therefore 1.5 g of Agarose (Sigma Aldrich) was
28
dissolved in 100 ml 1x TBE buffer (Sigma Aldrich) by boiling and 3.5 μl SYBR safe (Invitrogen, Lofer,
Austria) was added. The visualization of DNA fragments was performed under UV light (Gel Doc
imaging system 2000, Biorad).
Presumptive B. cereus colonies were confirmed by Multiplex-Standard-PCR (PARK et al., 2007),
followed by gel electrophoresis. The Target genes for this PCR were groEL and gyrB. The reaction
volume for one PCR tube was 25 μl (20 μl Mastermix and 5 μl Template; Table 7).
Table 7. B. cereus PCR according to PARK (2007).
Sequences of oligonucleotide primers PRIMER SEQUENCE (5'-3') BCGSH-F GTG CGA ACC CAA TGG GTC TTC BCGSH-R CCT TGT TGT ACC ACT TGC TC BASH-F GGT AGA TTA GCA GAT TGC TCT TCA AAA GA BASH-R ACG AGC TTT CTC AAT ATC AAA ATC TCC GC BTJH-F GCT TAC CAG GGA AAT TGG CAG BTJH-R ATC AAC GTC GGC GTC GG BCJH-F TCA TGA AGA GCC TGT GTA CG BCJH-R CGA CGT GTC AAT TCA CGC GC BMSH-F TTT TAA GAC TGC TCT AAC ACG TGT AAT BMSH-R TTC AAT AGC AAA ATC CCC ACC AAT
PCR-Mastermix COMPONENTS FINAL CONCENTRATION STOCK CONCENTRATION μL/TUBE Aqua dest. 12.55 10x buffer 1x 2.5 MgCl2 1.5 mM 50 mM 0.75 BASH-F 80 nM 5,000 nM 0.4 BASH-R 80 nM 5,000 nM 0.4 BTJH-F 32 nM 5,000 nM 0.16 BTJH-R 32 nM 5,000 nM 0.16 BCJH-F 40 nM 5,000 nM 0.2 BCJH-R 40 nM 5,000 nM 0.2 BMSH-F 100 nM 5,000 nM 0.5 BMSH-R 100 nM 5,000 nM 0.5 BCGSH-F 48 nM 5,000 nM 0.24 BCGSH-R 48 nM 5,000 nM 0.24 dNTP`s 200 μM 5,000 μM 1 Taq pol (Plat.) 1.5 U 5 U/μl 0.2 Total 20 Template 5 Reaction volume 25
29
PCR conditions (30 cycles*) PCR step Temperature Time Initialization 94°C 5 min. Denaturation 94°C 30 sec.* Annealing 55°C 30 sec.* Elongation 72°C 30 sec.* Final Elongation 72°C 5 min. 4°C ∞ The separation of the DNA fragments after PCR was performed as described in the previous section
(PCR detection of S. aureus).
3.2.10 MOLECULAR EPIDEMIOLOGICAL COMPARISON OF S.AUREUS To perform a molecular epidemiological comparison of S. aureus, pulsed-field gel electrophoresis
(PFGE) including a SmaI restriction digest was used (MURCHAN et al., 2003). An overnight culture
was prepared from isolated colonies in BHI-Y (Merck KGaA) (16-24 hours at 37°C). The solution has
been centrifugated and the pellet resuspended twice with cold PIV buffer. 300 μl of the resulting cell
suspension was mixed with 300 μl of melted SeaKem Gold agarose (Lonza Group Ltd, Basel,
Switzerland) (0.36 g SeaKem Gold agarose melted in 30 ml PIV buffer; stored in 56°C water bath (GFL,
Burgwedel, Germany)), mixed gently by pipetting up and down twice, and filled into plug moulds by
avoiding air bubbles. After solidification, the plugs were pushed into 5 ml of EC lysis buffer (+ 113 μl
enzyme mix: 3 μl RNAse (Qiagen GmbH, Hilden, Germany) (100 mg/ml), 55 μl Lysozyme (Sigma
Aldrich, Vienna, Austria) (10 mg/ml), 55 μl Lysostaphin (Sigma Aldrich, Vienna, Austria) (5 mg/ml))
and incubated at 54°C in the shaking waterbath (GFL) overnight. The plugs were washed twice with
10 ml of ES buffer at 54°C and 120 rpm for ten minutes, followed by protein digestion in 5 ml of ES
buffer (+ 25 μl Proteinase K (Roche Diagnostics GmbH, Applied Science, Vienna, Austria) (20 mg/ml))
at 54°C and 120 rpm in the waterbath (GFL) for two hours. After protein digestion the plugs were
washed twice with preheated Aqua bidest. (Mayrhofer Pharmazeutik, Leonding, Austria) and three
times with 10x TE buffer for ten minutes at 54°C and 120 rpm, respectively. The plugs were stored in
5 ml of 10x TE Buffer at 4°C.
For equilibration the plugs were sliced and incubated for 15 minutes at RT in a buffer/water mix (90
μl aqua bidest. + 10 μl buffer Tango). For digestion the water/buffer mix was removed, the plugs
were covered with 100 μl enzyme mix (89.5 μl aqua bidest. + 10 μl buffer Tango + 0.5 μl SmaI (MBI
Fermentas, St. Leon-Rot, Germany) (50 U/μl)) and incubated for three hours at 25°C. PFGE patterns
were normalized using the PFGE global standard Salmonella braenderup strain H9812 as a size
marker. For digestion XbaI (MBI Fermentas) (50 U/μl) has been used instead of SmaI and the
incubation occurred at 37°C for 1-3 h.
30
The separation of the DNA fragments in an pulsed field electrophoresis chamber (Bio-Rad, Hercules,
CA, USA) was performed in 1% SeaKem Gold agarose (Lonza Group Ltd.) in 0.5x TBE Buffer for 23
hours and the visualization under UV light after staining with an 0.01% Ethidiumbromid solution.
Genotypes were analyzed according to the criteria of TENOVER et al. (1995).
3.2.11 FOODBORNE PATHOGENS The foodborne pathogen organism L. monocytogenes was enriched according to ISO 11290-1 (1996).
Therefore 25 ml of raw milk were mixed with 225 ml Half-Fraser broth (HFB) (Biokar Diagnostics,
Beauvais Cedex, France) in a Stomacher bag (Seward Ltd., Worthing, UK) and incubated at 30°C for
24 h. This solution has been plated on ALOA agar (Merck KGaA) and PALCAM agar plates (Biokar
Diagnostics, Beauvais Cedex, France) and incubated at 37°C for 24-48 h. Furthermore 100 μl of the
solution have been transferred to Fraser broth (FB) (Merck KGaA, Darmstadt, Germany) for second
enrichment and incubated at 37°C for 48 hours. The latter enrichment was streaked on ALOA agar
(Merck KGaA) and PALCAM agar (Biokar Diagnostics), and incubated at 37°C for 24-48 hours (Figure
5). Furthermore, raw milk samples were diluted 1:10 in buffered Petonewater BPW (Oxoid Ltd.) and
further enumerated for L. monocytogenes on ALOA agar (Merck KGaA) and PALCAM agar (Biokar
Diagnostics) according to ISO 11290-2 (1998; Figure 6).
Figure 5. Work flow for Listeria detection according ISO 11290-1: First and second enrichment and selective plating media.
31
Figure 6. Enumeration of L. monocytogenes according to ISO 11290-2.
The raw milk samples were investigated for the detection of Salmonella spp. according to ISO 6579
(2005). Therefore, 25 ml of raw milk were diluted in 225 ml Buffered Peptone Water (BPW) (Oxoid
Ltd.) in a Stomacher bag (Seward Ltd.) and incubated at 37°C for 24 h. Subsequently, 1,000 μl of the
primary enrichment were inoculated in 10 ml Muller-Kauffmann Tetrathionate-Novobiocin broth
(MKTTn) (Oxoid Ltd.) and incubated at 37°C for 24 h. Additionally, 100 μl of the BPW enrichment
were added to Rappaport-Vassiliadis Soya Peptone (RVS) broth (Oxoid Ltd.) and incubated at 42°C for
24 h. After incubation these secondary enrichments were streaked on Xylose-Lysine-Deoxycholate
(XLD) agar (bioMérieux SA, Marcy l’Etoile, France) and incubated at 37°C for 24-48 h.
3.2.12 PHENOTYPICAL CONFIRMATION FOR SALMONELLA SPP. The confirmation of colonies suspicious for Salmonella spp. was performed applying the Oxidase test
and API (rapid) ID 32 E (bioMérieux SA).
Roughly a pure colony (incubated on TSA-Y (Merck KGaA) for 24 hours at 37°C) was dissolved in 2 ml
physiological sodium chloride (Merck KGaA) to achieve a suspension corresponding to McFarland
standard 0.5. Each well of the strip (32 wells) was filled with 55 μl of bacterial suspension. For API ID
32 E the tests for ODC (Ornithine decarboxylase), ADH (Arginine dihydrolase), LDC (Lysine
decarboxylase), URE (Urease), LARL (L-Arabitol), GAT (Galacturonate) and 5KG (5 Ketoglutarate) were
32
covered by overlaying the vials with two drops of mineral oil, for API rapid ID 32 E (bioMérieux SA)
only URE, LDC and ODC were covered. The whole strip was covered with a lid and incubated for four
(rapid) respectively 24 hours at 37°C. After incubation one drop of JAMES reagent was added to the
IND well. Hereafter, the test was ready to be analyzed.
3.2.13 PCR CONFIRMATION FOR FOODBORNE PATHOGENS Confirmation for all Listeria spp. positive colonies on ALOA and Palcam agar was performed with a
Listeria Multiplex-PCR (BUBERT et al., 1999) targeting the invasion associated gene (iap). The PCR
differentiated L. seeligeri / L. welshimeri / L. ivanovii, L. innocua, L. monocytogenes and L. grayi. The
reaction volume for one PCR tube was 25 μl (23 μl Mastermix and 2 μl Template; Table 8).
Table8. Listeria spp. multiplex- PCR according to BUBERT (1999).
Sequences of oligonucleotide primers PRIMER SEQUENCE (5'-3') Siwi2 TAA CTG AGG TAG CGA GCG AA Ino2 ACTAGCACTCCAGTTGTTAAAC Mono A CAA ACT GCT AAC ACA GCT ACT Murga1 CCA GCA GTT TCT AAA CCT GCT Lis1B TTA TAC GCG ACC GAA GCC AAC
PCR Mastermix COMPONENTS FINAL CONCENTRATION STOCK CONCENTRATION μL/TUBE Aqua dest. 8.45 10x buffer 1x 2.5 MgCl2 1.5 mM 50 mM 0.75 Siwi2 128 nM 1,600 nM 2 Ino2 128 nM 1,600 nM 2 Mono A 128 nM 1,600 nM 2 Murga1 128 nM 1,600 nM 2 Lis1B 128 nM 1,600 nM 2 dNTP`s 200 μM 5,000 μM 1 Taq pol (Plat.) 1.5 U 5 U/μl 0.3 Total 23 Template 2 Volume/Reaction 25
33
PCR conditions (30 cycles*) PCR STEP TEMPERATURE TIME Initialization 94°C 2 min. Denaturation 94°C 30 sec.* Annealing 56°C 30 sec.* Elongation 72°C 30 sec.* Final Elongation 72°C 5 min. 4°C ∞
A Listeria Serovar-Multiplex-PCR (DOUMITH et al., 2004) was performed for L. monocytogenes
isolates. The serovar PCR can distinguish five phylogenetic groups, each correlated with serovars:
I.1 1/2a, 3a
I.2 1/2c, 3c
II.1 4b, 4d, 4e
II.2 1/2b, 3b, 7
III 4a, 4c
by targeting the following genes and open reading frames, respectively:
Imo0737, Imo1118, ORF2819, ORF2110, prs
The reaction volume for 1 PCR tube was 25 μl (20 μl Mastermix and 5 μl Template; Table 9).
