Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
1
2
Mannitol and the mannitol-specific enzyme llB subunit activate Vibrio cholerae 3
biofilm formation 4
5
6
Patrick Ymele-Leki‡, Laetitia Houot¥, and Paula I. Watnick* 7
Division of Infectious Diseases 8 Boston Children's Hospital 9
300 Longwood Avenue 10 Boston, Massachusetts 02115 11
12
13
14
*Corresponding author. 15 Mailing address: 16 Division of Infectious Diseases, Boston Children's Hospital, 17 300 Longwood Avenue, Boston, MA 02115. 18 Phone: (617) 919-2918. Fax: (617) 730-0254. 19 E-mail: [email protected] 20 21 ‡Present address : 22 Department of Chemical Engineering 23 Howard University 24 2300 6th Street, NW 25 Washington, DC 20059 26 27 ¥Present address : 28 Laboratoire d’Ingénierie des Systèmes Macromoléculaires 29 Aix-Marseille Université 30 CNRS – UMR7255 31 31 chemin Joseph Aiguier 32 13402 Marseille Cedex 20, France 33 34
35
Running Title: Mannitol activates Vibrio cholerae biofilm accumulation36
Copyright © 2013, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01184-13 AEM Accepts, published online ahead of print on 31 May 2013
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Abstract 37
Vibrio cholerae are halophilic, Gram-negative bacteria found in marine environments. 38
Strains that produce cholera toxin cause the diarrheal disease cholera. V. cholerae 39
use a highly conserved, multi-component signal transduction cascade known as the 40
phosphoenolpyruvate phosphotransferase system (PTS) to regulate carbohydrate 41
uptake and biofilm formation. Regulation of biofilm formation by the PTS is complex, 42
involving many different regulatory pathways that incorporate distinct PTS 43
components. The PTS consists of the general components enzyme l (El) and 44
histidine protein (HPr), and the carbohydrate-specific enzymes ll. Mannitol transport 45
by V. cholerae requires the mannitol-specific Ell (EllMtl), which is expressed only in 46
the presence of mannitol. Here we show that mannitol activates V. cholerae biofilm 47
formation and transcription of the vps biofilm matrix exopolysaccharide synthesis 48
genes. This regulation is dependent on mannitol transport. However, in the absence 49
of mannitol, we show that ectopic expression of the B subunit of EllMtl is sufficient to 50
activate biofilm accumulation. Mannitol, a common compatible solute and 51
osmoprotectant of marine organisms, is a main photosynthetic product of many 52
algae and is secreted by algal mats. We propose that the ability of V. cholerae to 53
respond to environmental mannitol by forming a biofilm may play an important role in 54
habitat selection.55
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Introduction 56
Vibrio cholerae, a halophilic, Gram-negative rod, is responsible for the millions 57
of cases of the diarrheal disease cholera that are reported annually (1). The life cycle 58
of this pathogen encompasses not only the human intestine, but also estuarine and 59
marine environments. Within these aquatic environments, V. cholerae exists either 60
in the free-swimming, planktonic state or attached to a surface in a biofilm (2, 3). 61
Three types of V. cholerae biofilms have been described. The monolayer 62
biofilm consists of a single layer of cells attached to a surface and depends on 63
motility and the mannose-sensitive hemagglutinin (4). Multilayer biofilms consist of 64
multiple layers of cells anchored to the surface by a base of surface-attached cells. 65
One type of multilayer biofilm depends on Ca2+ to mediate intercellular interactions 66
(5), while another type depends on synthesis of an extracellular matrix comprised of 67
the VPS exopolysaccharide and a number of VPS-associated proteins (4, 6-10). 68
Most of the exopolysaccharide synthesis enzymes and structural biofilm proteins are 69
encoded within a region of the V. cholerae genome known as the VPS island (8). 70
Transcription of these vps genes is tightly regulated by diverse environmental cues 71
such as quorum-sensing autoinducers, polyamines, nucleic acids, phosphate, and 72
carbohydrates (11-20). 73
Specific sugars such as glucose and mannose have recently been shown to 74
play a determining role in activation of V. cholerae biofilm formation (2, 4, 20). 75
Transport of these sugars as well as fructose, mannitol, N-acetylglucosamine, 76
sucrose, and trehalose is dependent on the phosphoenolpyruvate 77
phosphotransferase system (PTS) (21). The PTS is a conserved bacterial multi-78
component signal transduction cascade that monitors the nutritional status of the cell 79
and alters transport and phosphorylation of selected sugars and sugar derivatives in 80
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
response to these cues (22). In addition to its role in carbohydrate transport, the 81
bacterial PTS has been implicated in the regulation of a myriad of cellular functions 82
including chemotaxis (23, 24), glycogen catabolism (25, 26), detection of quorum-83
sensing molecules (27), and biofilm formation (20, 28, 29). 84
In V. cholerae, the PTS includes the two general cytoplasmic proteins Enzyme 85
I (EI) and histidine protein (HPr), the fructose-specific HPr homolog FPr, and a 86
number of sugar-specific, multi-subunit proteins that comprise the group of enzymes 87
II (EIIs) (30). EI acquires phosphate from phosphoenolpyruvate (PEP) and transfers 88
it to either HPr or FPr (Figure 1). From here, the phosphoryl group is passed to one 89
of the EIIs, which are sugar-specific and consist of the three covalently or non-90
covalently associated subunits designated as enzyme IIA (EllA), enzyme IIB (EllB), 91
and enzyme IIC (EllC). Transfer of phosphate proceeds sequentially within enzyme II 92
from IIA to IIB to the incoming sugar, which is transported across the membrane by 93
the membrane-spanning IIC domain (22, 30, 31). 94
The phosphorylation state of PTS components reflects the intracellular 95
availability of PEP and the environmental availability of PTS-specific sugars. When 96
PEP is scarce and/or PTS-specific sugars are plentiful, PTS components become 97
