150

http://journals.tubitak.gov.tr/biology/

Turkish Journal of Biology Turk J Biol(2016) 40: 150-159© TÜBİTAKdoi:10.3906/biy-1502-12

Control of Tomato yellow leaf curl virus disease by Enterobacter asburiaeBQ9 as a result of priming plant resistance in tomatoes

Hongwei LI1,2,*, Xueling DING1,3,*, Chao WANG1,2, Hongjiao KE1,2, Zhou WU1,2,Yunpeng WANG4, Hongxia LIU1,2,**, Jianhua GUO1,2

1Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Nanjing, P.R. China2Key Laboratory of Integrated Pest Management in Crops in Eastern China (Nanjing Agricultural University), Ministry of Agriculture,

Nanjing, P.R. China 3Institute of Plant Protection, Fujian Academy of Agricultural Science, Fuzhou, P.R. China

4College of Life Science and Chemical Engineering, Huaiyin Institute of Technology, Huai’an, P.R. China

1. IntroductionTomato yellow leaf curl virus (TYLCV) disease is one of the most devastating viral diseases in tomato plants (Solanum lycopersicum L.) across the globe (Hanssen et al., 2010). This emerging disease is caused by isolates of several single-stranded DNA-containing geminiviruses (family Geminiviridae) in the genus Begomovirus and is transmitted by the whitefly Bemisia tabaci [Gennadius (Hemiptera, Aleyrodidae)] in a persistent circulative manner (Czosnek and Ghanim, 2005). All TYLCV-associated begomoviruses induced stunted growth, yellowing, and the upward curling of the leaves on infected tomato plants. Tomato fruits are symptomless, although they are sometimes smaller than usual; if infection occurs at an early growth stage, flower abortion can result in total yield loss (Picó et al., 1996).

Controlling TYLCV is difficult and is mainly based on intensive insecticide treatments that are used to control the vector populations (Palumbo et al., 2001). However, this method is harmful to the environment (Navot et

al., 1991) and has limited success because it selects for insecticide-resistant populations in B. tabaci (Cahill et al., 1996; Elbert and Nauen, 2000). Crop management and the use of physical barriers or UV-absorbing plastic films and screens to protect crops can also help to control TYLCV (Antignus et al., 2001). Although the use of virus-resistant cultivars is currently the best alternative for controlling TYLCV, limited sources of useful resistance are available at the commercial level, which greatly limits the possibility of crop breeding. TYLCV resistance is under complex genetic control, which is difficult to manage in breeding programs (Lapidot and Friedmann, 2002). The most widespread form of resistance used commercially is based on the partially dominant Ty-1 resistance gene which is derived from the S. chilense (Dunal) Reiche accession LA1969 (Zamir et al., 1994). The resistance in these plants resulted in substantially reduced symptoms and virus accumulation in infected plants (Michelson et al., 1994), but resistance breaks down under high disease pressure (Lapidot and Friedmann, 2002). In recent decades,

Abstract: Enterobacter asburiae BQ9, a plant-growth–promoting rhizobacterium, was shown to promote tomato plant growth and induce resistance to Tomato yellow leaf curl virus (TYLCV) under greenhouse conditions. Compared with mock-treated tomato plants, plants that were pretreated with BQ9 had increased fresh mass and significantly reduced disease severity and 52% biocontrol efficacy was achieved 30 days after inoculation. The expression of defense-related genes PR1a and PR1b and the H2O2 burst were quickly induced in BQ9 pretreated plants. Antioxidase activity analysis showed that the activities of phenylalanine ammonia lyase, peroxidase, catalase, and superoxide dismutase increased significantly in BQ9 pretreated plants. Our results suggest that the plant-growth–promoting rhizobacterium BQ9 induced a priming of the plant defense responses to TYLCV by increasing the expression of defense response genes, and the induced resistance was mechanistically connected to the expression of antioxidant enzymes and the production of H2O2.

Key words: Enterobacter asburiae, growth promotion, induced resistance, Tomato yellow leaf curl virus, H2O2 burst

Received: 05.02.2015 Accepted/Published Online: 08.06.2015 Final Version: 05.01.2016

Research Article

* Authors contributed equally to this work and are regarded as joint first authors. ** Correspondence: hxliu@njau.edu.cn

LI et al. / Turk J Biol

151

much attention has been devoted to plant and microbial metabolites with antiviral properties because of their ecosafety advantage over chemical pesticides (Baranwal and Verma, 1997). These antiviral metabolites are reported to inhibit the virus in vitro or induce plant resistance to the pathogen; the latter mode of action involves a broad spectrum of plant defense responses, and is thus a more effective strategy for disease control (Murphy et al., 1999; Kloepper et al., 2004).