Table 9. Listeria spp. Serovar-Multiplex-PCR according to DOUMITH (2004).
Sequences of oligonucleotide primers Primer Sequence (5'-3') Imo0737-F AGGGCTTCAAGGACTTACCC Imo0737-R ACGATTTCTGCTTGCCATTC ORF2819-F AGCAAAATGCCAAAACTCGT ORF2819-R CATCACTAAAGCCTCCCATTG ORF2110-F AGTGGACAATTGATTGGTGAA ORF2110-R CATCCATCCCTTACTTTGGAC Imo1118-F AGGGGTCTTAAATCCTGGAA Imo1118-R CGGCTTGTTCGGCATACTTA prs-F GCTGAAGAGATTGCGAAAGAAG prs-R CAAAGAAACCTTGGATTTGCGG
34
Mastermix
COMPONENTS FINAL CONCENTRATION STOCK CONCENTRATION μL/TUBE Aqua dest. 12 10x buffer 1x 2.5 MgCl2 2 mM 50 mM 1 Imo0737-F 1 μm 100 μm 0.25 Imo0737-R 1 μm 100 μm 0.25 ORF2819-F 1 μm 100 μm 0.25 ORF2819-R 1 μm 100 μm 0.25 ORF2110-F 1 μm 100 μm 0.25 ORF2110-R 1 μm 100 μm 0.25 Imo1118-F 1.5 μm 100 μm 0.375 Imo1118-R 1.5 μm 100 μm 0.375 prs-F 0.2 μm 10 μm 0.5 prs-R 0.2 μm 10 μm 0.5 dNTP`s 0.2 μm 5 μm 1 Taq pol (Plat.) 2 U 5 U/μl 0.3 Total 20 Template 5 Volume/Reaction 25
PCR conditions (35 cycles*) PCR STEP TEMPERATURE TIME Initialization 94°C 3 min. Denaturation 94°C 40 sec.* Annealing 53°C 1.15 min.* Elongation 72°C 1.15 min.* Final Elongation 72°C 7 min. 4°C ∞
3.2.14 MOLECULAR EPIDEMIOLOGICAL COMPARISON OF L. MONOCYTOGENES The genotyping of Listeria spp. was performed according to the One-Day Standardized Laboratory
Protocol for Molecular subtyping of L. monocytogenes by pulsed-field gel electrophoresis (PFGE)
(Center of Disease Control (CDC), 2013; http://www.cdc.gov/pulsenet/PDF/listeria-pfge-protocol-
508c.pd; accessed on: 23.09.2013).
Isolated colonies from test cultures were streaked onto TSA-Y agar plates (Merck KGaA) and
incubated at 37°C for 18 hours. Some colonies grown on the agar were transferred with a cotton
swab into TE-Buffer solution. The concentration of the suspension was adjusted to 1.0 at 610 nm
wavelength with a Spectrophotometer. 400 μl of the adjusted cell suspension were mixed with 10 μl
Lysozyme (Sigma Aldrich) (40 mg/ml) and the tubes placed into a 56°C water bath (GFL) for 20
minutes. 20 μl of Proteinase K (Roche Diagnostics GmbH) (20 mg/ml) were added to the cell
suspension. 400 μl melted 1% SeaKem Gold agarose (Lonza Group Ltd.) (1% SeaKem Gold agarose +
35
1% Sodium Dodeycl Sulfate (SDS) in TE Buffer) were added, gently mixed with the cell suspension and
dispensed into wells of plug mold. After solidification, the plugs were put into 5 ml of Lysis Buffer (+
25 μl Proteinase K (Roche Diagnostics GmbH) (20 mg/ml)) and incubated at 54°C in a shaker water
bath (GFL) overnight at 120 rpm. The plugs were washed twice with 15 ml of preheated aqua bidest
(Mayrhofer Pharmazeutik) and three times with 15 ml of preheated TE Buffer for 15 minutes at 54°C,
respectively. The plugs were stored in 5 ml TE Buffer at 4°C.
For equilibration the plugs were sliced and incubated for 15 minutes at room temperature (RT) in a
buffer/water mix (90 μl aqua bidest. (Mayrhofer Pharmazeutik) + 10 μl buffer Tango (MBI
Fermentas). The digestion was performed with AscI (MBI Fermentas) (50 U/plug) for 3 hours at 37°C
and with ApaI (MBI Fermentas) (50 U/plug) for four hours at 25°C. For digestion the water/buffer mix
was removed, the plugs were covered with 100 μl enzyme mix ((87.5 μl Aqua bidest. (Mayrhofer
Pharmazeutik) + 10 μl buffer Tango + 2.5 μl AscI/ApaI (MBI Fermentas)) and incubated. Salmonella
braenderup strain H9812 was used as a size marker. For the digestion 50 U XbaI (MBI Fermentas) was
applied per marker plug and the incubation occurred at 37°C for 1-3h. The separation of the DNA
fragments in an electrophoresis chamber was performed in 1% SeaKem Gold agarose (Lonza Group
Ltd.) in 0.5x TBE Buffer (Sigma Aldrich) for 23 hours and the visualization under UV light after an
Ethidiumbromid staining (0.01% solution). Genotypes were analyzed according to the criteria of
TENOVER et al. (1995).
36
Table 10. Typical colony morphology for the identification of target organisms on selective agar media. TARGET ORGANISMS SELECTIVE
AGAR INDICATORSYSTEM COLONY MORPHOLOGY
Hygiene indicators
AMC PC no indicator aerobic microorganism; heterogeneous growth Coliforms VRB fermentation of lactose red-purple colonies Pseudomonas spp. GSP red-violet colonies, surrounded by a violet zone
Aeromonas spp. degradation of starch; acid production yellow colonies, surrounded by a yellow zone
Moulds RBC Rose-bengal white mycelia, green, black pigmented Yeasts pink colonies
Enterococci KÄ hydrolysis of esculin ; kanamycin sulphate and sodium azide
black colonies with a black zones
Pathogens pathogenic Listeria spp.
ALOA hydrolysis of X-glucoside, phosphotidylinositol
opaque blue-green regular round colonies with halo
Listeria spp. PALCAM hydrolysis of esculin grey-green colored colonies with a black zones.
Salmonella spp. XLD decarboxylation of xylose red colonies with black centers
Salmonella spp. SM2 esterase activity pale pink to mauve colonies
B. cereus MYP lack of mannitol fermentation; hydrolysis of lecithin
bright pink colonies; zone of egg yolk precipitation
S. aureus BP tellurite reduction; hydrolysis of lecithin grey-black shiny colonies; surrounded by zone of clearing 2-5mm
37
4 RESULTS
4.1 FARM CHARACTERISTICS In winter 18 small scale dairy farms and in summer 2011, 17 small scale dairy farms were visited to
analyze the cooling dynamics of bulk tank milk and the influence of the cooling dynamic on hygiene
indicator bacteria and pathogens.
Therefore, bulk tank milk samples (in total n=70) were taken at the beginning of the cooling process
and additionally before the milk collection by the district dairy, which was generally two days later.
The dairy farms comprised following livestock breeds: Fleckvieh, Holstein-Friesian, and one farm had
a mix of Fleckvieh, Holstein-Friesian and Pinzgauer cattle (Figure 7).
Figure 7. Distribution of cattle breeds on the 18 farms.
The farms had an average of 18 lactating cows in winter and an average of 19 lactating cows in
summer 2011. The herd size ranged from 4 to 32 lactating dairy cows during winter, and 6 to 36 milk
producing cows in summer (herd size 4 versus 32 lactating dairy cows) (Figure 8).
16
1 1
Fleckvieh cattle
Holstein-Friesian cattle
Mixed cattle population
38
Figure 8. Number of farms with a specific quantity of lactating cows: comparison of winter 2010 and
summer 2011.
A milking parlour served at eleven dairy farms for milk production. Four farms were using a piped
milking machine, and three farms bucket milker units for milking (Figure 9).
3
8
5
2
winter
1-10
11-20
21-30
31-40
number of lactating cows
1
9
5
2
summer 2011
1-10
11-20
21-30
31-40
number of lactating cows
39
Figure 9. Distribution of the different milking systems.
Eight farms had a cooling tank for cooling and keeping the raw milk at low temperatures, three farms
had a mobile cooling tank and seven farms had a cooling trough (Figure 10).
Figure 10. Distribution of the different cooling systems.
11 4
3
Milking parlour
Piped milking machine
Bucket milker unit
8
7
3
Cooling tank
Cooling trough
Mobile Cooing tank
40
4.2 MILK COOLING DYNAMICS All farms had to store the tank milk at a maximum temperature of 6°C before milk collection,
because the milk was not collected on a daily base.
In winter the milk temperature on one farm was 6°C or higher during milk collection (9.7°C). In
summer 2011, five farms were affected (≥ 6.0°C, 6.1°C, 6.4°C, 7.7°C, 9.7°C). The farm which exceeded
the prescribed temperature in winter also had a temperature ≥ 6.0°C during the summer
measurements. A difference between the milk temperature was also indicated on the tank display
and the temperature measured by the data logger. In winter, for 36% of all measurements the
temperature displayed on the tank was lower in comparison to the data logger measurements. In
summer 76% of the temperatures shown on the tank display were lower.
The cooling rates, measured from the beginning of the tank filling until the end of stirring, were
slower in summer; only four farms (24%) achieved a faster cooling down of the raw milk in the bulk
tank in summer (Appendix, Table II and Table III).
4.3 HYGIENE INDICATORS AND INTRINSIC FLORA Overall 70 raw milk samples were tested for AMC, CC, yeasts and moulds, enterococci,
pseudomonads and lactic acid bacteria. In 41% (n=29) of all tested raw milk samples the AMC
exceeded 50,000 cfu/ml. Seventeen samples (47%) in winter and 12 samples (35%) in summer
exceeded the prescribed plate counts for S-classification.
Twenty raw milk samples had coliform counts of ≥ 1,000 cfu/ml, 15 samples in winter and five
samples in summer. Pseudomonas counts were higher in winter (n=22≥104 cfu/ml) compared to
summer (n=5≥104 cfu/ml). No seasonal effect was recorded when enumerating the Enterococci (5
samples =≥103 cfu/ml in winter) and Lactobacilli. CPS counts were higher in summer 2011.
Five (winter) and four bulk tanks (summer) showed slow cooling rates and AMC > 50,000 cfu/ml
(detailed results are shown in Figure 11; Appendix, Table I, III).
41
Figure 11.AMC, Pseudomonas, and Coliforms (cfu/ml) in bulk tank milk samples: comparison between winter (Fig. A) and summer (Fig. B).
0% 10% 20% 30% 40% 50% 60% 70% 80% 90%
100%
AMC Coliforms Pseudomonas
< 50,000 < 1,000< 10,000
≥ 50,000 ≥ 1,000 ≥ 10,000
0% 10%20%30%40%50%60%70%80%90%
100%
AMC Coliforms Pseudomonas
< 50,000
< 1,000 < 10,000
≥ 50,000
≥ 1,000 ≥ 10,000
Fig. A Fig. B
42
4.4 DETECTION OF THE POTENTIAL PATHOGENS B. CEREUS AND S. AUREUS All raw milk samples were tested negatively for Bacillus cereus. Three samples from summer 2011
showed suspicious colonies on MYP agar. The latter isolates were found to be negative for B. cereus
after differentiation (gram staining, Oxidase and Catalase test), biochemical profile (API 50 CH/B) and
PCR method.