dephosphorylated (Figure 1A). In contrast, PTS components are phosphorylated 98
when PEP is plentiful and transported sugars are scarce (Figure 1B). Because the 99
phosphorylation state of PTS components varies with the availability of PEP and 100
environmental carbohydrates, they are ideally poised to serve as sensors of the 101
nutritional status of the cell. The PTS components then communicate this 102
information through direct interactions with other proteins (32-34). 103
We recently reported that mutation of the V. cholerae general PTS 104
components El and HPr results in an increased propensity to associate in biofilms 105
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
(20, 30). A comparison of the transcriptomes of wild-type V. cholerae and a ΔPTS 106
mutant, revealed an increase in transcription of the gene encoding the mannitol-107
specific Ell. We previously observed that transcription of the gene encoding this Ell 108
component, in particular, was induced under biofilm-activating conditions (7). 109
Therefore, we investigated the hypothesis that the mannitol-specific Ell component 110
might participate in a biofilm-regulatory signal transduction cascade. Here we 111
describe a role for mannitol and the mannitol-specific EllB component (EllBMtl) in 112
activation of V. cholerae biofilm formation.113
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Materials and Methods 114
Bacterial strains, plasmids, and media. The bacterial strains and plasmids used in 115
this study are listed in Table 1. pFLAG-CTC (Sigma-Aldrich), an expression vector 116
including an isopropyl β-D-1-thiogalactopyranoside (IPTG) inducible promoter and a 117
C-terminal FLAG tag, was used in rescue experiments. Bacteria were cultivated in 118
Luria-Bertani broth (LB) or minimal medium supplemented with mannitol at a 119
concentration of approximately 25 mM unless otherwise indicated. During growth of 120
V. cholerae in LB broth supplemented with mannitol, the pH of the medium 121
decreased from 7 to 6 after 14 hours. The pH subsequently returned to 7 over the 122
next 10 hours. During 24 hours of growth in LB broth alone, the pH of the medium 123
increased from 7 to 9. Where indicated, ampicillin (100 μg/mL) and IPTG (1 mM) 124
were added to the growth medium. A 0.1 M phosphate-buffered saline solution (PBS, 125
pH 7.0) was used to resuspend biofilm cells. 126
Construction of in-frame deletion mutants. The in-frame deletion mutants were 127
constructed as described previously (11, 20). Briefly, for the construction of the mtlA 128
deletion (ΔmtlA) and mtlR deletion (ΔmtlR) mutants, the primers listed in Table 2 129
were used to amplify genome sequences spanning an in-frame deletion in the gene 130
of interest. These DNA fragments were joined by the technique of gene splicing by 131
overlap extension (SOE), cloned into pCR2.1-TOPO, and then subcloned into the 132
suicide vector pWM91 by ligation after digestion with XhoI and SpeI. All other 133
plasmids used in the construction of in-frame deletion mutants were available in our 134
laboratory. Suicide plasmids were used to generate in-frame deletion mutants by 135
double homologous recombination. 136
RNA isolation. Wild-type V. cholerae and ΔPTS mutant strains were cultured in 10 137
static glass tubes, each filled with 2 ml of minimal medium supplemented with 0.5% 138
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
glucose (wt/wt). After 24 hrs of incubation at 27°C, planktonic cells were harvested. 139
Two mls of phosphate buffered saline (PBS) along with a small amount of 1 mm 140
glass beads (Biospec, Inc) were added to the remaining biofilm cells. These were 141
dispersed by gentle vortexing. Both biofilm and planktonic cells were pelleted by 142
centrifugation for 15 minutes at 4,000 rpm and then incubated for 5 minutes in 200 µl 143
lysosyme-TE buffer (400 µl/ ml). Total RNA was extracted with the RNeasy kit 144
(Qiagen), and remaining traces of DNA were removed by incubation with 1 µl DNase 145
I (Promega) for 15 min at 37°C. Total RNA was precipitated with ethanol and 146
resuspended in 20 µl RNase-free water. Concentration and purity were determined 147
with absorbance measurements at 260 nm and 280 nm (A260 and A280 respectively; 148
A260/A280 >1.9), as well as by agarose gel electrophoresis to verify the absence of 149
RNA degradation. 150
Microarray data acquisition and statistical analysis. DNA microarrays were 151
obtained from the Pathogen Functional Genomics Resource Center at the J Craig 152
Venter Institute (Vibrio cholerae El Tor N16961, version 2), and experimental 153
procedures were adapted from Institute protocols. Briefly, before use, microarrays 154
were prehybridized in 0.22 μm filtered buffer (5x SSC, 0.1% SDS, 1% BSA) at 42°C 155
for 1 h. They were then washed with 2 L of distilled water, rinsed with isopropyl 156
alcohol, and dried. Eight μg of total RNA purified from wild type V. cholerae or a 157
ΔPTS mutant was used as a template for reverse transcription (RT) reactions. The 158
RT reaction included 5 μg of random hexanucleotide primers (Invitrogen), 10 mM 159
DTT, 500 μM each of dATP, dCTP and dGTP, 100 μM dTTP, 400 μM 5-(3-160
aminoallyl)-dUTP (Sigma), 1x First Strand Buffer (Invitrogen), and 400 U of 161
Superscript III reverse transcriptase (Invitrogen). This reaction was allowed to 162
proceed for 2 h at 42°C. The RNA template was then hydrolyzed with 2 units of 163
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
RNase H (Amersham Pharmacia) for 15 min at 37°C. The resulting cDNA was 164
purified on a Microcon-30 microconcentrator (Amicon), ethanol-precipitated, and 165
resuspended in 9 µl of NaHCO3 (0.1M, pH 9). Labelling was performed by incubation 166
with 4.5 µl of Cy3 or Cy5 monofunctional dye (Amersham Biosciences) for 45 min at 167
room temperature. Unincorporated dye was quenched by the addition of 4.5 µl of 4 168
M hydroxylamine and removed with a QIAquick PCR purification kit (Qiagen). Two 169
differentially labelled samples (one with Cy3 and the other with Cy5) of the ΔPTS 170