In many plants, induced systemic resistance (ISR) can be stimulated by abiotic or biotic elicitors that increase the capacity of the plant to resist pathogens (Murphy et al., 1999; Beckers and Conrath, 2007). Among the various inducers of resistance, plant-growth–promoting rhizobacteria (PGPR) attract much attention because of their advantages over other inducers, which include broad-spectrum antimicrobial activity, high levels of colonization on plant tissues, and growth-promoting capacity (Lian et al., 2011). Rhizobacteria-mediated ISR has been demonstrated in a variety of plants, including beans, carnations, cucumbers, radishes, tobacco, tomatoes, and the model plant Arabidopsis thaliana (Van Loon et al., 1998). The rhizobacterium Bacillus amyloliquefaciens strain EXTN-1 can induce resistance to anthracnose activity in cucumber plants and can induce the expression of a defense-related gene (PR-1a) in tobacco plants (Jeun et al., 2001; Park et al., 2001). Wang et al. (2009) found that treatment with B. subtilis G1 enhanced the expression level of the PR-Ia and PR-Ib genes and of plant-defense–related genes NPR1 and CoiI, after TMV-challenged inoculation. Beneficial rhizobacteria such as PGPR can also trigger ISR by potentiating the activation of specific molecular and cellular defense responses, which are activated more quickly and potently than those activated during more common infections (Ton et al., 2005; Ahn et al., 2007). The cellular defense responses include the oxidative burst (Iriti and Faoro, 2003), cell-wall reinforcement (Benhamou, 1996), accumulation of defense-related enzymes (Brisset et al., 2000), and production of secondary metabolites (Yedidia et al., 2003).

We previously isolated Enterobacter asburiae BQ9. This rhizobacterium was shown to significantly reduce the symptoms caused by TYLCV in tomato plants. In the present study, we focused on its role in BQ9-induced resistance to TYLCV and growth promotion in tomato plants. We measured curling symptoms and defensive responses through ROS accumulation, H2O2-scavenging enzymes, and the expression of defense-related genes. This study addressed the role of BQ9 in priming the defense response to infection by TYLCV in tomato plants.

2. Materials and methods2.1. Plants materials and bacterial strainTomato seeds (Hezuo 903, a TYLCV-susceptible cultivar) were sown in seed trays. Three-week-old seedlings were transferred into 300-mL pots containing a vermiculite potting soil mixture that had been autoclaved for 20 min at 121 °C twice on two consecutive days. Plants were cultivated in a growth chamber at 25 ± 2 °C with a 14 h/10 h (day/night) photoperiod.

The PGPR used in this experiment, Enterobacter asburiae BQ9, was originally isolated from the forest soil in Dongguan City, Guangdong Province, China. BQ9 was grown on Luria–Bertani (LB) agar plates at 28 °C for 24 h. Subsequently, bacterial cells were collected by centrifugation and then resuspended in a sterile 0.85% NaCl solution adjusted to 5 × 107 CFU mL–1 for use. The TYLCV infectious Agrobacterium tumefaciens strain EHA105, which was transformed with pB-TY-XH-1.8A, was grown in liquid LB medium containing 50 mg L–1 rifampicin and 50 mg L–1 kanamycin at 28 °C overnight and was adjusted to 5 × 107 CFU mL–1 for use.2.2. Assessment of the induction of systemic resistance and plant growthAfter 1 week of growth in pots, four-leaf-stage tomato seedlings were subjected to induction treatments. Seedlings were treated in 1 of 4 ways: a pretreatment with BQ9 followed by challenging inoculation with TYLCV, a BQ9 pretreated control, a TYLCV control, and a mock treatment. Each treatment consisted of 24 plants. For the plants receiving BQ9 treatments, 20 mL of a 5 × 107 CFU mL–1 cell suspension of BQ9 was poured on the soil around the roots of the tomato plants in each pot. For the two treatments that were not receiving BQ9, plants were treated with 20 mL of sterile 0.85% NaCl solution in the same manner. Seven days later, the seedlings receiving TYLCV treatments were challenged and inoculated with TYLCV as described (Zhou et al., 2003), using a fine needle to inject 0.2 mL of EHA105 culture (5 × 107 CFU mL–1) into the stems or petioles. Fifteen days after the challenge inoculation, the plants were scored every day to determine their disease rating (DR) on a scale of 0–4, as described by Lapidot et al. (2006). Disease severity and biocontrol efficacy were calculated as follows:

Disease severity (%) = [∑(the number of diseased plants in disease rating i × disease rating i)/(total number of plants investigated × highest disease rating)] × 100;

Biocontrol efficacy (%) = [(disease severity of viral control treatment – disease severity of antagonist treatment)/disease severity of viral control treatment] × 100.