A total of 17 raw milk samples (24%) were tested positive for S. aureus, thereof eight samples in
winter, and nine samples in summer. Two samples from winter achieved S. aureus counts ranging
between 330 and 590 cfu/ml, the other samples contained S. aureus <10 cfu/ml. All positive samples
from summer comprised S. aureus counts below the limit of detection (<10 cfu/ml).
In total, eight farms were tested positive for S. aureus. Thereof, five farms in winter and seven in
summer. For S. aureus suspicious colonies (n=101), the exact colony morphology was recorded. The
isolates were subcultured on Baired Parker agar and further confirmed by clumping factor, tube
coagulase reaction, API Staph and PCR method targeting the nuc gene. A high variability of typical
and atypical colonies was confirmed as S. aureus (n=78): big black colonies with a broad Lecithinase
corona; grey colonies with a small Lecithinase corona, olive colonies, black colonies, fawn-black
colonies. Twenty-three isolates were found to be S. caprae (n=5), S. hyicus (4), S. haemolyticus (n=3),
S. xylosus (n=2), S. chromogenes (n=1), S. warneri (n=1) and Enterococci (n=7).
In the S. aureus PFGE typing applying the restriction enzyme SmaI nine genotypes could be detected.
Some genotypes were only present on one specific farm during winter and/or summer (PFGE type 1,
2, 4, 5, 8, 9). PFGE type 3 and 7 was shared by different farms in both seasons. Interestingly, not all
colonies with the same genotype had the same colony morphology on Baird Parker agar (Table 11;
Figure 12).
43
Table11. Phenotypical and genotypical characteristics of 31 S. aureus isolates. PFGE GENOTYPE
SEASON FARM SAMPLE NO.
LECITHINASE REACTION
CF COA COLONY MORPHOLOGY
1 winter 12 22 pos + + grey 24 pos + + big black
2
winter
16
30 pos + + big black 30 pos - + big black 34 neg + + fawn-black 34 pos + + big black 34 pos - + big black 34 pos + + big black
summer 19 pos + + big black 24 pos + + big black 24 pos + + big black
3
summer 6
1 neg + + black 6 neg + + black
11 13 pos + + black winter
16 30 neg + + olive 34 neg + + black 34 neg + + olive
4 winter
12 22 pos + + big black
summer 12 pos - + big black 12 pos + + big black
5 winter 6
14 neg - + black
6 11 neg + + olive 11 neg + + black
7 winter
4 4 neg + + black 4 neg - + black
winter 13
25 neg + + black summer 32 neg - + black
8 summer 18 23 neg - - grey
9 summer 10 29 pos + + big black 29 pos + + big black 29 pos + + big black
CF, Clumping factor, Coa, Tube coagulase test.
44
Figure 12. S. aureus PFGE typing applying the restriction enzyme SmaI.
Lane 1,16,29: Salmonella braenderup; lane 13,15: genotype 1; lane 3,4,5,6,7,9,11,12: genotype 2; lane 2,8,24,25: genotype 3; lane 14,17,18: genotype 4; lane 23: genotype 5; lane 22: genotype 6; lane 19,21,26,28: genotype 7.
Lane 1,15,28: Salmonella braenderup; lane 3: genotype 2; lane 2,14: genotype 3; lane 19: genotype 6; lane 5: genotype 8; lane 23,24,25: genotype 9.
45
4.5 DETECTION OF THE FOODBORNE PATHOGENS SALMONELLA SPP. AND L. MONOCYTOGENES In 18 raw milk samples Salmonella spp. typical colonies on XLD agar were detected, but none of
these colonies were confirmed as Salmonella spp. Following species resulted in the latter false
positive colony morphology: Citrobacter freundii group, Citrobacter brakii, Proteus spp. and Klebsiella
pneumonia spp. (confirmed by API ID 32E).
Seven raw milk samples were detected positive for L. monocytogens acc. to ISO 11290-1, three
samples in winter and four samples in summer. The L. monocytogens positive samples originated
from six farms.
Three different serovar groups were identified with serovar-multiplex PCR: Group I.1 (1/2a, 3a) was
found on two different farms, group II.1 (4b, 4d, 4e) on one farm and group II.2 (1/2b, 3b, 7) on four
different farms (Figure 13, Table 12).
Figure 13. L. monocytogenes serovar-multiplex PCR.
Lane 1,19: 1kb ladder; lane 2: negative control; lane 3: template-free control; lane 4: positive control (group I.2); lane
5,6,8,9,10,12,13,14: group II.2(1/2b, 3b, 7); lane 7,11,16,17: group I.1(1/2a, 3a); lane 15: group II.1(4b, 4d, 4e)
Table 12. . Genotypical characteristics of 32 L. monocytogenes isolates.
FARM SAMPLE NO. SEASON PFGE TYPE ASCI
PFGE TYPE APAI
SEROVAR PCR ISOLATES (n)
6 14 winter 3 3 1/2a, 3a 7 6 14 winter 4 5 1/2b, 3b, 7 4 8 16 winter 2 2 1/2b, 3b, 7 4 8 16 winter 1 1 4b, 4d, 4e 1 9 4 summer 4 5 1/2b, 3b, 7 1 9 7 summer 4 5 1/2b, 3b, 7 2 10 33 summer 5 6 1/2b, 3b, 7 4 12 24 winter 1 1 4b, 4d, 4e 5 16 24 summer 3 ST 4 1/2a, 3a 4
46
The subtyping of 32 L. monocytogenes isolates resulted in five AscI and six ApaI profiles. Farm 6 and 8
harboured two L. monocytogenes genotypes from different serovar groups in their bulk tank milk
samples. Farm 8 and farm 12 shared the same PFGE type 1 during the winter sampling of bulk tank
milk (Table 12, Figure 14).
Figure 14. L. monocytogenes PFGE typing applying the restriction enzyme ApaI.
Lane 1,8,15: Salmonella braenderup; lane 2: genotype 1; lane 3,4,5: genotype 2; lane 6,7,9: genotype 3; lane 10: genotype
4; lane 11,12,13: genotype 5; lane 14: genotype 6
5 DISCUSSION AND CONCLUSION
Raw milk has been recognized as a vehicle of zoonotic agents worldwide, irrespectively the level of
development in the national surveillance system (ANGULO et al., 2009; BIANCHI et al., 2013; OLIVER
et al., 2009; MOSALAGAE et al., 2011; PETRUZZELLI et al., 2013). In industrialized countries,
outbreaks related to milk and milk products represent 2–6% of the bacterial foodborne outbreaks
(CLAEYS et al., 2012).
Besides to food safety, milk of high quality (S-class) with low bacterial and somatic cells result in high
quality milk and milk products with increased shelf-life (D’AMICO and DONNELLY, 2010; GARGOURI
et al., 2013).
47
The aim of this study was to determine the influence of cooling conditions on the microbiological
quality of raw bulk tank milk (BTM) collected on 18 Styrian milk supplying farms with respect to
seasonal effects. Furthermore, the occurrence of pathogenic microorganisms (L. monocytogenes,
Salmonella spp.) and potential pathogens (S. aureus, B. cereus) in bulk tank milk was determined and
compared with molecular subtyping techniques.
The BTM samples investigated in this study were collected by the district dairy every second day and
therefore the BTM had to be stored ≤ 6°C prior to collection. An evident seasonal effect was
recognized concerning temperature: five farms stored their milk above 6°C in summer, whereas only
one farm had a problem with the bulk tank milk cooling system in winter. The latter dairy farm
exceeded in both seasons the prescribed 6°C. Data logger measurements revealed that the
temperature display indicated higher temperatures in winter and lower temperatures in summer. No
influence of milk amount, milking and cooling system was recognized. The cooling rates, measured
from the beginning of the tank filling until the end of stirring, were slower in summer. PANTOJA et al.
(2009) investigated the BTM quality in a cohort study of dairies and saw that the coliform counts
were increasing by 1% for every 0.1°C increase in the BTM temperature. The authors found a very
low percentage of temperature measurements (0.06%) that were >7.2°C (Pasteurized Milk Ordinance
legal limit). Similar to our findings the seasonal influence of summer months on increasing the milk
temperatures in milk tanks was evident in the study of PANTOJA et al. (2009). Interestingly the higher
temperature in bulk tanks investigated in our study were not resulting in higher AMC. This could be
explained by a high amount of psychrotrophic organisms in the BTM samples.
Generally, bulk tank milk hygiene, quality and pathogen status data are not easily to compare e. g.
due to their bias in dairy farm components, the breeding, climatic influence, herd size and the
analytical detection methods.
In our study 41% (n=29) of all tested raw milk samples had AMC > 50,000 cfu/ml. BTM samples taken
in winter (47%) had higher AMC than samples in summer (35%). Furthermore, psychrothrophic
organisms, as coliforms (CC ≥ 1,000 cfu/ml) and Pseudomonas (104 cfu/ml), were increasingly
detected in winter bulk tank milk samples (41%). CPS counts were higher during summer. STULOVA
et al. (2010) found a higher microbiological quality of BTM samples in Estonia when AMC counts
were considered. More than 91% of samples had bacterial counts < 50,000 cfu/ml. Results
concerning lactic acid bacteria, which remained < 104 cfu/ml, and psychrothrophic microorganisms
which were dominating the bulk tank milk flora, were similar to the results of our study.
GIACOMETTI et al. (2012) investigated raw milk samples in Northern Italy distributed from vending
machines and also found an increased rate for AMC (> 50,000 cfu/ml; 45% of the investigated
samples). A total of 5% of the samples were tested positively for at least one pathogen.
48
In contrast to our findings, GILLESPIE et al. (2012) noticed an increase of AMC and CC in BTM samples
in summer and no seasonal influence on Staphylococcus spp. counts.
OLIVEIRA et al. (2011a) investigated small and medium scale dairy farms in Brazil determined
possible risk factors for raw milk quality. The authors stated that nearly half of the producers would
have problems with achieving the threshold limits for bacterial counts if no major improvement of
milk and udder hygiene would be undertaken. A high quantity of dairy farms (66%) harboured S.
aureus > 3 log cfu/ml indicating a major animal and milk production hygiene problem. Similar
findings for raw cow’s milk bacteriological quality were found by COSTA SOBRINHO et al. (2012). A
high incidence of S. aureus in Brazilian dairy herds was evident. The authors stated that SCC and AMC
were no good indicators for the presence of pathogenic organisms. The number of S. aureus positive
samples (total 24%) in this study was slightly higher in the summer sampling event, but all counts
were <10 cfu/ml. Interestingly, some S. aureus genotypes were only present on one specific farm
during winter and/or summer (PFGE type 1, 2, 4, 5, 8, 9). PFGE type 3 and 7 were shared by up to
three different farms in both seasons. These findings could be explained by the fact, that some dairy
herds and farms harbour distinct well established S. aureus genotypes, which are in higher quantities
a risk for human health due to their special strain features (enterotoxins, antibiotic resistance;
OLIVEIRA et al.,2011 b). LEE et al. (2012) also found a wide distribution of certain S. aureus
genotypes in the primary milk production in Brazil. The incidence was lower in quarter milk samples
but higher in BTM (21.7%) indicating a risk for the Brazilian population where raw milk consumption
is not unusual. OLDE RIEKERINK et al. (2010) studied certain management practices in relation to S.
aureus isolation from Canadian BTM samples. The highest prevalence was found in Nova Scotia
(91%). A major influence on the high S. aureus rates in BTM had the use of rubber mats in the free-
stall barns and the check of the milking equipment by an independent technician.
Recently, researchers reported that certain genotypes (GTB) and methicillin-resistant S. aureus
(MRSA) are prevalent in the dairy herds. The livestock associated S. aureus clonal complex (CC) 398 is
arising in the cattle and pig herds (GRABER und BOSS, 2012; HARAN et al., 2012; KREAUSUKON et al.,
2012; SPOHR et al., 2011) . SYRING et al. (2012) saw that S. aureus GTB was occurring in 87% of Swiss
dairy cows. Therefore, a rapid screening real-time PCR was developed to detect the GTB which
causes a large economic loss in the Swiss dairy industry.