mutant and the wild type strain were combined, and the mixture was ethanol-171
precipitated. Labelled cDNAs were then resuspended in 30 µl of hybridization buffer 172
(21% formamide, 0.2% SDS, 1x Denhardt’s, 7x SSPE) and heated for 2 min at 173
100°C before being applied to the microarray. 174
DNA microarrays were incubated in hybridization chambers (Corning) at 42°C for 175
18–20 h and then washed to remove non-specific hybridization (once with 2x SSC, 176
0.1% SDS for 5 min, twice with 0.1x SSC, 0.1% SDS for 6 min, twice with 0.1x SSC 177
for 5 min). For each microarray experiment, four independent experimental 178
replicates were performed of which the Cy dyes were swapped in two to control for 179
incorporation bias. Hybridized arrays were immediately scanned using a GenePixTM 180
4000B scanner (Axon Instruments). Image analysis was performed using 181
GenePixTM Pro 4.0. For each spot, the local background fluorescence was 182
subtracted. The signals were analyzed with GENESPRING 5.0.1. (Silicon Genetics), 183
using the global normalization LOWESS method. The final ratio of Cy5/Cy3 intensity 184
was calculated as a mean of the ratio for each spot of the replicated dye swaps. 185
Microarray data have been deposited in the GEO data base (Accession number 186
GSE42674). 187
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Ectopic protein expression. The protocol for protein expression has been 188
previously described (6). Briefly, the ORFs or protein domains of interest were 189
amplified by PCR. For cloning into pFLAG-CTC, NdeI and EcoRI restriction sites 190
were included in the PCR primer pairs. The PCR products were then digested and 191
ligated into the expression vector. The ligation products were transformed into E. coli 192
TOP10 competent cells and selected on LB agar plates supplemented with 193
ampicillin. The presence of the correct insert was confirmed by colony PCR and 194
sequence analysis. Confirmed plasmids were electroporated into V. cholerae. 195
Quantitative analysis of total growth and biofilm formation. Quantification of 196
total growth and biofilm formation in culture tubes was performed as described 197
previously (2). The strains were grown overnight on LB agar plates at 27ºC. To set 198
up biofilm cultures, the resulting colonies were used to inoculate borosilicate tubes 199
filled with 300 μL of LB broth alone or supplemented with mannitol. After incubation 200
for 18 to 24 h at 27 ºC, each planktonic cell suspension was collected, and the 201
planktonic cell density was determined by measuring the optical density at 655 nm 202
(OD655) using a Benchmark Plus microplate spectrophotometer (Bio-Rad). To 203
quantify the surface-attached cells, 300 μL of PBS and a small volume of 1-mm 204
glass beads (Biospec, Inc) were added to the surface-attached cells remaining in the 205
borosilicate tube, and the cells were dispersed by vortexing. The OD655 of the 206
resulting cell suspension was measured. This measurement technique was found to 207
be linearly correlated with the total amount of protein in these biofilm samples, 208
suggesting that it accurately reflects the number of cells in the biofilm (data not 209
shown). The reported total growth was calculated from the sum of the OD655 210
measured for planktonic and surface-associated cell suspensions. All values are the 211
means of at least three experimental replicates. Error bars represent the standard 212
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
deviation, and statistical significance was calculated using a two-tailed t test. 213
Differences were considered significant if the p value was less than 0.05. 214
Measurement of vpsL transcription using β-galactosidase assays. Strains were 215
grown overnight on LB agar plates at 27ºC. The following morning, several bacterial 216
colonies were resuspended in LB broth to obtain an initial OD655 of approximately 217
0.05. Cultures were then incubated at 27ºC with shaking until the OD655 reached 218
approximately 1.5. The OD655 of each culture was recorded. One milliliter of each 219
culture was moved into a microcentrifuge eppendorf tube, centrifuged gently to avoid 220
cell lysis, and resuspended in 200 μL of Z-buffer (0.06 M Na2HPO4 7H2O, 0.04 M 221
NaH2PO4 H2O, 0.01 M KCl, and 0.001 M MgSO4, pH 7.0). Three freeze-thaw cycles 222
were performed, and 17 μL of 4 mg/mL ortho-nitrophenyl-β-galactoside (ONPG) 223
were added to each tube. The tubes were then incubated at room temperature until 224
the first tube turned yellow. All tubes were immediately centrifuged to remove 225
cellular debris, 100 µl of each supernatant was moved into a 96-well plate (Nunc), 226
and the OD420 of each well was measured using a Benchmark Plus microplate 227
spectrophotometer (Bio-Rad). We did not find it necessary to stop the reactions by 228
adding bicarbonate because an insignificant amount of color was generated during 229
rapid processing of the samples. β-galactosidase measurements were normalized 230
by dividing by the final OD655 of the respective culture. Because all samples were 231
harvested at the same time, there was no need to normalize with respect to the 232
length of time the reactions were allowed to proceed. Three experimental replicates 233
were performed each time, and every experiment was repeated multiple times. Error 234
bars represent the standard deviation, and statistical significance was calculated 235
using a two-tailed t test. Measurements were considered significant if the p value 236
was less than 0.05. 237
238
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Results 239
Transcriptomic analysis of gene expression in a ΔPTS mutant. We previously 240
demonstrated that, in minimal medium supplemented with glucose, biofilm formation 241
by a ΔPTS mutant, lacking the operon encoding EI (VC0965), HPr (VC0966), and 242
EIIAGlc (VC0964), is increased (20). To describe differences in gene regulation 243
between this mutant and wild-type V. cholerae in both the planktonic and biofilm 244