Twenty days after treatment with BQ9, the tomato plants of BQ9 pretreated control and mock treatment were collected to measure their roots, shoots, and fresh mass:

LI et al. / Turk J Biol

152

Fresh mass increase (%) = [(fresh mass of BQ9 pretreated control – fresh mass of mock treatment)/fresh mass of mock treatment] × 100.2.3. Impact of antagonistic bacterium BQ9 on the viral load in tomato plantsTo study the impact of BQ9 on the viral load in the host plant, a PCR experiment was conducted. After the challenging inoculation, the plants were tested every day to determine the viral load. Using a plant gene extraction kit (SBS, Shanghai), plant DNA was extracted from 0.1 g of the youngest leaves from plants in each treatment. The TYLCV fragment was amplified using the specific primer pair PF/PR (Deng et al., 1994), where PA: 5’-TAATATTACCKGWKGVCCSC-3’ and PB: 5’-TGGACYTTRCAWGGBCCGCACA-3’. Primers were synthesized by Shanghai Biological Technology (SBS). Cycling was performed as follows: an initial denaturation for 4 min at 95 °C, followed by 34 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C followed by annealing for 10 min at 72 °C. After the reaction was complete, the PCR products were subjected to electrophoresis on 1% agarose gel in Tris-acetate-EDTA (TAE) buffer and then stained with ethidium bromide (EB).2.4. Analysis of gene expression by RT-PCRTo analyze the expression of the PR1a and PR1b genes, RT-PCR was performed according to the manufacturers’ instructions for the Prime Script First-Strand cDNA synthesis kit (TaKaRa Biotech, Dalian, China). Total RNA was extracted from tomato leaves using TRIzol reagent (Invitrogen, San Diego, CA, USA). Using the Oligo dT primer, first-strand cDNA was synthesized from 500 ng of total RNA. An independent PCR with 25 cycles was performed using aliquots (1 μL) of the cDNA samples and the PR1a and PR1b specific primers. A constitutively expressed gene, EF1α, was used as a quantitative control in the RT-PCR analysis. Primer Premier 5.00 was employed to design specific primer pairs for EF1α (forward primer: ATGTTGGGTTCAATGTTAAG, reverse primer: ATCACACTGCACAGTTCAC), PR1a (forward primer: TCTCCATTTTCGTTGCTTGTTTCATTACC, reverse primer: GGATCATAATTGCACGTTATAAAAACCCAC), and PR1b (forward primer: GGATTTAGCGGACTT-CCTTCTG, reverse primer: ATGCCAAGGCTTGTAC-TAGAGAATG).2.5. Detection and quantification of H2O2H2O2 levels were determined as previously described (Loreto and Velikova, 2001) with minor modifications. Leaf samples (70 mg) were homogenized in 2.0 mL of 0.1% (w/v) trichloroacetic acid, and the homogenate was centrifuged at 14,000 × g for 15 min at 4 °C. From each supernatant sample, an aliquot of 0.5 mL was added to 0.5 mL of 10 mM phosphate buffer (pH 7.0) and 1.0 mL of 1 M KI, and the absorbance was measured at 390 nm with

a UV1000 spectrophotometer. The concentration of H2O2 was quantified, taking into account a calibration curve using solutions with known H2O2 concentrations.2.6. Assay of defense enzymesThree leaf samples were collected from each treatment at 0, 1, 2, 3, 4, and 5 days postinoculation (dpi); and 0.2 g (FW) of each sample was placed into a mortar with 2 mL of 50 mM ice-cold phosphate buffered saline (pH 7.8) containing 1 mM ethylene diamine tetraacetic acid (EDTA). The mixture was homogenized with a pestle, and the homogenate was centrifuged at 15,000 × g for 15 min at 4 °C. The enzyme extract was in the supernatant which was used in the following enzyme assays. All enzymatic assays were performed at 4 °C using freshly prepared enzyme extracts that were kept on ice until analysis.

The superoxide dismutase (SOD) activity was determined according to the Beyer and Fridovich (1987) method. Peroxidase (POD) activity was measured according to the procedure described by McAdam et al. (1992). Phenylalanine ammonia lyase (PAL) activity was determined using the method described by D’Cunha et al. (1996). Catalase (CAT) activity was determined by the decrease in H2O2 levels (Aebi, 1983). 2.7. Data analysisData were analyzed using Excel 2007, and the differences in these data among treatments were analyzed for significance (P < 0.05) using the statistical software Data Processing System (DPS, version 7.05). The viral load was analyzed using Image J.