L. monocytogenes was present in the Styrian BTM samples (10% of samples) but detected to a low
amount in both sampling events. The low L. monocytogenes prevalence is in accordance with other
research based on BTM samples (D’AMICO and DONNELLY, 2010; VAN KESSEL et al., 2011).
ANTOGNOLI et al. (2009) screened a large number of US dairy farms for the presence of L.
monocytogenes and highlighted following factors which are contributing to a higher risk: larger herd
49
sizes and the storing of the manure where cattle have access. A certain geographical influence on L.
monocytogenes distribution was found. VILAR et al. (2007) determined the Listeria spp. prevalence in
Spanish bulk tank milk samples. A major impact on the presence of Listeria spp. had a silage of low
quality (high pH), tie-stall systems and neglecting the milking order.
More than one L. monocytogenes genotype was present in the raw milk of two dairy farms
investigated in our survey. Interestingly, two farms shared the same PFGE type 1 during the winter
sampling of BTM. A major risk for L. monocytogenes contaminations on the dairy farm is therefore
mainly caused by an environmental contamination, the possibility of survival in niches, and
transmission to other farms via dairy equipment. LATORRE et al. (2010) found a higher prevalence of
persistent PFGE types caused by biofilm formation on surface scratches of the dairy equipment.
Besides, biofilms on abiotic surfaces are one of the main sources of contaminated raw milk.
Pathogenic bacteria are often well established on soiled surfaces in coexistence with Pseudomonas
due to the exo-enzyme production that is elevated at low temperatures. Those biofilms once
established are hardly to remove, because cleaning protocols are often not sufficiently applied or the
cleaning efficiency is limited in the complex system of milking pipelines and dairy equipment
(MARCHAND et al., 2012). The cold storage of raw milk during processing favours the multiplication
of psychrotrophic organisms as Pseudomonas. The latter organisms are often producing extracellular
proteases and lipases causing spoilage and structural defects in further untreated or thermally
treated milk products (DE JONGHE et al., 2011; RAATS et al., 2011). Further detailed knowledge is
needed on the composition and activity of initially prevalent raw milk bacteria. Not all milk
contaminating gram-negative biotypes are proteolytic and cause therefore extensive spoilage. Other
gram-positive groups as Bacilli and Actinobacteria often have high degrading enzymatic activities and
are not well characterized. Furthermore, studies focused on the microbiological communities in raw
milk are often not comparable due to a variety in the milk flora in each individual sample and the
methodological bias. There is a high need of reliable techniques for the identification of
microorganisms in raw milk to prevent spoilage or transmission of zoonotic agents (ERCOLINI et al.
2009; RAATS et al., 2011). FRICKER et al. (2011) highlighted the Fourier-transform infrared
spectroscopy (FTIR), as rapid culture-based metabolic fingerprinting technique for the analysis of
microbial communities in raw milk. The authors stated that the major differences were evident
between the bulk tank milk on farm and the further processed milk in the dairy. A shift was
recognized from the gram-positive flora in the bulk tank to a gram-negative dominated population in
the dairy milk samples. The geographical differences were not significant. HANTSIS-ZACHAROV et al.
(2007) saw a seasonal change in the microbial composition of raw milk: Gammaproteobacteria were
50
dominating in spring and winter. These findings are in correlation with the high CC and
psychrotrophic counts during winter determined in this study.
A reason for the high psychrotrophic counts is an increased amount of water residues and biofilms in
the milking equipment of a single dairy farm or a regional higher contaminated water applied as
wash water (PERKINS et al., 2009).
A further important factor is the common hygiene knowledge status of dairy farmers. YOUNG et al.
(2010) investigated in an interesting survey the knowledge gaps among Canadian dairy producers.
The farmers attended dairy-health management courses were aware of general risks outgoing from
unknown hygiene status of raw milk. Most dairy farmers knew Salmonella and E. coli as high risk
pathogens but were not aware of e. g. Brucella.
Furthermore, major cleaning and sanitation errors are often occurring as washing water
temperatures <45°C (BAVA et al., 2011). Additionally, cleaning frequencies are often insufficient and
not corresponding with the milking frequency of the dairy herd. The increasing soil and bacterial load
is often underestimated or dirty cleaning sponges are applied harbouring a heavy load of bacterial
recontaminants (REINEMANN et al., 2003). The easy application of ATP bioluminescence methods for
the visualization of biofilms established on dairy equipment should be more applied in training
events for dairy producers (VILAR et al., 2008). However, this rapid test is only applicable for
screening purposes. ATP bioluminescence is only able to reveal microbial hot spots on surfaces. A
major impact on the maintenance of low bacterial loads in the bulk tank milk has a well working tank
cooling system. We fully agree with VILAR et al. (2012) that food safety has to be guaranteed at every
stage of food production. The European legislation has implicated the use of Hazard Analysis and
Critical Control Point (HACCP) concepts, but the introduction of a full control program for further
quality risk management is at the moment only recommended but not mandatory on dairy farms.
51
6 EXTENDED SUMMARY
The objective of this study was to determine whether measurable variations existed between small
scale farms with different bulk tank milk cooling systems. A further aim was to determine the
influence of cooling dynamics on the bacterial status of hygiene indicator bacteria and pathogen
bacteria as Listeria monocytogenes, Salmonella spp. and potential enterotoxin producers as
Staphylococcus aureus and Bacillus cereus. For this purpose the cooling dynamics in the bulk tank of
eighteen dairy farms in the southeast of Austria were recorded in winter 2010 and summer 2011 by
data logging. Dairy farms were visited and sampled at the beginning of the cooling process and
additionally before milk collection by the district dairy. The mesophilic aerobic counts (AMC) of the
bulk tank milk samples were determined on Plate Count agar (PCA) (Oxoid, Basingstoke, UK)
according to ISO 4833 (2003). Additionally, further microbiological hygiene parameters were
investigated: Yeasts and Moulds on Rose-Bengal Chloramphenicol agar (RBCA) (Merck KgA,
Darmstadt, Germany) and Coliforms according to ISO 4832 (2006) on Violet Red Bile Lactose agar
(VRBL) (Oxoid, Basingstoke, UK). The lecithinase positive Staphylococci were enumerated on Baird
Parker agar (BP) (Merck Darmstadt, Germany) according to ISO 6888 (1999) and confirmed by
clumping factor and tube coagulase reaction. Presumptive colonies were confirmed by PCR targeting
the nuc gen. Bacillus cereus was quantified on Mannitol Egg Yolk Polymyxin (MYP) agar. The
foodborne pathogen bacteria Listeria monocytogenes and Salmonella spp. were enriched according
to ISO 11290 (1996; Amd. 2004) and ISO 6759 (2002). Confirmation was performed phenotypically
(biochemical tests, latex agglutination) and genotypically by PCR method (Bubert et al., 1999, Rahn et
al., 1992). In winter the milk temperature on one farm was 6°C or higher during milk collection
(9.7°C). In summer 2011, five farms were affected (≥ 6.0°C, 6.1°C, 6.4°C, 7.7°C, 9.7°C). The farm which
exceeded the prescribed temperature in winter also had a temperature ≥ 6.0°C during the summer
measurements. In 41% (n=29) of all tested raw milk samples the AMC exceeded 50,000 cfu/ml.
Seventeen samples (47%) in winter and 12 samples (35%) in summer exceeded the prescribed plate
counts for S-classification.
Coliforms were counted in the bulk tank milk of 19 farms >1,000 cfu/ml. Seven raw milk samples
were positive for L. monocytogenes and 17 samples for S. aureus. Interestingly, no significant
relationship between cooling tanks exceeding 6°C and higher microbial counts was found. A major
outcome of this study is that real temperature inside of cooling tanks used in small scale dairy farms
is often higher than the external temperature controls indicate even before milk collection. The
higher bacterial contamination of the bulk tank milk samples could be explained by water residues
after the cleaning process of the milking equipment and biofilm formation of psychrotolerant and
psychrotrophic flora (Listeria, coliforms, Pseudomonas).
52
7 ZUSAMMENFASSUNG
Das Ziel dieser Arbeit war es, messbare Schwankungen in der Abkühldynamik von Rohmilch in
verschiedenen Kühlsystemen von bäuerlichen Betrieben zu determinieren. Zusätzlich sollte die
Kühltemperatur in Relation zum mikrobiologischen Hygienestatus gebracht werden. Dazu wurden
Mikroorganismen die als Hygieneindikator gelten (mesophile Gesamtkeimzahl, Coliforme,
Pseudomonaden, Hefe, Schimmel), pathogene Miroorganismen (Listeria monocytogenes, Salmonella
spp.) und potentielle Enterotoxinbildner wie Staphylococcus aureus and Bacillus cereus
herangezogen. Dazu wurden in 18 steirischen Betrieben die Abkühlraten im Winter und Sommer
2011 mittels Datalogger-Messungen bestimmt. Die Aufzeichnungen erfolgten am Beginn des
Abkühlprozesses und kurz vor der Abholung der Tankmilch durch die Gebietsmolkerei.
Die mesophile Gesamtkeimzahl (GKZ/ml) der Tankmilchproben wurde auf dem Plate Count Agar
(PCA) (Oxoid, Basingstoke, UK) gemäß der ISO Verordnung 4833 (2003) pro ml bestimmt. Hefen und
Schimmel wurden auf dem Bengalrosa Chloramphenicol Agar (Merck KgA, Darmstadt, Germany) und
Coliforme auf dem Violettrot-Galle Laktose Agar (VRBL; ISO 4832 (2006)) quantifiziert. Lecithinase-
positive Staphylokokken wurden auf Baird Parker Agar (BP) (Merck KgA) gemäß der ISO 6888 (1999)
ausgezählt und typische und atypische Kolonien weiter mit Clumpingfaktor, Koagulasetest und
mittels PCR (Targetgen: nuc) bestätigt. Die Enumeration von Bacillus cereus erfolgte auf Mannitol Egg
Yolk Polymyxin (MYP) agar (Merck KgA) enumeriert. Die pathogenen Mikroorganismen Listeria
monocytogenes and Salmonella spp. wurden in Anreicherungsverfahren gemäß ISO 11290 (1996) and
ISO 6759 (2002) detektiert. Die Bestätigung der Kolonien erfolgte einerseits phänotypisch
(biochemische Tests, Latex Agglutination) und mittels PCR Nachweis (Bubert et al., 1999, Rahn et al.,
1992).Während der Dattalogger Messungen im Winter, war die Kühlung der Rohmilch bei Abholung
von einem milchverarbeitenden Betrieb abweichend von der vorgeschriebenen Kühltemperatur. Im
Sommer 2011 waren fünf Tankmilchkühltemperaturen bei 6°C oder höher (≥ 6.0°C, 6.1°C, 6.4°C,
7.7°C, 9.7°C). Eine Kühlwanne konnte weder im Winter, noch im Sommer effizient kühlen (9.7°C).
In 41% (n=29) der Fälle waren die getesteten GKZ über 50,000 cfu/ml. Ein größerer Anteil der
Tankmilchproben (47%) war während der Wintermonate erhöht, während 12 Proben im Sommer
keiner S- Klasse entsprachen. Ein hoher Anteil der im Winter gesamelten Tankmilchproben (n=19)
hatte eine Coliformen Belastung >1,000 cfu/ml. Sieben Rohmilchproben waren L. monocytogenes
positiv und 17 Proben enthielten S. aureus, meist <10 kolonienbildende Einheiten KBE/ml.