states, we used microarray analysis (Tables S1 and S2). As compared with the wild-245
type biofilm, five hundred and sixty-three genes were differentially regulated in the 246
ΔPTS biofilm. However, only 218 genes were differentially regulated in the 247
corresponding planktonic experiment. We hypothesize that genes selectively 248
differentially regulated in the biofilm or oppositely regulated in biofilm and planktonic 249
cells reflect the bacterial response to the larger biofilm structure of the ΔPTS mutant. 250
Table 3 lists genes that were significantly differentially regulated in planktonic wild-251
type V. cholerae and ΔPTS mutant cells by 3-fold or more and similarly regulated in 252
the biofilm. The majority of these genes were predicted or known to participate in 253
transport or metabolism of carbohydrates either directly or through regulation of 254
these processes. Furthermore, the most highly differentially regulated genes were 255
Ell components of the PTS. In particular, VC1826 encoding the IIABC mannose 256
permease (EIIMan), mtlA (VCA1045) encoding the IIABC mannitol-specific transporter 257
(EIIMtl) (21, 38), and VC1820 and 1821 encoding hypothetical EllA and EllBC 258
components, respectively, were the most highly induced PTS components in both 259
biofilm and planktonic cells. These genes were also previously found to be 260
transcriptionally activated by the addition of PTS sugars, a condition that increases 261
transcription of biofilm genes (7). We hypothesize that mutation of general PTS 262
components results in a physiological state similar to that found when PTS sugars 263
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
are abundant and increased transport of PTS sugars prevents accumulation of 264
phosphate on the downstream Ell PTS components. Because activation of biofilm 265
formation by mannitol has interesting environmental implications for V. cholerae, we 266
investigated the effect of mannitol and EllMtl on V. cholerae biofilm formation. 267
Mannitol increases VPS-dependent biofilm formation. We hypothesized that 268
mannitol might activate biofilm formation. Therefore, we measured biofilm formation 269
by wild-type V. cholerae in the presence of mannitol. As shown in Figures 2A and B, 270
medium supplementation with this sugar increased surface association but did not 271
increase total growth, suggesting that the increase in biofilm formation is 272
independent of bacterial replication. This surface-associated structure was 273
dependent on the vps genes (Figure 2C). Therefore, we conclude that mannitol 274
increases VPS exopolysaccharide-dependent biofilm formation when added to LB 275
broth. 276
Micromolar concentrations of mannitol activate biofilm formation. Mannitol 277
concentrations as high as 700 µM have been found in marine environments (39). To 278
determine if concentrations of mannitol in this range activate V. cholerae biofilm 279
formation, we performed a titration experiment. As shown in Figure 3, V. cholerae 280
formed an increased biofilm in response to levels of mannitol as low as 400 µM. 281
Mannitol-specific Ell is required for activation of V. cholerae biofilm formation 282
in the presence of mannitol. We questioned whether EllMtl might affect biofilm 283
formation by wild-type V. cholerae and PTS mutants. As shown in Figure 4A and B, 284
deletion of mtlA in V. cholerae cultured in LB broth supplemented with mannitol 285
decreased biofilm formation to levels observed in LB broth alone (Figure 4). 286
Furthermore, the increase in biofilm accumulation resulting from deletion of the 287
general PTS component HPr did not require mannitol or EllMtl. MtlR has been shown 288
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
to repress E. coli EllMtl by an unknown mechanism (40). We hypothesized that 289
deletion of mtlR might affect biofilm formation indirectly through an effect on EllMtl, 290
but this had no effect on biofilm formation either in the presence or absence of 291
mannitol (Figure 4). 292
Only the EIIBMtl subunit is required for activation of biofilm formation. 293
Expression of MtlA is observed only in the presence of mannitol due to post-294
transcriptional inhibition by the small RNA mtlS (41). We reasoned that we could 295
assess the role of EllMtl in biofilm formation independently of the presence of 296
mannitol by ectopically expressing EllMtl subdomains in wild-type V. cholerae cultured 297
in LB broth alone. To test this hypothesis, we measured biofilm formation by wild-298
type cells transformed with a control plasmid or plasmids encoding the IIA domain of 299
EIIMtl (EIIAMtl), the IIB domain of EIIMtl (EIIBMtl), or MtlR. As controls, we tested the 300
effect on biofilm formation of expression of VC1281, which is an EllB component 301
involved in cellobiose transport (42), and VC1821, which contains fused Ell B and C 302
components of unknown function, and confirmed adequate expression of all 303
ectopically produced proteins by Western analysis. As shown in Figure 5, despite 304
adequate expression of all constructs, only EIIBMtl activated biofilm formation in the 305
absence of exogenous mannitol. These results suggest that the EllBMtl domain 306
mediates increased biofilm accumulation even in the absence of mannitol transport. 307
Furthermore, they suggest that MtlR does not play a role in regulation of biofilm 308
formation by mannitol and EllBMtl. 309
Evidence that only the unphosphorylated form of EIIBMtl regulates biofilm 310
accumulation. Transport of D-mannitol by the V. cholerae PTS requires transfer of 311
the phosphoryl group from the intermediate phosphocarrier protein HPr to EllA and 312
EllB, the cytoplasmic subunits of EIIMtl. Regulatory functions of PTS intermediates 313
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
are often coupled to their phosphorylation state. To determine if activation of biofilm 314
formation by EIIBMtl was dependent on its phosphorylation state, we engineered and 315
expressed wild-type EllABMtl as well as the following point mutants: EIIAMtlH564A or 316