3. Results3.1. Effects of Enterobacter asburiae BQ9 on systemic protection against TYLCV in tomato plantsThe bioprotection capacity of Enterobacter asburiae BQ9 was assessed in tomato plants according to their phenotypic responses and the severity of their symptoms. Twenty-five days after the plants were challenged through inoculation with TYLCV, the plants developed typical TYLCV symptoms consisting of stunting, yellowing, and the upward curling of leaves. In plants that were pretreated with BQ9, the appearance of symptoms was delayed for 7 days (data not shown), and the symptoms that developed on leaves were milder and less distinct than those in the viral control (Figure 1a). In addition, the results of the disease severity investigation showed that BQ9 pretreated plants had significantly reduced disease severity when compared to the viral control; accordingly, 30 days after inoculation with TYLCV the biocontrol efficacy of BQ9 in controlling the viral disease caused by TYLCV reached 58.7%. After 45 days, the protection conferred by BQ9 was weakened; however, it still provided significant disease reduction (42%) (Figure 1b).

LI et al. / Turk J Biol

153

3.2. Effect of BQ9 on promoting the growth of tomato plantsBQ9 was assessed for its ability to promote the growth of tomato plants under greenhouse conditions. Twenty days after treatment, plants that were pretreated with BQ9 exhibited increases in shoot length, root length, and fresh mass when compared with plants of the mock treatment; BQ9 treatment also increased the fresh mass of the plants by 37.84% (Table; Figure 2). 3.3. Impact of antagonistic bacterium BQ9 on the viral load in tomato plantSeven days after the tomato plants were challenged through inoculation, viral particles were detected in the viral control (Figure 3a). A small amount of the virus was detected in the BQ9 pretreated plants after 9 days, and the viral load was almost one-third of that in the viral control (Figure 3b), indicating that BQ9 could induce plant resistance to virus proliferation in the leaf.

3.4. Expression of defense-related genes induced by BQ9 and TYLCV inoculation in tomato plantsReverse-transcription polymerase chain reaction (RT-PCR) was used to analyze the expression patterns of the defense-related genes PR1a and PR1b in tomato plants that had been treated with BQ9. Transcripts of all tested genes were detected 1–5 days post-BQ9 treatment (dpt) in the plant leaves where the expression of these genes was evident (Figure 4a). PR1a transcripts accumulated in the leaves from 2 to 5 dpt. The expression of the PR1b gene began at 3 dpt and reached maximum levels at 4 dpt (Figure 4a). By contrast, the transcription of these genes was undetected in the leaves of mock-treatment plants (Figure 3a).

RT-PCR was also used to analyze the transcription of these genes in the tomato plants that were inoculated only with TYLCV and in plants that were pretreated with BQ9 and then challenged by inoculation with TYLCV.

Dise

ase

seve

rity

(%)

Figure 1. The bioprotection capacity of antagonistic bacterium BQ9 to TYLCV. Control: pathogen control; BQ9: BQ9 pretreated plants challenged with TYLCV. a) Representative plants for treatments with BQ9 or a control were photographed 30 days after inoculation challenge (DAC). b) For each treatment, disease severity in plants was determined according to the disease rating measured at 30 and 45 DAC. Disease severity of each treatment was determined according to the disease rating. Values are means with standard errors from 24 plants. Different letters indicate statistically significant differences between the treatments (Fisher’s least significant difference test; P < 0.05). All experiments were conducted three times with similar results.

Table. Promotion of tomato plant growth by BQ9. The data are from a representative experiment that was repeated three times with similar results. Different letters indicate statistically significant differences between the treatments (Fisher’s least significant difference test; P < 0.05).

Treatment Shoot length (cm) Root length (cm) Fresh mass (g) Fresh mass increase (%)

BQ9 26.40 ± 1.77a 13.57 ± 1.81a 7.03 ± 0.45a 37.84

Mock 21.03 ± 1.83b 9.40 ± 1.08b 5.10 ± 0.26b --

LI et al. / Turk J Biol

154

Transcripts of all tested genes were detected 12–96 h postinoculation (hpi) in the leaves of plants that had been inoculated only with TYLCV; however, they were detected 6–96 hpi in BQ9 pretreated plants. The PR1a gene transcript reached maximum levels at 24 hpi in the leaves of plants only inoculated with TYLCV and as soon as 12 hpi in BQ9 pretreated plants challenged by inoculation

with TYLCV (Figure 4b). The PR1b gene transcript was more highly expressed in BQ9 pretreated plants challenged by inoculation with TYLCV than in those only inoculated with TYLCV. This indicates that the transcription of these genes occurred more quickly in plants that were pretreated with BQ9 and challenged by inoculation with TYLCV. Furthermore, across all time points, both genes were more

Figure 2. Promotion of tomato plant growth by BQ9. Representative plants for each treatment were photographed 20 days posttreatment.

Figure 3. Impact of antagonistic bacterium BQ9 on viral load in tomato leaves. The RA value was analyzed using Image J.