Es konnte kein Zusammenhang zwischen erhöhten Kühltemperaturen (>6°C) und erhöhter
Keimbelastung festgestellt werden. Eine wichtige Information dieser Arbeit ist, dass die externen
Temperaturanzeigen am Milchtank deutlich von der Temperatur im Inneren auch kurz vor der
Abholung abweichen können. Die höhere Keimbelastung könnte durch erhöhtes Restwasser nach
53
Reinigung der Melkanlage und Biofilmbildung durch die deutlich erhöhte psychrotolerante und
psychrotrophe Flora (Listerien, Coliforme, Pseudomonaden) erklärbar sein.
54
8 REFERENCES
ANGULO, F.J., LEJEUNE, J.T., RAJALA-SCHULTZ, P.J. (2009): Unpasteurized milk: a continued public health threat. Clinical Infectious Diseases 48, 93-100.
ANONYMOUS (2006): Order of the Federal Minister for Health and Women's Affairs on raw milk. BGBl. II Nr. 106/2006. p.1-2. www.ris.bka.gv.at; accessed on: 23.09.2013.
ANONYMOUS (2007): Order of the Federal Minister for Agriculture and Forestry, the Environment and Water Management on the milk quota regulation. BGBl. II Nr. 209/2007. 1-19. p.15. www.ris.bka.gv.at; accessed on: 23.09.2013.
ANTOGNOLI, M.C., LOMBARD, J.E., WAGNER, B.A., MCCLUSKEY, B.J., VAN KESSEL, J.S., KARNS, J.S. (2009): Risk factors associated with the presence of viable Listeria monocytogenes in bulk tank milk from US dairies. Zoonoses and public health 56, 77-83.
BAVA, L., ZUCALI, M., SANDRUCCI, A., BRASCA, M., VANONI, L., ZANINI, L., TAMBURINI, A. (2011): Effect of cleaning procedure and hygienic condition of milking equipment on bacterial count of bulk tank milk. Journal of Dairy Research 78, 211-219.
BIANCHI, D.M., BARBARO, A., GALLINA, S., VITALE, N., CHIAVACCI, L., CARAMELLI, M., DECASTELLI, L. (2013): Monitoring of foodborne pathogenic bacteria in vending machine raw milk in Piedmont, Italy. Food Control 32, 435-439.
BRAEM, G., DE VLIEGHER, S., VERBIST, B., HEYNDRICKX, M., LEROY, F., DE VUYST, L. (2012): Culture-independent exploration of the teat apex microbiota of dairy cows reveals a wide bacterial species diversity. Veterinary microbiology 157, 383-390.
BRAKSTAD, O.G., AASBAKK, K., MAELAND, J.A. (1992): Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of clinical microbiology 30, 1654-1660.
BRAMLEY, A.J. AND C.H. MCKINNON (1990): The microbiology of raw milk. pp. 163-208. In Dairy Microbiology, Vol. 1. Robinson, R.K. (ed.) Elsevier Science Publishers, London. BRAMLEY, A. J., J. S. CULLOR, R. J. ERSKINE, R. J. HARMON, J. S. HOGAN, S. C. NICKERSON, S. P. OLIVER, K. L. SMITH, AND L. M. SORDILLO. (1996): Current Concepts of Bovine Mastitis. 4th ed. National Mastitis Council, Madison, WI.
BREEN, J.E., BRADLEY, A.J., GREEN, M.J. (2009): Quarter and cow risk factors associated with a somatic cell count greater than 199,000 cells per milliliter in United Kingdom dairy cows. Journal of dairy science 92, 3106-3115.
BROOKS, J., MARTINEZ, B., STRATTON, J., BIANCHINI, A., KROKSTROM, R., HUTKINS, R. (2012): Survey of raw milk cheeses for microbiological quality and prevalence of foodborne pathogens. Food Microbiology 31, 154-158.
BUBERT, A., HEIN, I., RAUCH, M., LEHNER, A., YOON, B., GOEBEL, W., WAGNER, M. (1999): Detection and differentiation of Listeria spp. by a single reaction based on multiplex PCR. Applied and Environmental Microbiology 65, 4688-4692.
55
CLAEYS, W.L., CARDOEN, S., DAUBE, G., DE BLOCK, J., DEWETTINCK, K., DIERICK, K., DE ZUTTER, L., HUYGHEBAERT, A., IMBERECHTS, H., THIANGE, P. (2012): Raw or heated cow milk consumption: Review of risks and benefits. Food Control 31, 251–262.
COSTA SOBRINHO, PAULO DE SOUZA, MARÇAL DE FARIA, CAMILA ANDREATA, SILVA PINHEIRO, J., GONÇALVES DE ALMEIDA, H., VIEIRA PIRES, C., SILVA SANTOS, A. (2012): Bacteriological quality of raw Milk used for production of a Brazilian farmstead raw milk cheese. Foodborne Pathogens and Disease 9, 138-144.
D’AMICO, D., DONNELLY, C. (2010): Microbiological quality of raw milk used for small-scale artisan cheese production in Vermont: effect of farm characteristics and practices. Journal of dairy science 93, 134-147.
DE JONGHE, V., COOREVITS, A., VAN HOORDE, K., MESSENS, W., VAN LANDSCHOOT, A., DE VOS, P., HEYNDRICKX, M. (2011): Influence of storage conditions on the growth of Pseudomonas species in refrigerated raw milk. Applied and Environmental Microbiology 77, 460-470.
DE PINHO MANZI, M., NOBREGA, D.B., FACCIOLI, P.Y., TRONCARELLI, M.Z., MENOZZI, B.D., LANGONI, H. (2012): Relationship between teat-end condition, udder cleanliness and bovine subclinical mastitis. Research in veterinary science 93, 430-434.
DEVRIES, T.J., AARNOUDSE, M.G., BARKEMA, H.W., LESLIE, K.E., VON KEYSERLINGK, M.A. (2012): Associations of dairy cow behavior, barn hygiene, cow hygiene, and risk of elevated somatic cell count. Journal of dairy science 95, 5730-5739.
DORAN, P., CARSON, J., COSTELLO, E., MORE, S. (2009): An outbreak of tuberculosis affecting cattle and people on an Irish dairy farm, following the consumption of raw milk. Irish Veterinary Journal 62, 390.
DOUMITH, M., BUCHRIESER, C., GLASER, P., JACQUET, C., MARTIN, P. (2004): Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. Journal of clinical microbiology 42, 3819-3822.
ELLIS, K.A., INNOCENT, G.T., MIHM, M., CRIPPS, P., MCLEAN, W.G., HOWARD, C.V., GROVE-WHITE, D. (2007): Dairy cow cleanliness and milk quality on organic and conventional farms in the UK. Journal of Dairy Research 74, 302-310.
ELMOSLEMANY, A., KEEFE, G.P., DOHOO, I.R., JAYARAO, B. (2009): Risk factors for bacteriological quality of bulk tank milk in Prince Edward Island dairy herds. Part 1: Overall risk factors. Journal of dairy science 92, 2634-2643.
ELMOSLEMANY, A.M., KEEFE, G., DOHOO, I., WICHTEL, J., STRYHN, H., DINGWELL, R. (2010): The association between bulk tank milk analysis for raw milk quality and on-farm management practices. Preventive veterinary medicine 95, 32-40.
ELTHOLTH, M., MARSH, V., VAN WINDEN, S., GUITIAN, F. (2009): Contamination of food products with Mycobacterium avium paratuberculosis: a systematic review. Journal of applied microbiology 107, 1061-1071.
56
ERCOLINI, D., RUSSO, F., FERROCINO, I., VILLANI, F. (2009): Molecular identification of mesophilic and psychrotrophic bacteria from raw cow's milk. Food Microbiology 26, 228-231.
EUROPEAN COMMISSION (2004): Regulation (EC) No 853/2004 of the European Parliament and of the Council of 29 April 2004 laying down specific hygiene rules for food of animal origin. Off.J.Eur.Union L 226, 22-82.
EUROPEAN COMMISSION (2005): Commission Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Off.J.Eur.Union L 338.
FRANK J., F. (1997): Milk and dairy products. Food Microbiology –Fundamental and Frontiers (Doyle P, Beuchat R & Montville J, eds.), pp. 169–186. ASM Press, Washington, DC.
FRICKER, M., SKANSENG, B., RUDI, K., STESSL, B., EHLING-SCHULZ, M. (2011): Shift from farm to dairy tank milk microbiota revealed by a polyphasic approach is independent from geographical origin. International journal of food microbiology 145 Suppl 1, S24-30.
GARGOURI, A., HAMED, H., ELFEKI, A. (2013): Analysis of Raw Milk Quality at Reception and During Cold Storage: Combined Effects of Somatic Cell Counts and Psychrotrophic Bacteria on Lipolysis. Journal of Food Science .
GIACOMETTI, F., SERRAINO, A., FINAZZI, G., DAMINELLI, P., LOSIO, M.N., BONILAURI, P., ARRIGONI, N., GARIGLIANI, A., MATTIOLI, R., ALONSO, S. (2012): Foodborne pathogens in in-line milk filters and associated on-farm risk factors in dairy farms authorized to produce and sell raw milk in Northern Italy. Journal of Food Protection® 75, 1263-1269.
GILLESPIE, B., LEWIS, M., BOONYAYATRA, S., MAXWELL, M., SAXTON, A., OLIVER, S., ALMEIDA, R. (2012): Evaluation of bulk tank milk microbiological quality of nine dairy farms in Tennessee. Journal of dairy science 95, 4275-4279.
GRABER, H, BOSS, R (2012): Mastitis diagnostics: qPCR for Staphylococcus aureus genotype B in bulk tank milk. Anonymous Udder Health and CommunicationSpringer, S. 243-249.
GUH, A., PHAN, Q., RANDALL, N., PURVIANCE, K., MILARDO, E., KINNEY, S., MSHAR, P., KASACEK, W., CARTTER, M. (2010): Outbreak of Escherichia coli O157 associated with raw milk, Connecticut, 2008. Clinical infectious diseases 51, 1411-1417.
HARAN, K., GODDEN, S., BOXRUD, D., JAWAHIR, S., BENDER, J., SREEVATSAN, S. (2012): Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. Journal of clinical microbiology 50, 688-695.
HANTSIS-ZACHAROV, E., HALPERN, M. (2007): Culturable psychrotrophic bacterial communities in raw milk and their proteolytic and lipolytic traits. Applied and Environmental Microbiology 73, 7162-7168.
HAVERI, M., HOVINEN, M., ROSLOF, A., PYORALA, S. (2008): Molecular types and genetic profiles of Staphylococcus aureus strains isolated from bovine intramammary infections and extramammary sites. Journal of clinical microbiology 46, 3728-3735.
57
HEUVELINK, A.E., VAN HEERWAARDEN, C., ZWARTKRUIS-NAHUIS, A., TILBURG, J.J., BOS, M.H., HEILMANN, F.G., HOFHUIS, A., HOEKSTRA, T., DE BOER, E. (2009): Two outbreaks of campylobacteriosis associated with the consumption of raw cows' milk. International journal of food microbiology 134, 70-74.
HUBER, H., GIEZENDANNER, N., STEPHAN, R., ZWEIFEL, C. (2011): Genotypes, antibiotic resistance profiles and microarray-based characterization of methicillin-resistant Staphylococcus aureus strains isolated from livestock and veterinarians in Switzerland. Zoonoses and public health 58, 343-349.
INTERNATIONAL DAIRY FEDERATION (IDF) (1987): Bovine mastitis. Definition and guidelines for diagnosis. Bulletin 24. International Dairy Federation, Brussels, Belgium.
ISO 11290-1 (1996/Amd. 2004): Microbiology of food and animal feeding stuffs-horizontal method for the detection and enumeration of Listeria monocytogenes Part 1: Detection. International Organisation for Standardization. Geneva, Switzerland.