EIIABMtlH564A, in which the phosphorylated histidine of EllAMtl is mutated to an 317
alanine, and EIIBMtlC389S or EIIABMtlC389S, in which the phosphorylated cysteine of 318
EllBMtl is mutated to a serine. Each of these mutations prevents phosphorylation of 319
EllBMtl. As shown in Figure 6, EllBMtl and EIIBMtlC389S, which cannot be 320
phosphorylated, induced biofilm formation to similar degrees when overexpressed in 321
either wild-type V. cholerae or a ΔmtlA mutant, but overexpression of wild-type 322
EllABMtl had no effect on biofilm formation. Overexpression of EIIABMtlC389S and 323
EIIABMtlH564A, which are also unphosphorylatable, activated biofilm formation, albeit 324
not to the extent observed for EllBMtl. We hypothesize that these mutants may be 325
less active than the wild-type protein. Furthermore, poor expression or degradation 326
of EIIABMtlC389S may lessen the phenotype induced by this mutant. Taken together, 327
our observations suggest that the unphosphorylated form of EIIBMtl activates biofilm 328
formation. 329
Mannitol and EIIBMtl regulate biofilm formation at the level of transcription. We 330
have shown that EllBMtl activates biofilm formation. To determine whether this 331
occurs at the transcriptional level, we measured β-galactosidase activity in reporter 332
strains carrying a vpsL-lacZ fusion at a neutral site on the chromosome. As shown 333
in Figure 7A, mannitol transport increased vps gene transcription approximately 8-334
fold. Furthermore, in LB broth, overexpression of EllBMtl increased vps gene 335
transcription approximately 6-fold in both wild-type V. cholerae and a ΔmtlA mutant 336
(Figure 7B and C). These results suggest that EllBMtl activates biofilm formation at 337
the transcriptional level. 338
339
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Discussion 340
Because transcription of mtlA, the gene encoding the mannitol-specific 341
enzyme ll, is greatly induced under conditions that favor biofilm formation (7), we 342
hypothesized that mannitol and EllMtl might activate biofilm formation. Here we show 343
that mannitol activates VPS-dependent V. cholerae biofilm formation at the 344
transcriptional level. Concentrations of mannitol as low as 400 µM are sufficient to 345
impact biofilm formation. Furthermore, our studies support a model in which the 346
unphosphorylated form of EllBMtl activates biofilm formation independently of its role 347
in mannitol transport. 348
Transcriptional regulation through interactions with other proteins is a 349
common theme for EllB components of the PTS (43). The glucose-specific EllBC of 350
Escherichia coli blocks the function of the transcription factor Mlc by sequestering it 351
to the membrane (44). Bacillus subtilis MtlR activates mtlA transcription by binding 352
to its promoter (45). Recently, investigators have shown that the unphosphorylated 353
form of the Bacillus subtilis EllBMtl interacts with the C-terminus of MtlR, sequestering 354
it to the membrane (46). This, in turn, potentiates MtlR, leading to increased 355
transcription of EllMtl. The MtlR protein of B. subtilis is not homologous to that of V. 356
cholerae. Unlike the B. subtilis MtlR, the Vibrio MtlR is not believed to function as a 357
classical transcription factor by binding DNA (47). Furthermore, the data presented 358
here suggest that it does not regulate biofilm formation in a manner parallel to that of 359
EllBMtl. Therefore, we hypothesize that EllBMtl interacts with an activator of biofilm 360
formation other than MtlR to increase surface attachment. We have initiated 361
experiments to isolate such an interaction partner. 362
In the high osmolarity environments such as estuaries and oceans where V. 363
cholerae is found, plants, algae, fungi, and bacteria use mannitol as a compatible 364
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
solute and osmoprotectant (48). Mannitol is also the main product of photosynthesis 365
by brown algae, and the concentration of mannitol directly above algal mats has 366
been shown to reach levels as high as 700 µM (39, 48). Beyond its association with 367
chitinaceous surfaces, very little is known about the natural habitats of V. cholerae in 368
marine environments. Based on the findings reported here, we propose that 369
mannitol released from marine organisms such as those in algal mats could activate 370
transcription of the vps genes, thus inducing V. cholerae to colonize these 371
environments. A scenario in which mannitol might activate V. cholerae biofilm 372
formation in the marine environment is depicted in Figure 8. Because V. cholerae 373
can transport and utilize mannitol as a carbon source and possibly also as a 374
compatible solute, this regulatory adaptation could provide V. cholerae with a 375
nutritional and osmoadaptive fitness advantage in the marine environment.376
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Acknowledgements 377
This work was supported by NIH AI050032 to P.I.W. Microarrays were obtained 378
from the Pathogen Functional Genomics Resource Center through a grant from 379
NIH/NIAID. 380
381
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
References 382
1. Weil AA, Ivers LC, Harris JB. 2012. Cholera: lessons from haiti and beyond. 383
Curr Infect Dis Rep 14:1-8. 384
2. Kierek K, Watnick PI. 2003. Environmental Determinants of Vibrio cholerae 385
Biofilm Development. Appl Environ Microbiol 69:5079-5088. 386
3. Reidl J, Klose KE. 2002. Vibrio cholerae and cholera: out of the water and 387
into the host. FEMS Microbiol Rev 26:125-139. 388
4. Moorthy S, Watnick PI. 2004. Genetic evidence that the Vibrio cholerae 389
monolayer is a distinct stage in biofilm development. Mol Microbiol 52:573-390
587. 391
5. Kierek K, Watnick PI. 2003. The Vibrio cholerae O139 O-antigen 392
polysaccharide is essential for Ca2+-dependent biofilm development in sea 393
water. Proc Natl Acad Sci U S A ;100:14357-14362. 394
6. Absalon C, Van Dellen K, Watnick PI. 2011. A communal bacterial adhesin 395