Figure 4. Expression of PR1a and PR1b genes in tomato plants in response to BQ9 treatment (a) or in combination with TYLCV inoculation (b). dpt = days posttreatment, hpi = hours postinoculation.

LI et al. / Turk J Biol

155

highly expressed in BQ9 pretreated plants challenged by inoculation with TYLCV than in plants that were only inoculated with TYLCV (Figure 4b).3.5. BQ9 induced the priming of cellular defense responses in tomato plantsBQ9 was examined to determine the mechanism by which it primes tomato plants to potentiate the activation of cellular defense responses. H2O2 accumulation was detected 6 hpi in the leaves of plants that were treated with BQ9 and inoculated with TYLCV, but neither BQ9 treatment nor TYLCV inoculation alone resulted in a cellular defense response at the same time point (Figure 5). In plants that were treated with BQ9 and inoculated with TYLCV, the extent of H2O2 accumulation was significantly greater than in plants that were only treated with BQ9, plants that were only inoculated with TYLCV, and in mock-treated plants (Figure 5).3.6. BQ9 induced defense enzymes in tomato plantsCAT activity reached maximum levels at 4 dpi and 3 dpi in plants that were pretreated with BQ9 and then challenged by inoculation with TYLCV and in those that were inoculated with TYLCV alone, respectively (Figure 6a). POD activity was observed in plants that were pretreated with BQ9 and challenged by inoculation with TYLCV, and the activity reached maximum levels at 2 dpi; however, activity was lower in plants that were inoculated with

TYLCV alone (Figure 6b). PAL showed a similar pattern of activity that reached maximum levels at 3 dpi in plants that were pretreated with BQ9 and challenged by inoculation with TYLCV (Figure 6c). Similarly, for tomato plants that were inoculated with TYLCV alone, a slight increase in PAL activity was recorded. In the SOD assay, the activity

Figure 5. Effect of BQ9 and TYLCV treatments on H2O2 accumulation in tomato leaves. Different letters indicate statistically significant differences between the treatments (Fisher’s least significant difference test; P < 0.05). All experiments were repeated three times, and similar results were obtained.

Figure 6. Effect of BQ9 treatment on CAT (a), POD (b), PAL (c), and SOD (d) activities in tomato leaves. Different letters indicate statistically significant differences among treatments (Fisher’s least significant difference test; P < 0.05). Vertical bars indicate standard deviations of three replications.

6 h12 h

LI et al. / Turk J Biol

156

of SOD appeared as two peaks, 2 dpi and 4 dpi, in plants that were treated with BQ9 and inoculated with TYLCV, but only one peak appeared for plants that were inoculated with TYLCV alone (Figure 6d).

4. DiscussionTomato yellow leaf curl virus (TYLCV) is undoubtedly one of the most damaging pathogens in tomato plants, and it limits the production of tomatoes in many tropical and subtropical areas of the world. Insecticides are commonly applied to suppress whitefly populations and to indirectly reduce the spread of TYLCV. Rhizobacteria, as potential biological control candidates, could be used to directly control the spread of TYLCV. In this study, we investigated the effectiveness of the rhizobacterium Enterobacter asburiae BQ9 against TYLCV in tomato plants. In the evidence presented here, tomato plants that were pretreated with BQ9 triggered a resistant response, including the expression of defense-related genes, production of H2O2, and activation of defense enzymes, when challenged by inoculation with TYLCV. In addition, BQ9-treated plants exhibited statistically significant increases in fresh mass compared with mock-treated plants, suggesting that BQ9 is a PGPR. As for plant disease management, the induction of plant resistance by PGPR has become a trend in recent years. Although a large number of studies have focused on PGPR-induced resistance to various bacterial and fungal pathogens (Van Loon et al., 1998; Kloepper et al., 2004), only a few studies have investigated application of PGPR strains for plant viral disease control under greenhouse and/or field conditions (Raupach et al., 1996; DeMeyer et al., 1999; Udaya Shankar et al., 2009; Wang et al., 2009). These studies are mostly associated with bacteria from the genus Bacillus that are in contact with plants to control TMV or CMV via ISR and other mechanisms (Kloepper et al., 2004; Zhou et al., 2008). This study addressed the role of E. asburiae BQ9 in priming the defense response to infection by TYLCV in tomato plants. This study is the first to describe an Enterobacter asburiae PGPR that triggers tomato plant resistance to TYLCV and promotes plant growth.