ISO 11290-2 (1998): Microbiology of food and animal feeding stuffs-horizontal method for the enumeration of Listeria monocytogenes Part 2: Enumeration. International Organisation for Standardization. Geneva, Switzerland.
ISO 6888-1 (1999): Microbiology of food and animal feeding stuffs -- Horizontal method for the enumeration of coagulase-positive staphylococci Staphylococcus aureus and other species -- Part 1: Technique using Baird-Parker agar medium. International Organisation for Standardization. Geneva, Switzerland.
ISO 4833 (2003): Microbiology of food and animal feeding stuffs -- Horizontal method for the enumeration of microorganisms -- Colony-count technique at 30 degrees C. International Organisation for Standardization. Geneva, Switzerland.
ISO 6579 (2005): Microbiology of food and animal feeding stuffs -- Horizontal method for the detection of International Organisation for Standardization. Geneva, Switzerland.
ISO 4832 (2006): Microbiology of food and animal feeding stuffs -- Horizontal method for the enumeration of coliforms -- Colony-count technique. International Organisation for Standardization. Geneva, Switzerland.
JACKSON, K., BIGGERSTAFF, M., TOBIN-D'ANGELO, M., SWEAT, D., KLOS, R., NOSARI, J., GARRISON, O., BOOTHE, E., SAATHOFF-HUBER, L., HAINSTOCK, L. (2011): Multistate outbreak of Listeria monocytogenes associated with Mexican-style cheese made from pasteurized milk among pregnant, Hispanic women. Journal of Food Protection® 74, 949-953.
JAYARAO, B.M., DONALDSON, S.C., STRALEY, B.A., SAWANT, A.A., HEGDE, N.V., BROWN, J. (2006): A survey of foodborne pathogens in bulk tank milk and raw milk consumption among farm families in Pennsylvania. Journal of dairy science 89, 2451-2458.
JAYARAO, B., PILLAI, S., SAWANT, A., WOLFGANG, D., HEGDE, N. (2004): Guidelines for monitoring bulk tank milk somatic cell and bacterial counts. Journal of dairy science 87, 3561-3573.
58
KELLY, P.T., O'SULLIVAN, K., BERRY, D.P., MORE, S.J., MEANEY, W.J., O'CALLAGHAN, E.J., O'BRIEN, B. (2009): Farm management factors associated with bulk tank somatic cell count in Irish dairy herds. Irish Veterinary Journal 62, S45.
KREAUSUKON, K., FETSCH, A., KRAUSHAAR, B., ALT, K., MÜLLER, K., KRÖMKER, V., ZESSIN, K., KÄSBOHRER, A., TENHAGEN, B. (2012): Prevalence, antimicrobial resistance, and molecular characterization of methicillin-resistant Staphylococcus aureus from bulk tank milk of dairy herds. Journal of dairy science 95, 4382-4388.
KURZWEIL, R., BUSSE, M. (1973): Total count and microflora of freshly drawn milk. Milchwissenschaft 28:427.
LATORRE, A., VAN KESSEL, J., KARNS, J., ZURAKOWSKI, M., PRADHAN, A., BOOR, K., JAYARAO, B., HOUSER, B., DAUGHERTY, C., SCHUKKEN, Y. (2010): Biofilm in milking equipment on a dairy farm as a potential source of bulk tank milk contamination with Listeria monocytogenes. Journal of dairy science 93, 2792-2802.
LEE, S.H., CAMARGO, C.H., GONCALVES, J.L., CRUZ, A.G., SARTORI, B.T., MACHADO, M.B., OLIVEIRA, C.A. (2012): Characterization of Staphylococcus aureus isolates in milk and the milking environment from small-scale dairy farms of Sao Paulo, Brazil, using pulsed-field gel electrophoresis. Journal of dairy science 95, 7377-7383.
LERICHE, F., FAYOLLE, K. (2012): No seasonal effect on culturable pseudomonads in fresh milks from cattle herds. Journal of dairy science 95, 2299-2306.
LOFTIS, A.D., PRIESTLEY, R.A., MASSUNG, R.F. (2010): Detection of Coxiella burnetii in commercially available raw milk from the United States. Foodborne pathogens and disease 7, 1453-1456.
MARCHAND, S., DE BLOCK, J., DE JONGHE, V., COOREVITS, A., HEYNDRICKX, M., HERMAN, L. (2012): Biofilm formation in milk production and processing environments; influence on milk quality and safety. Comprehensive Reviews in Food Science and Food Safety 11, 133-147.
MOLINERI, A.I., SIGNORINI, M.L., CUATRÍN, A.L., CANAVESIO, V.R., NEDER, V.E., RUSSI, N.B., BONAZZA, J.C., CALVINHO, L.F. (2012): Association between milking practices and psychrotrophic bacterial counts in bulk tank milk. Revista Argentina de microbiologia 44, 187-194.
MØRK, T., KVITLE, B., JORGENSEN, H.J. (2012): Reservoirs of Staphylococcus aureus in meat sheep and dairy cattle. Veterinary microbiology 155, 81-87.
MOSALAGAE, D., PFUKENYI, D.M., MATOPE, G. (2011): Milk producers’ awareness of milk-borne zoonoses in selected smallholder and commercial dairy farms of Zimbabwe. Tropical animal health and production 43, 733-739.
MUNOZ, M.A., BENNETT, G.J., AHLSTROM, C., GRIFFITHS, H.M., SCHUKKEN, Y.H., ZADOKS, R.N. (2008): Cleanliness scores as indicator of Klebsiella exposure in dairy cows. Journal of dairy science 91, 3908-3916.
59
MURCHAN, S., KAUFMANN, M.E., DEPLANO, A., DE RYCK, R., STRUELENS, M., ZINN, C.E., FUSSING, V., SALMENLINNA, S., VUOPIO-VARKILA, J., EL SOLH, N., CUNY, C., WITTE, W., TASSIOS, P.T., LEGAKIS, N., VAN LEEUWEN, W., VAN BELKUM, A., VINDEL, A., LACONCHA, I., GARAIZAR, J., HAEGGMAN, S., OLSSON-LILJEQUIST, B., RANSJO, U., COOMBES, G., COOKSON, B. (2003): Harmonization of pulsed-field gel electrophoresis protocols for epidemiological typing of strains of methicillin-resistant Staphylococcus aureus: a single approach developed by consensus in 10 European laboratories and its application for tracing the spread of related strains. Journal of clinical microbiology 41, 1574-1585.
OKURA, H., NIELSEN, S.S., TOFT, N. (2013): Modelling the effect of direct and indirect contamination of on-farm bulk tank milk with Mycobacterium avium subsp. paratuberculosis. Foodborne pathogens and disease 10, 270-277.
OLDE RIEKERINK, R.G., BARKEMA, H.W., SCHOLL, D.T., POOLE, D.E., KELTON, D.F. (2010): Management practices associated with the bulk-milk prevalence of Staphylococcus aureus in Canadian dairy farms. Preventive veterinary medicine 97, 20-28.
OLIVEIRA, C., LOPES JÚNIOR, W., QUEIROGA, R., GIVISIEZ, P., AZEVEDO, P., PEREIRA, W., GEBREYES, W. (2011a): Risk factors associated with selected indicators of milk quality in semiarid northeastern Brazil. Journal of dairy science 94, 3166-3175.
OLIVEIRA, A.M., PADOVANI, C.R., MIYA, N.T.N., SANT'ANA, A.S., PEREIRA, J.L. (2011b): High Incidence of Enterotoxin D Producing Staphylococcus spp. in Brazilian Cow's Raw Milk and Its Relation with Coagulase and Thermonuclease Enzymes. Foodborne Pathogens and Disease 8, 159-163.
OLIVER, S.P., BOOR, K.J., MURPHY, S.C., MURINDA, S.E. (2009): Food safety hazards associated with consumption of raw milk. Foodborne pathogens and disease 6, 793-806.
OSTYN, A., DE BUYSER, M., GUILLIER, F., GROULT, J., FELIX, B., SALAH, S., DELMAS, G., HENNEKINNE, J. (2010): First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Euro Surveill 15, 1-4.
PADUCH, J.H., MOHR, E., KROMKER, V. (2013): The association between bedding material and the bacterial counts of Staphylococcus aureus, Streptococcus uberis and coliform bacteria on teat skin and in teat canals in lactating dairy cattle. The Journal of dairy research 80, 159-164.
PANKEY, J.W. (1989): Premilking udder hygiene. Journal of dairy science 72, 1308-1312.
PANTOJA, J.C., REINEMANN, D.J., RUEGG, P.L. (2009): Associations among milk quality indicators in raw bulk milk. Journal of dairy science 92, 4978-4987.
PANTOJA, J., REINEMANN, D., RUEGG, P. (2011): Factors associated with coliform count in unpasteurized bulk milk. Journal of dairy science 94, 2680-2691.
PARK, S.H., KIM, H.J., KIM, J.H., KIM, T.W., KIM, H.Y. (2007): Simultaneous detection and identification of Bacillus cereus group bacteria using multiplex PCR. Journal of microbiology and biotechnology 17, 1177-1182.
PERKINS, N., KELTON, D., HAND, K., MACNAUGHTON, G., BERKE, O., LESLIE, K. (2009): An analysis of the relationship between bulk tank milk quality and wash water quality on dairy farms in Ontario, Canada. Journal of dairy science 92, 3714-3722.
60
PETRUZZELLI, A., AMAGLIANI, G., MICCI, E., FOGLINI, M., DI RENZO, E., BRANDI, G., TONUCCI, F. (2013): Prevalence assessment of Coxiella burnetii and verocytotoxin-producing Escherichia coli in bovine raw milk through molecular identification. Food Control .
PICCININI, R., CESARIS, L., DAPRA, V., BORROMEO, V., PICOZZI, C., SECCHI, C., ZECCONI, A. (2009): The role of teat skin contamination in the epidemiology of Staphylococcus aureus intramammary infections. The Journal of dairy research 76, 36-41.
PIEPERS, S., PEETERS, K., OPSOMER, G., BARKEMA, H.W., FRANKENA, K., DE VLIEGHER, S. (2011): Pathogen group specific risk factors at herd, heifer and quarter levels for intramammary infections in early lactating dairy heifers. Preventive veterinary medicine 99, 91-101.
QUIGLEY, L., O'SULLIVAN, O., BERESFORD, T.P., ROSS, R.P., FITZGERALD, G.F., COTTER, P.D. (2011): Molecular approaches to analysing the microbial composition of raw milk and raw milk cheese. International journal of food microbiology 150, 81-94.
RAATS, D., OFFEK, M., MINZ, D., HALPERN, M. (2011): Molecular analysis of bacterial communities in raw cow milk and the impact of refrigeration on its structure and dynamics. Food Microbiology 28, 465-471.
REINEMANN, D.J., WOLTERS, G., BILLON, P., LIND, O., RASMUSSEN, M.D. (2003): Review of practices for cleaning and sanitation of milking machines. Bulletin-International Dairy Federation , 3-18.
REYHER, K.K., HAINE, D., DOHOO, I.R., REVIE, C.W. (2012): Examining the effect of intramammary infections with minor mastitis pathogens on the acquisition of new intramammary infections with major mastitis pathogens--a systematic review and meta-analysis. Journal of dairy science 95, 6483-6502.
RU, G., MODA, G., CHIAVACCI, L. (2013): Bovine TB control: valuable insights from countries on steps toward eradication. The Veterinary record 172, 310-311.
RUUSUNEN, M., SALONEN, M., PULKKINEN, H., HUUSKONEN, M., HELLSTROM, S., REVEZ, J., HANNINEN, M.L., FREDRIKSSON-AHOMAA, M., LINDSTROM, M. (2013): Pathogenic bacteria in Finnish bulk tank milk. Foodborne pathogens and disease 10, 99-106.