anchors biofilm and bystander cells to surfaces. PLoS Pathog 7:e1002210. 396
7. Moorthy S, Watnick PI. 2005. Identification of novel stage-specific genetic 397
requirements through whole genome transcription profiling of Vibrio cholerae 398
biofilm development. Mol Microbiol 57:1623-1635. 399
8. Yildiz FH, Schoolnik GK. 1999. Vibrio cholerae O1 El Tor: Identification of a 400
gene cluster required for the rugose colony type, exopolysaccharide 401
production, chlorine resistance, and biofilm formation. Proc. Natl. Acad. Sci. 402
USA 96:4028-4033. 403
9. Fong JC, Yildiz FH. 2007. The rbmBCDEF gene cluster modulates 404
development of rugose colony morphology and biofilm formation in Vibrio 405
cholerae. J Bacteriol 189:2319-2330. 406
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
10. Fong JC, Karplus K, Schoolnik GK, Yildiz FH. 2006. Identification and 407
characterization of RbmA, a novel protein required for the development of 408
rugose colony morphology and biofilm structure in Vibrio cholerae. J Bacteriol 409
188:1049-1059. 410
11. Haugo AJ, Watnick PI. 2002. Vibrio cholerae CytR is a repressor of biofilm 411
development. Mol Microbiol 45:471-483. 412
12. Sultan SZ, Silva AJ, Benitez JA. 2010. The PhoB regulatory system 413
modulates biofilm formation and stress response in El Tor biotype Vibrio 414
cholerae. FEMS Microbiol Lett 302:22-31. 415
13. Pratt JT, McDonough E, Camilli A. 2009. PhoB regulates motility, biofilms, 416
and cyclic di-GMP in Vibrio cholerae. J Bacteriol 191:6632-6642. 417
14. Mudrak B, Tamayo R. 2012. The Vibrio cholerae Pst2 phosphate transport 418
system is upregulated in biofilms and contributes to biofilm-induced 419
hyperinfectivity. Infect Immun 80:1794-1802. 420
15. Zhu J, Mekalanos JJ. 2003. Quorum sensing-dependent biofilms enhance 421
colonization in Vibrio cholerae. Dev Cell 5:647-656. 422
16. Mueller RS, Beyhan S, Saini SG, Yildiz FH, Bartlett DH. 2009. Indole acts 423
as an extracellular cue regulating gene expression in Vibrio cholerae. J 424
Bacteriol 191:3504-3516. 425
17. Seper A, Fengler VH, Roier S, Wolinski H, Kohlwein SD, Bishop AL, 426
Camilli A, Reidl J, Schild S. 2011. Extracellular nucleases and extracellular 427
DNA play important roles in Vibrio cholerae biofilm formation. Mol Microbiol 428
82:1015-1037. 429
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
18. McGinnis MW, Parker ZM, Walter NE, Rutkovsky AC, Cartaya-Marin C, 430
Karatan E. 2009. Spermidine regulates Vibrio cholerae biofilm formation via 431
transport and signaling pathways. FEMS Microbiol Lett. 432
19. Karatan E, Duncan TR, Watnick PI. 2005. NspS, a predicted polyamine 433
sensor, mediates activation of Vibrio cholerae biofilm formation by 434
norspermidine. J Bacteriol 187:7434-7443. 435
20. Houot L, Watnick PI. 2008. A novel role for enzyme I of the Vibrio cholerae 436
phosphoenolpyruvate phosphotransferase system in regulation of growth in a 437
biofilm. J Bacteriol 190:311-320. 438
21. Houot L, Chang S, Absalon C, Watnick PI. 2010. Vibrio cholerae 439
phosphoenolpyruvate phosphotransferase system control of carbohydrate 440
transport, biofilm formation, and colonization of the germfree mouse intestine. 441
Infect Immun 78:1482-1494. 442
22. Deutscher J, Francke C, Postma PW. 2006. How phosphotransferase 443
system-related protein phosphorylation regulates carbohydrate metabolism in 444
bacteria. Microbiol Mol Biol Rev 70:939-1031. 445
23. Titgemeyer F. 1993. Signal transduction in chemotaxis mediated by the 446
bacterial phosphotransferase system. J Cell Biochem 51:69-74. 447
24. Lux R, Jahreis K, Bettenbrock K, Parkinson JS, Lengeler JW. 1995. 448
Coupling the phosphotransferase system and the methyl-accepting 449
chemotaxis protein-dependent chemotaxis signaling pathways of Escherichia 450
coli. Proc Natl Acad Sci U S A 92:11583-11587. 451
25. Seok YJ, Sondej M, Badawi P, Lewis MS, Briggs MC, Jaffe H, 452
Peterkofsky A. 1997. High affinity binding and allosteric regulation of 453
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Escherichia coli glycogen phosphorylase by the histidine phosphocarrier 454
protein, HPr. J Biol Chem 272:26511-26521. 455
26. Seok YJ, Koo BM, Sondej M, Peterkofsky A. 2001. Regulation of 456
Escherichia. coli glycogen phosphorylase activity by HPr. J Mol Microbiol 457
Biotechnol 3:385-393. 458
27. Pereira CS, Santos AJ, Bejerano-Sagie M, Correia PB, Marques JC, 459
Xavier KB. 2012. Phosphoenolpyruvate phosphotransferase system 460
regulates detection and processing of the quorum sensing signal autoinducer-461
2. Mol Microbiol 84:93-104. 462
28. Loo CY, Mitrakul K, Voss IB, Hughes CV, Ganeshkumar N. 2003. 463
Involvement of an inducible fructose phosphotransferase operon in 464
Streptococcus gordonii biofilm formation. J Bacteriol 185:6241-6254. 465
29. Abranches J, Candella MM, Wen ZT, Baker HV, Burne RA. 2006. Different 466
roles of EIIABMan and EIIGlc in regulation of energy metabolism, biofilm 467
development, and competence in Streptococcus mutans. J Bacteriol 468
188:3748-3756. 469
30. Houot L, Chang S, Pickering BS, Absalon C, Watnick PI. 2010. The 470
phosphoenolpyruvate phosphotransferase system regulates Vibrio cholerae 471
biofilm formation through multiple independent pathways. J Bacteriol 472
192:3055-3067. 473
31. Barabote RD, Saier MH, Jr. 2005. Comparative genomic analyses of the 474
bacterial phosphotransferase system. Microbiol Mol Biol Rev 69:608-634. 475
32. Pickering BS, Smith DR, Watnick PI. 2012. Glucose-specific enzyme IIA 476
has unique binding partners in the Vibrio cholerae biofilm. MBio 3:e00228-12. 477
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
33. Lengeler JW, Jahreis K. 2009. Bacterial PEP-dependent carbohydrate: 478
phosphotransferase systems couple sensing and global control mechanisms. 479
Contrib Microbiol 16:65-87. 480
34. Wang G, Sondej M, Garrett DS, Peterkofsky A, Clore GM. 2000. A 481
common interface on histidine-containing phosphocarrier protein for 482
interaction with its partner proteins. J Biol Chem 275:16401-16403. 483
35. Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use in 484