PGPRs, predominantly Bacillus and Pseudomonas spp., colonize the rhizosphere and promote plant growth by synthesizing phytohormones, facilitating the uptake of nutrients, producing antagonistic substances, or inducing resistance to phytopathogenic organisms (Glick, 1995; Beneduzi et al., 2012). For naturally growing plants, it is difficult to distinguish whether an apparent growth promotion was bacterially stimulated or was caused by the suppression of deleterious soil microorganisms (Van Loon, 2007). Induced systemic resistance (ISR), which was first described by Van Peer et al. (1991), could be explained as follows: rhizobacteria can reduce the activity of pathogenic microorganisms not only through microbial

antagonism but also by activating the plant to better defend itself (Van Loon, 2007). In the current study, ISR triggered by BQ9 conferred lasting protection against TYLCV with a reduction in disease of 42%, even at 45 dpi, and it was proposed that the plants may remain protected for a considerable part of their lifetime once ISR has been triggered (Van Loon et al., 1998).

When treated with BQ9, the roots of tomato plants should produce a local signal that moves to the leaves in order to activate a systemic enhanced defensive capacity in the plant, although the nature of the mobile signal triggered by BQ9 has so far remained elusive. In the leaves of tomato plants pretreated with BQ9, the H2O2 burst occurred more rapidly and to a greater extent upon challenge with TYLCV than the burst that occurred in the leaves of viral control plants, and this finding supports the above assertion. H2O2 has important functions in the infected plants; it is an early molecular signal that systemically induces resistance in the fortification of apoptotic tissues and causes apoptosis of infested cells (Ahn et al., 2011). The H2O2 burst, an essential signal that primes defense responses, is a typical response to pathogen infection in primed plants (Zhang et al., 2009). It has been well documented that rhizobacteria-mediated ISR is often associated with priming for the enhanced activation of cellular defense responses upon pathogen attack, such as the rapid accumulation of hydrogen peroxide (Conrath et al., 2002; Van Wees et al., 2008; Niu et al., 2011). In this study, H2O2 accumulation was detected 6 hpi in the leaves of plants that were pretreated with BQ9 and challenged by inoculation with TYLCV, but not in leaves treated with BQ9 or TYLCV alone. At 12 hpi, the response was observed in plants that had been inoculated with TYLCV alone, but still not in plants treated with BQ9 alone (Figure 5). This implies that BQ9 primed the plant for an accelerated and enhanced capacity to systemically activate cellular defense responses, which were induced only upon pathogen attack. While we inferred that treatment with the BQ9 strain protected tomato plants from TYLCV infection through priming defense-related mechanisms, the same phenomenon was determined in the tomato–Pseudomonas putida strain LSW17S interaction (Ahn et al., 2011) and the Arabidopsis–Bacillus cereus strain AR156 interaction (Niu et al., 2011).

The activation of certain pathogenesis-related (PR) genes in some plant–PGPR interactions suggested that the systemic resistance induced by the rhizobacteria was similar to pathogen-induced systemic acquired resistance (SAR) (Wang et al., 2005). The enhanced defensive capacity that is characteristic of SAR is always associated with the accumulation of PR genes. PR-1, notably PR1a and PR1b, is a dominant group of PR genes and is commonly used as a marker for SAR (Kessmann et al., 1994). PR1a transcripts

LI et al. / Turk J Biol

157

accumulated in leaves of BQ9-treated plants 2 to 5 dpt, the transcription of PR1b began 3 dpt, and transcription of both genes reached their maximums levels at 4 dpt, while neither transcript was detected in mock-treatment plants (Figure 4a). Furthermore, when challenged by inoculation with TYLCV, the leaves of plants that were pretreated with BQ9 had more rapid and extensive transcription of the PR1 genes than plants that were not pretreated. Altogether, these observations suggest that BQ9 primed SAR in tomato plants.

The generation of active oxygen species (AOS) is one of the initial responses of plants to pathogens (Mehdy, 1994; Vanacker et al., 2000). As a major scavenger in antioxidant enzyme systems that protect cellular membranes and organelles from AOS in plants, SOD converts superoxide anion radicals to hydrogen peroxide and oxygen by disproportion (Fridovich, 1986). Considering the high density of AOS that is generated in tomato plants after TYLCV invasion, strong SOD activity was assumed to scavenge AOS, and the relatively low activity of CAT may be explained by the downstream functions of SOD.

POD can oxidize phenolic compounds into antimicrobial quinones, which inhibit viruses by inactivating viral RNA (Lamb and Dixon, 1997). This may account for the stronger POD activity, compared to CAT, during the first two days post-TYLCV inoculation. PAL, a key enzyme in phenylpropanoid metabolism, plays a significant role in the synthesis of various secondary metabolites (e.g., phenols, phenylpropanoids, and lignin and salicylic acid monomers) that are involved in plant immunity and induce resistance by PGPR (Gerasimova et al., 2005; Harish et al., 2008). The accumulation of these secondary metabolites was thought to restrict virus invasion (Lian et al., 2011), which may account for the increased PAL activity in tomato plants treated with strain BQ9 prior to inoculation with TYLCV.