SCHMID, D., FRETZ, R., WINTER, P., MANN, M., HÖGER, G., STÖGER, A., RUPPITSCH, W., LADSTÄTTER, J., MAYER, N., DE MARTIN, A. (2009): Outbreak of staphylococcal food intoxication after consumption of pasteurized milk products, June 2007, Austria. Wiener klinische Wochenschrift 121, 125-131.
SCHUKKEN, Y., CHUFF, M., MORONI, P., GURJAR, A., SANTISTEBAN, C., WELCOME, F., ZADOKS, R. (2012): The "other" gram-negative bacteria in mastitis: Klebsiella, Serratia, and more. The Veterinary clinics of North America.Food animal practice 28, 239-256.
SPOHR, M., RAU, J., FRIEDRICH, A., KLITTICH, G., FETSCH, A., GUERRA, B., HAMMERL, J., TENHAGEN, B. (2011): Methicillin-Resistant Staphylococcus aureus (MRSA) in Three Dairy Herds in Southwest Germany. Zoonoses and Public Health 58, 252-261.
STULOVA, I., ADAMBERG, S., KRIŠČIUNAITE, T., KAMPURA, M., BLANK, L., LAHT, T. (2010): Microbiological quality of raw milk produced in Estonia. Letters in applied microbiology 51, 683-690.
61
SYRING, C., BOSS, R., REIST, M., BODMER, M., HUMMERJOHANN, J., GEHRIG, P., GRABER, H.U. (2012): Bovine mastitis: the diagnostic properties of a PCR-based assay to monitor the Staphylococcus aureus genotype B status of a herd, using bulk tank milk. Journal of dairy science 95, 3674-3682.
TENOVER, F.C., ARBEIT, R.D., GOERING, R.V., MICKELSEN, P.A., MURRAY, B.E., PERSING, D.H., SWAMINATHAN, B. (1995): Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. Journal of clinical microbiology 33, 2233-2239.
TILBURG, J.J., ROEST, H.J.I., NABUURS-FRANSSEN, M.H., HORREVORTS, A.M., KLAASSEN, C.H. (2012): Genotyping reveals the presence of a predominant genotype of Coxiella burnetii in consumer milk products. Journal of clinical microbiology 50, 2156-2158.
TOLLE A (1980): The microflora of the udder. Bulletin of the International Dairy Federation 120, pp. 4.
VAN DUYNHOVEN, Y., ISKEN, L., BORGEN, K., BESSELSE, M., SOETHOUDT, K., HAITSMA, O., MULDER, B., NOTERMANS, D., DE JONGE, R., KOCK, P. (2009): A prolonged outbreak of Salmonella Typhimurium infection related to an uncommon vehicle: hard cheese made from raw milk. Epidemiology and infection 137, 1548-1557.
VAN KESSEL, JO ANN S, KARNS, J.S., LOMBARD, J.E., KOPRAL, C.A. (2011): Prevalence of Salmonella enterica, Listeria monocytogenes, and Escherichia coli virulence factors in bulk tank milk and in-line filters from US dairies. Journal of Food Protection® 74, 759-768.
VERDIER-METZ, I., GAGNE, G., BORNES, S., MONSALLIER, F., VEISSEIRE, P., DELBES-PAUS, C., MONTEL, M.C. (2012): Cow teat skin, a potential source of diverse microbial populations for cheese production. Applied and Environmental Microbiology 78, 326-333.
VILAR, M., RODRÍGUEZ-OTERO, J., SANJUÁN, M., DIÉGUEZ, F., VARELA, M., YUS, E. (2012): Implementation of HACCP to control the influence of milking equipment and cooling tank on the milk quality. Trends in Food Science & Technology 23, 4-12.
VILAR, M., RODRIGUEZ-OTERO, J., DIÉGUEZ, F., SANJUÁN, M., YUS, E. (2008): Application of ATP bioluminescence for evaluation of surface cleanliness of milking equipment. International journal of food microbiology 125, 357-361.
VILAR, M., YUS, E., SANJUÁN, M., DIÉGUEZ, F., RODRÍGUEZ-OTERO, J. (2007): Prevalence of and Risk Factors for Listeria Species on Dairy Farms. Journal of dairy science 90, 5083-5088.
WALSH, P.S., METZGER, D.A., HIGUCHI, R. (1991): Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10, 506-513.
YOUNG, I., HENDRICK, S., PARKER, S., RAJIĆ, A., MCCLURE, J., SANCHEZ, J., MCEWEN, S. (2010): Knowledge and attitudes towards food safety among Canadian dairy producers. Preventive veterinary medicine 94, 65-76.
ZADOKS, R.N., GRIFFITHS, H.M., MUNOZ, M.A., AHLSTROM, C., BENNETT, G.J., THOMAS, E., SCHUKKEN, Y.H. (2011): Sources of Klebsiella and Raoultella species on dairy farms: be careful where you walk. Journal of dairy science 94, 1045-1051.
62
ZUCALI, M., BAVA, L., TAMBURINI, A., BRASCA, M., VANONI, L., SANDRUCCI, A. (2011): Effects of season, milking routine and cow cleanliness on bacterial and somatic cell counts of bulk t
63
9 APPENDIX Table I. Microbiological data on 18 bulk tank milk samples collected at 18 dairy farms during winter (cfu/ml). FARM 1 FARM 2 FARM 3 FARM 4 FARM 5
SAMPLE 1 SAMPLE 5 SAMPLE 2 SAMPLE 7 SAMPLE 3 SAMPLE 8 SAMPLE 4 SAMPLE 9 SAMPLE 6 SAMPLE 10
pH 6.83 6.84 7.15 6.96 6.88 6.76 6.8 6.6 7.03 6.66 TBC/ml 3.10E+03 1.60E+03 1.30E+05 6.50E+03 1.30E+03 2.20E+03 6.90E+03 3.10E+03 9.40E+03 2.20E+05 Coliforms/ml <10 <10 <10 <10 <10 1.40E+01 <10 <10 <10 <10 Yeasts and Molds/ml <10 7.60E+01 1.60E+04 4.40E+02 <10 5.70E+02 1.70E+02 1.20E+02 >3.0E+02 >3.0E+02 Enterococci/ml <10 <10 <10 2.00E+02 1.50E+02 1.60E+02 <10 2.40E+02 <10 <10 Pseudomonas/ml >3.0E+07 1.60E+07 >3.0E+07 1.80E+07 >3.0E+07 >3.0E+07 >3.0E+07 >3.0E+07 >3.0E+07 2.60E+07 Lactobacilli/ml 1.60E+02 2.30E+02 9.10E+02 8.00E+02 1.40E+02 1.30E+02 1.20E+03 2.70E+02 2.10E+02 2.80E+02 Lactic Acid Streptococci/ml 1.60E+03 1.60E+03 3.00E+04 1.30E+03 6.40E+02 5.30E+02 2.60E+03 1.50E+03 4.70E+02 8.20E+02 S. aureus /ml <10 <10 <10 <10 <10 <10 <10 <10 2.40E+03 8.40E+02
FARM 6 FARM 7 FARM 8 FARM 9 FARM 10
SAMPLE 11 SAMPLE 14 SAMPLE 12 SAMPLE 15 SAMPLE 13 SAMPLE 16 SAMPLE 17 SAMPLE 19 SAMPLE 18 SAMPLE 20 pH 7.1 7.16 7.17 7.18 7.23 7.22 6.88 6.83 6.7 6.64 TBC/ml 7.70E+04 3.10E+05 2.80E+03 3.00E+03 8.40E+04 9.50E+04 1.80E+06 8.00E+04 1.00E+04 1.50E+04 Coliforms/ml 5.50E+01 1.10E+03 2.20E+01 6.30E+02 2.10E+01 4.20E+02 6.60E+04 1.40E+04 5.60E+03 5.60E+02 Yeasts and Molds/ml 7.20E+02 2.30E+03 6.20E+01 1.50E+02 5.80E+02 4.50E+02 6.70E+04 3.20E+03 1.00E+03 1.20E+02 Enterococci/ml 1.40E+02 7.40E+02 9.60E+02 6.60E+02 5.20E+02 8.50E+02 4.90E+03 3.30E+03 2.40E+02 3.90E+02 Pseudomonas/ml 1.90E+03 8.70E+03 1.60E+02 2.20E+03 1.30E+03 1.80E+04 1.80E+06 1.50E+04 2.10E+04 5.00E+02 Lactobacilli/ml 1.50E+04 >3.0E+04 1.00E+03 1.30E+03 5.60E+03 1.50E+03 1.30E+04 >3.0E+04 7.10E+02 8.00E+02 Lactic Acid Streptococci/ml 1.60E+04 >3.0E+04 1.40E+03 1.80E+03 6.30E+03 1.20E+04 >3.0E+04 >3.0E+04 2.60E+03 5.40E+03 S. aureus /ml <10 <10 <10 <10 9.40E+02 <10 1.40E+03 >3,0E+03 <10 <10
Milk temperature ≥ +6°C: sample 36 (+ 9.7°C) farm 18 S. aureus positive: sample 4, 11, 14, 22, 24, 25, 30, 34 farm 4, 6, 12, 13, 16 L. monocytogenes positive: sample 14, 16, 24 farm 6, 8, 12
64
Table I continued. Microbiological data on bulk tank milk samples collected at 18 dairy farms during winter (cfu/ml). FARM 11 FARM 12 FARM 13 FARM 14
SAMPLE 21 SAMPLE 23 SAMPLE 22 SAMPLE 24 SAMPLE 25 SAMPLE 27 SAMPLE 26 SAMPLE 28
pH 6.69 6.9 6.88 6.98 6.86 6.71 7.02 6.85 TBC/ml 2.60E+05 4.60E+04 1.70E+05 6.00E+04 9.10E+03 1.70E+04 7.90E+04 1.60E+06 Coliforms/ml 2.90E+03 1.20E+03 1.10E+03 6.40E+02 8.30E+02 4.10E+03 9.20E+03 >3,0E+05 Yeasts and Molds/ml 9.00E+02 1.00E+03 4.80E+02 2.80E+02 2.40E+02 1.70E+02 4.50E+02 1.80E+03 Enterococci/ml 7.50E+02 1.90E+03 1.30E+02 5.50E+02 6.00E+02 5.90E+02 7.00E+03 1.20E+03 Pseudomonas/ml 2.10E+03 5.70E+03 7.20E+03 1.20E+03 1.30E+03 1.80E+04 1.20E+04 9.20E+05 Lactobacilli/ml 5.10E+03 5.70E+03 8.50E+03 6.70E+03 2.50E+03 2.00E+03 4.40E+03 1.60E+03 Lactic Acid Streptococci/ml 1.10E+04 1.20E+04 1.10E+04 9.10E+03 2.90E+03 7.40E+03 1.40E+04 2.10E+04 S. aureus/ml <10 <10 <10 5.90E+02 <10 <10 <10 1.20E+02