construction of insertion mutations: osmoregulation of outer membrane 485
proteins and virulence determinants in Vibrio cholerae requires toxR. J 486
Bacteriol 170:2575-2583. 487
36. Waldor MK, Mekalanos JJ. 1994. Emergence of a new cholera pandemic: 488
molecular analysis of virulence determinants in Vibrio cholerae O139 and 489
development of a live vaccine prototype. J Infect Dis 170:278-283. 490
37. Metcalf WW, Jiang W, Daniels LL, Kim SK, Haldimann A, Wanner BL. 491
1996. Conditionally replicative and conjugative plasmids carrying lacZ a for 492
cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1-13. 493
38. Kumar S, Smith KP, Floyd JL, Varela MF. 2011. Cloning and molecular 494
analysis of a mannitol operon of phosphoenolpyruvate-dependent 495
phosphotransferase (PTS) type from Vibrio cholerae O395. Arch Microbiol 496
193:201-208. 497
39. Krug PJ, Zimmer RK. 2000. Larval settlement: chemical markers for tracing 498
production, transport, and distribution of a waterborne cue. Marine Ecology 499
Progress Series 207:283-296. 500
40. Figge RM, Ramseier TM, Saier MH, Jr. 1994. The mannitol repressor (MtlR) 501
of Escherichia coli. J Bacteriol 176:840-847. 502
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
41. Mustachio LM, Aksit S, Mistry RH, Scheffler R, Yamada A, Liu JM. 2012. 503
The Vibrio cholerae mannitol transporter is regulated posttranscriptionally by 504
the MtlS small regulatory RNA. J Bacteriol 194:598-606. 505
42. Berg T, Schild S, Reidl J. 2007. Regulation of the chitobiose-506
phosphotransferase system in Vibrio cholerae. Arch Microbiol 187:433-439. 507
43. Joyet P, Bouraoui H, Ake FM, Derkaoui M, Zebre AC, Cao TN, Ventroux 508
M, Nessler S, Noirot-Gros MF, Deutscher J, Milohanic E. 2013. 509
Transcription regulators controlled by interaction with enzyme IIB components 510
of the phosphoenolpyruvate:sugar phosphotransferase system. Biochim 511
Biophys Acta. 512
44. Nam TW, Jung HI, An YJ, Park YH, Lee SH, Seok YJ, Cha SS. 2008. 513
Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc 514
inactivation by membrane sequestration. Proc Natl Acad Sci U S A 105:3751-515
3756. 516
45. Joyet P, Derkaoui M, Poncet S, Deutscher J. 2010. Control of Bacillus 517
subtilis mtl operon expression by complex phosphorylation-dependent 518
regulation of the transcriptional activator MtlR. Mol Microbiol 76:1279-1294. 519
46. Bouraoui H, Ventroux M, Noirot-Gros MF, Deutscher J, Joyet P. 2013. 520
Membrane sequestration by the EIIB domain of the mannitol permease MtlA 521
activates the Bacillus subtilis mtl operon regulator MtlR. Mol Microbiol 87:789-522
801. 523
47. Tan K, Clancy S, Borovilos M, Zhou M, Horer S, Moy S, Volkart LL, 524
Sassoon J, Baumann U, Joachimiak A. 2009. The mannitol operon 525
repressor MtlR belongs to a new class of transcription regulators in bacteria. J 526
Biol Chem 284:36670-36679. 527
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
48. Iwamoto K, Shiraiwa Y. 2005. Salt-regulated mannitol metabolism in algae. 528
Mar Biotechnol (NY) 7:407-415. 529
530
531
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Figure Legends 532
Figure 1: Schematic view of the phosphorylation state of PTS components. (A) 533
when PTS sugars are abundant, and (B) when PTS sugars are scarce. Bold font is 534
used for species that are more abundant under the specified conditions. 535
Figure 2. Mannitol activates VPS-dependent biofilm formation. (A) Biofilm 536
formation or (B) total growth of wild-type V. cholerae in LB broth alone or 537
supplemented with 0.5% mannitol. * indicates measurements that are significantly 538
different from LB alone. (C) Comparison of biofilm formation by wild-type V. cholerae 539
and a ΔvpsA mutant in LB alone or supplemented with mannitol. Differences in 540
biofilm accumulation between wild-type V. cholerae and the ΔvpsA mutant are 541
significantly different. 542
Figure 3: Mannitol activates biofilm formation at concentrations as low as 430 543
µM. Measurements of biofilm formation by wild-type V. cholerae in LB broth 544
supplemented with various concentrations of mannitol. * indicates measurements 545
that are significantly different from biofilm formation in LB broth alone. 546
Figure 4: Activation of wild-type V. cholerae biofilm formation by mannitol is 547
dependent on mtlA. (A) Photographs of biofilms formed by wild-type V. cholerae 548
(WT) as well as ΔmtlA, ΔmtlR, and ΔHPr mutants in LB broth alone (-) or LB broth 549
supplemented with mannitol (+). Biofilm accumulation (grey bars) and total growth 550
(black bars) in (B) LB broth (-MTL) alone or (C) LB broth supplemented with mannitol 551
(+ MTL) for wild-type V. cholerae (WT) and the indicated mutants. * indicates 552
measurements that are significantly different from that of wild-type V. cholerae. 553
Figure 5. The EllBMtl domain of EllMtl regulates biofilm formation independently 554
of mannitol transport. (A) Measurements of biofilm accumulation in LB broth by 555
wild-type V. cholerae transformed with either an empty vector (pCTL) or the 556
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
corresponding vector expressing the A domain of EIIMtl (pEIIAMtl), the B domain of 557
EIIMtl (pEIIBMtl), a wild-type MtlR allele (pMtlR), a wild-type VC1281 allele (pVC1281), 558
and a wild-type VC1821 allele (pVC1821). Protein expression was induced by 559
addition of 1mM IPTG. * indicate measurements that are significantly different from 560
that of wild-type V. cholerae. (B) Western analysis to document expression of the 561
indicated FLAG-tagged proteins by V. cholerae. 562
Figure 6: Evidence that EllBMtl in its unphosphorylated form activates biofilm 563
formation. Biofilm accumulation and total growth were determined for either (A) 564
wild-type V. cholerae or (B) a ΔmtlA mutant transformed with an empty pFLAG-CTC 565
vector (pCTL), a pFLAG plasmid encoding the A domain of EIIMtl (pEIIAMtl); a plasmid 566
expressing EIIAMtlH564A, in which the phosphorylated histidine is mutated to alanine; a 567
plasmid encoding the B domain of EIIMtl (pEIIBMtl); a plasmid encoding EIIBMtlC389S, in 568