Acknowledgments This research was supported by the Special Fund for Agro-Scientific Research in the Public Interest (201003065, 201303028) and the Joint Innovation Fund Project (BY2014128-05).

References

Aebi H (1983). Catalase. In: Bergmeyer H, editor. Methods in Enzymatic Analysis. 2nd ed. New York, NY, USA: Academic Press, pp. 276–286.

Ahn IP, Kim S, Lee YH, Suh SC (2007). Vitamin B1-induced priming is dependent on hydrogen peroxide and the NPR1 gene in Arabidopsis. Plant Physiol 143: 838–848.

Ahn IP, Lee SW, Kim MG, Park SR, Hwang DJ, Bae SC (2011). Priming by rhizobacterium protects tomato plants from biotrophic and necrotrophic pathogen infections through multiple defense mechanisms. Mol Cells 32: 7–14.

Antignus Y, Nestel D, Cohen S, Lapidot M (2001). Ultraviolet-deficient greenhouse environment affects whitefly attraction and flight-behavior. Environ Entomol 30: 394–399.

Baranwal VK, Verma HN (1997). Characteristics of a virus inhibitor from the leaf extract of Celosia cristata. Plant Pathol 46: 523–529.

Beckers GJM, Conrath U (2007). Priming for stress resistance: from the lab to the field. Curr Opin Plant Biol 10: 425–431.

Beneduzi A, Ambrosini A, Passaglia LMP (2012). Plant growth-promoting rhizobacteria (PGPR): their potential as antagonists and biocontrol agents. Genet Mol Biol 35: 1044–1051.

Benhamou N (1996). Elicitor-induced plant defence pathways. Trends Plant Sci 1: 233–240.

Beyer WF Jr, Fridovich I (1987). Assaying for superoxide dismutase activity: some large consequences of minor changes in conditions. Anal Biochem 161: 559–566.

Brisset MN, Cesbron S, Thomson SV, Paulin JP (2000). Acibenzolar-S-methyl induces the accumulation of defense-related enzymes in apple and protects from fire blight. Eur J Plant Pathol 106: 529–536.

Cahill M, Gorman K, Day S, Denholm I (1996). Baseline determination and detection of resistance to imidacloprid in Bemisia tabaci (Homoptera: Aleyrodidae). Bull Entomol Res 86: 343–349.

Conrath U, Pieterse CMJ, Mauch-Mani B (2002). Priming in plant-pathogen interactions. Trends Plant Sci 7: 210–216.

Czosnek H, Ghanim M, Ghanim M (2002). The circulative pathway of begomoviruses in the whitefly vector Bemisia tabaci—insights from studies with Tomato yellow leaf curl virus. Ann Appl Biol 140: 215–231.

D’Cunha GB, Satyanarayan V, Madhusudanan NP (1996). Stabilization of phenylalanine ammonia lyase containing Rhodotorula glutinis cells for the continuous synthesis of l-phenylalanine methyl ester. Enzyme Microb Technol 19: 421–427.

DeMeyer G, Audenaert K, Höfte M (1999). Pseudomonas aeruginosa 7NSK2-induced systemic resistance in tobacco depends on in planta salicylic acid accumulation but is not associated with PR1a expression. Eur J Plant Pathol 105: 513–517.

Elbert A, Nauen R (2000). Resistance of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides in southern Spain with special reference to neonicotinoids. Pest Manag Sci 56: 60–64.

Foyer CH, Lelandais M, Kunert KJ (1994). Photooxidative stress in plants. Physiol Plantarum 92: 696–717.

LI et al. / Turk J Biol

158

Fridovich I (1986). Biological effects of the superoxide radical. Arch Biochem Biophys 247: 1–11.

Gerasimova NG, Pridvorova SM, Ozeretskovskaya OL (2005). Role of L-phenylalanine ammonia lyase in the induced resistance and susceptibility of sotato plants. Appl Biochem Microbiol 41: 103–105.

Glick BR (1995). The enhancement of plant growth by free-living bacteria. Can J Microbiol 41: 109–117.

Hanssen IM, Lapidot M, Thomma BPHJ (2010). Emerging viral diseases of tomato crops. Mol Plant Microbe Interaction 23: 539–548.

Harish S, Kavino M, Kumar N, Saravanakumar D, Soorianathasundaram K, Samiyappan R (2008). Biohardening with plant growth promoting rhizosphere and endophytic bacteria induces systemic resistance against Banana bunchy top virus. Appl Soil Ecol 39: 187–200.

Iriti M, Faoro F (2003). Benzothiadiazole (BTH) induces cell-death independent resistance in Phaseolus vulgaris against Uromyces appendiculatus. J Phytopathol 151: 171–180.