FARM 15 FARM 16 FARM 17 FARM 18
SAMPLE 29 SAMPLE 31 SAMPLE 30 SAMPLE 34 SAMPLE 32 SAMPLE 35 SAMPLE 33 SAMPLE 36
pH 7.05 6.89 6.85 6.68 6.78 6.88 6.77 6.64 TBC/ml 7.50E+05 2.50E+05 1.20E+04 2.40E+04 1.80E+04 1.20E+06 8.80E+03 1.80E+05 Coliforms/ml 1.20E+05 >3,0E+04 7.00E+02 9.90E+03 7.10E+02 1.80E+04 4.60E+01 7.10E+03 Yeasts and Molds/ml >3.0E+02 >3.0E+03 >3.0E+03 n.a. 2.50E+02 1.50E+03 5.10E+01 2.20E+04 Enterococci/ml 6.20E+02 2.90E+02 1.70E+02 4.90E+02 4.80E+02 3.70E+02 <10 <10 Pseudomonas/ml 6.80E+05 3.20E+05 2.00E+02 1.60E+04 1.50E+03 7.70E+05 <10 1.50E+05 Lactobacilli/ml 3.10E+03 1.20E+03 2.00E+03 2.00E+03 6.50E+03 3.00E+03 2.50E+03 9.20E+03 Lactic Acid Streptococci/ml 4.30E+03 1.40E+03 5.70E+03 5.80E+03 9.40E+03 3.90E+03 2.80E+03 2.40E+03 S. aureus/ml <10 <10 <10 3.30E+02 <10 <10 <10 <10
Milk temperature ≥ +6°C: sample 36 (+ 9.7°C) farm 18 S. aureus positive: sample 4, 11, 14, 22, 24, 25, 30, 34 farm 4, 6, 12, 13, 16 L. monocytogenes positive: sample 14, 16, 24 farm 6, 8, 12
65
Table I continued. Microbiological data on bulk tank milk samples collected at 17 dairy farms during summer (cfu/ml). FARM 1 FARM 2 FARM 3 FARM 4 FARM 5 SAMPLE 11 SAMPLE 16 SAMPLE 27 SAMPLE 31 SAMPLE 2 SAMPLE 5 SAMPLE 3 SAMPLE 8 SAMPLE 22 SAMPLE 26
pH 6.61 6.54 6.78 6.72 6.84 6.81 6.76 6.80 6.58 6.71 TBC/ml 4.70E+03 7.10E+04 1.60E+05 3.70E+03 4.60E+03 3.90E+03 1.30E+05 1.80E+05 2.40E+03 8.30E+03 Coliforms/ml <10 8.50E+02 3.50E+01 1.10E+01 <10 <10 1.10E+02 2.90E+01 <10 <10 Yeasts and Molds/ml 4.80E+02 2.30E+03 2.50E+03 1.50E+03 2.20E+02 1.50E+03 2.30E+03 2.00E+03 4.80E+02 6.00E+02 Enterococci/ml 1.00E+02 <10 1.90E+02 1.70E+02 <10 <10 2.40E+02 1.40E+02 3.00E+02 1.30E+02 Pseudomonas/ml 7.10E+02 1.00E+03 7.70E+03 1.30E+03 1.20E+02 5.40E+03 3.20E+03 8.10E+02 <10 1.20E+02 Lactobacilli/ml 6.30E+03 6.50E+03 1.60E+04 2.90E+03 1.30E+03 1.80E+03 9.20E+03 4.00E+03 8.70E+02 1.10E+03 Lactic Acid Streptococci/ml <10 <10 <10 <10 <10 1.20E+02 <10 <10 1.90E+02 1.90E+02 CPS/ml 4.60E+01 1.50E+02 3.50E+02 8.70E+02 4.60E+01 1.30E+02 2.10E+03 1.90E+03 1.70E+01 1.10E+01
FARM 6 FARM 7 FARM 8 FARM 9 FARM 10 SAMPLE 1 SAMPLE 6 SAMPLE 17 SAMPLE 20 SAMPLE 30 SAMPLE 34 SAMPLE 4 SAMPLE 7 SAMPLE 29 SAMPLE 33
pH 6.78 6.79 6.54 6.48 7.23 6.42 6.82 7.04 6.78 6.82 TBC/ml 1.80E+04 7.20E+04 1.70E+04 7.70E+03 2.10E+04 8.80E+04 9.50E+04 3.50E+04 2.20E+04 2.80E+04 Coliforms/ml 4.40E+02 5.40E+02 1.60E+01 <10 1.60E+01 3.20E+01 8.50E+01 5.20E+01 7.40E+01 1.20E+03 Yeast and Mold/ml 9.80E+03 6.80E+03 6.70E+03 1.80E+03 2.70E+03 9.90E+02 2.30E+04 7.20E+03 1.60E+03 2.40E+03 Enterococci/ml <10 4.30E+02 4.90E+02 4.10E+02 2.20E+02 6.60E+02 6.60E+02 6.50E+02 1.20E+02 1.20E+02 Pseudomonas/ml 9.36E+02 3.30E+03 3.70E+02 8.40E+02 2.40E+03 6.60E+04 <10 <10 4.20E+03 2.40E+04 Lactobacilli/ml 1.30E+04 1.60E+04 1.15E+04 4.80E+03 5.40E+03 4.30E+03 >3.0E+04 >3.00E+04 5.40E+02 6.80E+03 Lactic Acid Streptococci/ml <10 <10 <10 <10 <10 <10 <10 <10 <10 <10 CPS/ml 5.00E+02 1.60E+03 7.90E+02 1.90E+02 >3.0E+02 >3.0E+02 1.90E+02 5.70E+02 1.80E+02 1.10E+01 Milk temperature ≥ +6°C: sample 15 (+ 6.0°C), 24 (+ 6.1°C), farm 5, 10, 12, 16, 18 25 (+ 9.7°C), 26 (+ 7.7°C), 33 (+ 6.4°C) S. aureus positive: sample 1, 6, 8, 12, 13, 19, 24, 29, 32, 34 farm 4, 6, 8, 10, 11, 12, 13,
16 L. monocytogenes positive: sample 4, 7, 24, 33 farm 9, 10, 16
66
Table I continued. Microbiological data on bulk tank milk samples collected at 17 dairy farms during summer (cfu/ml)..
FARM 11 FARM 12 FARM 13 FARM 15 SAMPLE 9 SAMPLE 13 SAMPLE 12 SAMPLE 15 SAMPLE 28 SAMPLE 32 SAMPLE 18 SAMPLE 21
pH 6.78 6.77 6.70 6.69 6.58 6.74 6.72 6.71 TBC/ml 1.80E+04 1.90E+04 3.40E+05 3.50E+06 2.50E+04 2.90E+05 9.70E+03 1.20E+04 Coliforms/ml 2.30E+02 >3.0E+03 3.90E+02 9.90E+03 7.27E+01 1.10E+03 1.80E+02 3.70E+02 Yeasts and Molds/ml 4.50E+03 5.90E+03 7.10E+03 1.10E+04 2.00E+03 3.20E+03 2.00E+03 2.90E+03 Enterococci/ml 1.10E+03 1.40E+03 1.20E+02 4.90E+02 9.00E+02 1.50E+03 5.10E+02 5.90E+02 Pseudomonas/ml 5.00E+03 2.80E+03 >3.0E+04 1.30E+04 3.50E+03 5.80E+03 7.90E+02 1.30E+03 Lactobacilli/ml 5.90E+03 5.80E+03 2.00E+04 >3.0E+04 9.30E+03 >3.0E+04 2.20E+03 4.50E+03 Lactic Acid Streptococci/ml <10 <10 <10 <10 <10 <10 <10 <10 CPS/ml 9.50E+01 5.50E+02 3.10E+03 1.70E+03 1.40E+03 1.30E+03 1.10E+02 3.20E+02
FARM 16 FARM 17 FARM 18 SAMPLE 19 SAMPLE 24 SAMPLE 10 SAMPLE 14 SAMPLE 23 SAMPLE 25
pH 6.41 6.68 6.80 6.81 6.70 6.77 TBC/ml 2.50E+04 9.70E+04 1.50E+04 1.90E+04 1.90E+05 4.10E+03 Coliforms/ml 4.30E+01 >3.0E+03 2.30E+01 3.80E+02 1.00E+01 <10 Yeasts and Molds/ml 1.13E+04 1.30E+04 8.70E+03 1.02E+04 5.30E+02 6.30E+02 Enterococci/ml 9.60E+02 1.10E+03 2.70E+02 1.90E+02 1.30E+03 1.90E+02 Pseudomonas/ml 2.30E+02 9.70E+05 1.50E+03 1.10E+03 6.40E+03 1.10E+02 Lactobacilli/ml 2.53E+04 2.20E+04 1.40E+04 1.62E+04 1.20E+04 2.10E+03 Lactic Acid Streptococci/ml <10 <10 <10 <10 <10 <10 CPS/ml 2.90E+02 5.40E+02 1.30E+02 >3.0E+02 >3.0E+02 8.10E+01 Milk temperature ≥ +6°C: sample 15 (+ 6.0°C), 24 (+ 6.1°C), farm 5, 10, 12, 16, 18 25 (+ 9.7°C), 26 (+ 7.7°C), 33 (+ 6.4°C) S. aureus positive: sample 1, 6, 8, 12, 13, 19, 24, 29, 32, 34 farm 4, 6, 8, 10, 11, 12, 13,
16 L. monocytogenes positive: sample 4, 7, 24, 33 farm 9, 10, 16
67
Table II. Data logger results. WINTER SUMMER Data logger (°C) Tank display (°C) Data logger (°C) Tank display (°C)
FARM 1 2.06 4.0 4.90 4.00 3.94 4.0 5.80 4.20
FARM 2 5.54 5.5 4.70 3.50 4.70 5.9 5.20 4.00
FARM 3 4.70 3.7 4.80 3.80 5.24 n. d. 5.10 3.90
FARM 4 0.74 3.6 3.60 3.70 3.50 3.9 4.30 4.10
FARM 5 3.64 4.5 4.90 4.40 5.40 5.7 7.70 6.90
FARM 6 3.50 3.9 4.80 3.80 4.94 4.0 5.70 4.00
FARM 7 3.90 4.0 4.10 4.10 3.94 4.1 4.70 4.20
FARM 8 0.60 3.5 1.30 4.20 3.90 3.6 5.00 3.90
FARM 9 1.14 1.2 4.70 3.70 3.64 3.2 4.00 5.50
FARM 10 4.60 2.4 3.60 1.90 4.54 2.6 6.40 3.00
FARM 11 2.40 4.0 3.20 4.30 3.64 4.3 3.90 4.30
FARM 12 4.30 4.0 5.20 4.80 5.40 5.0 6.00 5.00
FARM 13 3.94 2.8 4.70 3.20 4.34 3.7 5.20 3.80
FARM 14 3.00 3.6 n. d. n. d. 3.94 3.6 n. d. n. d.
FARM 15 3.10 3.8 4.30 3.80 3.64 3.9 4.10 4.20
FARM 16 3.10 4.4 4.60 5.00 5.64 5.3 6.10 5.40
FARM 17 3.74 4.1 3.70 3.40 3.64 4.2 3.40 3.00
FARM 18 3.00 3.5 3.90 3.80 9.70 7.0 9.70 8.40
n. d., not determined;
68
Table III. Cooling dynamics in eighteen dairy farm bulk tanks.
WINTER SUMMER
cooling down phase (minutes)
average AMC (cfu/ml)
cooling down phase (minutes)
average AMC (cfu/ml)
farm 1 84 3.90E+03 94 3.79E+04 farm 2 102 1.33E+05 123 8.19E+04 farm 3 28 2.85E+03 81 4.25E+03 farm 4 72 5.00E+03 73 1.55E+05 farm 5 118 1.15E+05 126 5.35E+03 farm 6 90 1.94E+05 89 4.50E+04 farm 7 98 2.90E+03 119 1.24E+04 farm 8 102 8.95E+04 94 5.45E+04 farm 9 64 9.40E+05 64 6.50E+04 farm 10 65 1.25E+04 84 2.50E+04 farm 11 78 1.53E+05 102 1.85E+04 farm 12 42 1.15E+05 60 1.92E+06 farm 13 85 1.31E+04 90 1.58E+05 farm 14 46 8.40E+05 ----- ----- farm 15 134 5.00E+05 103 1.09E+04 farm 16 70 6.09E+05 53 1.70E+04 farm 17 109 1.80E+04 113 6.10E+04 farm 18 120 9.44E+04 123 9.71E+04
n. d., not determined; AMC, aerobic mesophilc counts.