which the phosphorylated cysteine is mutated to a serine; a plasmid encoding both 569
the B and the A domains of EIIMtl (pEIIBAMtl); a plasmid encoding EIIBAMtlH564A; or a 570
plasmid encoding EIIBAMtlC389S. Protein expression was induced by addition of 1mM 571
IPTG. The values are the average of three experimental replicates. * indicate 572
measurements that are significantly different from that of wild-type V. cholerae. (C) 573
Assessment of expression of the indicated constructs in wild-type V. cholerae by 574
Western analysis. 575
Figure 7. Mannitol and EllBMtl regulate biofilm formation at the transcriptional 576
level. (A) β-galactosidase activity exhibited by a control V. cholerae strain (WT) 577
carrying a chromosomal vps-lacZ fusion cultured in LB broth alone or supplemented 578
with 0.1 % mannitol. (B) β-galactosidase activity exhibited by a control V. cholerae 579
strain (WT) and ΔHPr and ΔmtlA mutants cultured in LB broth. β-galactosidase 580
activity was measured for either (C) wild-type V. cholerae (WT) or (D) a ΔmtlA 581
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
mutant. Both strains were transformed with either an empty vector (pCTL) or a 582
plasmid encoding the A domain of EIIMtl (pEIIAMtl), the B domain of EIIMtl (pEIIBMtl), or 583
the AB domain of EIIMtl (pEIIABMtl). β-galactosidase activity was monitored by 584
addition of ortho-nitrophenyl-β-galactoside (ONPG) in Z-buffer. The values are the 585
average ratio OD420/OD600 for three experimental replicates. Measurements in A-D 586
were collected concurrently as part of one experiment but are separated for clarity. * 587
indicate measurements that are significantly different from that of wild-type V. 588
cholerae. 589
Figure 8: Model for the interaction of V. cholerae with brown algae in the 590
marine environment. (A) Planktonic bacteria in the absence of algae. (B) Secretion 591
of mannitol (Mtl) by algal mats activates the vps genes resulting in biofilm formation 592
by V. cholerae on these surfaces. Grey structures represent an algal mat. The 593
thickness of the bacterial outline corresponds to the amount of VPS 594
exopolysaccharide produced. 595
596
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 1. Bacterial strains and plasmids 597
E. coli strain Genotype or description Source or reference
E. coli SM10λpir
thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu (λpirR6K) Kmr
(35)
V. cholerae strains PW249 MO10 (36) PW357 MO10 lacZ::vpsLplacZ; Smr (11) PW396 MO10 ΔvpsA (4) PW961 MO10 lacZ::vpsLplacZ ΔEI; Smr (20) PW964 MO10 lacZ::vpsLplacZ ΔHPr; Smr (20) PW954 MO10 lacZ::vpsLplacZ ΔFPr; Smr (21) PW1352 MO10 lacZ::vpsLplacZ ΔmtlA; Smr This study PW1353 MO10 lacZ::vpsLplacZ ΔHPrΔEIIMtl; Smr This study PW1356 MO10 lacZ::vpsLplacZ ΔmtlR; Smr This study Plasmids for construction of deletions pWM91 oriR6K mobRP4 lacI pTac tnp mini-Tn10; Kmr Apr (37) pWM91::ΔEIIMTL pWM91 carrying an unmarked, in-frame deletion in
VCA1045 (mtlA); Apr This study
pWM91::ΔMtlR pWM91 carrying an unmarked, in-frame deletion in VCA1047 (mtlR); Apr
This study
Plasmids used in complementation experiments pEIIMtl-FLAG pFLAG-CTC carrying the coding sequence of VCA1045 This study pEIIAMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding
positions 507 to 649 This study
pEIIAMtlH564A-FLAG
pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 507 to 649 with an H-to-A mutation at position 564
This study
pEIIBMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding positions 380 to 470
This study
pEIIBMtlC389S -FLAG
pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 380-470 with a C-to-S mutation at position 389
This study
pEIIBAMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding positions 345 to 649
This study
pEIIBAMtlH564A-FLAG
pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 345 to 649 with an H-to-A mutation at position 564
This study
pEIIBAMtlC389S-FLAG
pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 345 to 649 with a C-to-S mutation at position 389
This study
pMtlR-FLAG pFLAG-CTC carrying the coding sequence of VCA1047 This study 598 599
600
601
602
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 2. Primers used 603 Primers used in gene deletions
ΔmtlA GTGTAGGTCTTCCTACTTACGTAT TAACGAGCGGCCGCACATCGCGTCCCCCGTTGG TGCGGCCGCTCGTTATAACGTTTTTGCTCCTGAGGC CCGCGCACCATATTCTCA ΔmtlR CTGTGTGACGGCTTATCTGGG TAACGAGCGGCCGCACATTTTAAGACTACCGATAACCGC TGCGGCCGCTCGTTATAACGTTTAGGTGCACGC AGCGCCCCACACTCTTGTTG Primers used in complementation constructs EIIAMtl CGACCGCATATGCAAAAGGAGAACATTC CTGCAAGAATTCTGCCGCTTGGCTGGEIIAMtlH654A GTACCGGCCGGTACTGTG CACAGTACCGGCCGGTAC EIIBMtl CGACCGCATATGGGCGATAAAGACGCG CTGCAAGAATTCAAGTTGAGTCACTAACTG EIIBMtlC389S GTCGCTAGTGATGCGGGT ACCCGCATCACTAGCGACEIIBAMtl CGACCGCATATGGGCGATAAAGACGCG CTGCAAGAATTCTGCCGCTTGGCTGGTGGC VC1281 CGACCGCATATGAAAAAGATCCTACTC CTGCAAGAATTCGTTAATTAAATCTAAAGC VC1821 CGACCGCATATGGACGAAATCGC CTGCAAGAATTCAGCTTGGATAAGTTC MtlR CGACCGCATATGTCGAGAGCTGTC CTGCAAGAATTCAAACGGGCTGTC
604
605
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 3: Genes differentially regulated in ΔPTS mutant cells 606 in both the planktonic and biofilm states (p < 0.05). 607
608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630
*denotes genes that are PTS components or are in operons with PTS components. 631 632
633
634
Locus Putative or proven function Fold change (ΔPTS/WT)
Biofilm Planktonic Transport and binding proteins *VC1826 Mannose-specific EIIABC 16.65 16.11 *VC1820 Fructose-specific EIIA 13.70 4.83 *VCA1045 Mannitol-specific EIIABC 12.59 6.75 *VC1821 Fructose-specific EIIBC 12.32 8.78 VCA0943 Maltose ABC transporter,
permease 2.47 3.73 Energy Metabolism *VCA1046 Mannitol-1-phosphate 5-
dehydrogenase 14.30 3.34 *VC1827 Mannose-6-phosphate isomerase 13.36 6.41 Regulatory Function *VC1825 Transcriptional regulator 4.95 9.86 VC0606 Nitrogen regulatory protein P-II 0.08 0.30 Other functions VC1742 Hypothetical 0.45 0.23 VC2720 Conserved hypothetical 0.42 0.24
on January 12, 2019 by guesthttp://aem
.asm.org/
Dow
nloaded from