Jeun YC, Park K, Kim CH (2001). Different mechanisms of induced systemic resistance and systemic acquired resistance against Colletotrichum orbiculare on the leaves of cucumber plants. Mycobiology 29: 19–26.

Kessmann H, Staub T, Ligon J, Oostendorp M, Ryals J (1994). Activation of systemic acquired disease resistance in plants. Eur J Plant Pathol 100: 359–369.

Kloepper JW, Ryu CM, Zhang S (2004). Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94: 1259–1266.

Lapidot M, Ben-Joseph R, Cohen L, Machbash Z, Levy D (2006). Development of a scale for evaluation of Tomato yellow leaf curl virus resistance level in tomato plants. Phytopathology 96: 1404–1408.

Lapidot M, Friedmann M (2002). Breeding for resistance to whitefly-transmitted geminiviruses. Ann Appl Biol 140: 109–127.

Lian L, Xie L, Zheng L, Lin Q (2011). Induction of systemic resistance in tobacco against Tobacco mosaic virus by Bacillus spp. Biocontrol Sci Technol 21: 281–292.

Loreto F, Velikova V (2001). Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes. Plant Physiol 127: 1781–1787.

MacAdam JW, Nelson CJ, Sharp RE (1992). Peroxidase activity in the leaf elongation zone of tall fescue I. Spatial distribution of ionically bound peroxidase activity in genotypes differing in length of the elongation zone. Plant Physiol 99: 872–878.

Mehdy MC (1994). Active oxygen species in plant defense against pathogens. Plant Physiol 105: 467.

Michelson I, Zamir D, Czosnek H (1994). Accumulation and translocation of Tomato yellow leaf curl virus (TYLCV) in a Lycopersicon esculentum breeding line containing the L. chilense TYLCV tolerance gene Ty-1. Phytopathology 84: 928–933.

Murphy AM, Chivasa S, Singh DP, Carr JP (1999). Salicylic acid-induced resistance to viruses and other pathogens: a parting of the ways? Trends Plant Sci 4: 155–160.

Navot N, Pichersky E, Zeidan M, Czosnek H (1991). Tomato yellow leaf curl virus: a whitefly-transmitted geminivirus with a single genomic component. Virology 185: 151–161.

Niu DD, Liu HX, Jiang CH, Wang YP, Wang QY, Jin HL, Guo JH (2011). The plant growth-promoting rhizobacterium Bacillus cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate- and jasmonate/ethylene-dependent signaling pathways. Mol Plant Microbe Interaction 24: 533–542.

Palumbo JC, Horowitz AR, Prabhaker N (2001). Insecticidal control and resistance management for Bemisia tabaci. Crop Prot 20: 739–765.

Park KS, Ahn IP, Kim CH (2001). Systemic resistance and expression of the pathogenesis-related genes mediated by the plant growth-promoting rhizobacterium Bacillus amyloliquefaciens EXTN-1 against anthracnose disease in cucumber. Mycobiology 29: 48–53.

Picó B, Díez MJ, Nuez F (1996). Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus—a review. Sci Hort-Amsterdam 67: 151–196.

Raupach GS, Liu L, Murphy JF, Tuzun S, Kloepper JW (1996). Induced systemic resistance in cucumber and tomato against Cucumber mosaic cucumovirus using plant growth-promoting rhizobacteria (PGPR). Plant Dis 80: 891–894.

Ton J, Jakab G, Toquin V, Flors V, Iavicoli A, Maeder MN, Métrauxc JP, Mauch-Mania B (2005). Dissecting the β-aminobutyric acid-induced priming phenomenon in Arabidopsis. Plant Cell 17: 987–999.

Udaya Shankar AC, Chandra Nayaka S, Niranjan-Raj S, Bhuvanendra Kumar H, Reddy MS, Niranjana SR, Prakash HS (2009). Rhizobacteria-mediated resistance against the blackeye cowpea mosaic strain of Bean common mosaic virus in cowpea (Vigna unguiculata). Pest Manag Sci 65: 1059–1064.

Vanacker H, Carver TLW, Foyer CH (2000). Early H2O2 accumulation in mesophyll cells leads to induction of glutathione during the hyper-sensitive response in the barley–powdery mildew interaction. Plant Physiol 123: 1289–1300.

Van Loon LC (2007). Plant responses to plant growth-promoting rhizobacteria. Eur J Plant Pathol 119: 243–254.

Van Loon LC, Bakker P, Pieterse CMJ (1998). Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36: 453–483.

Van Peer R, Niemann GJ, Schippers B (1991). Induced resistance and phytoalexin accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS 417r. Phytopathology 81: 728–734.

Van Wees S, Van der Ent S, Pieterse CMJ (2008). Plant immune responses triggered by beneficial microbes. Curr Opin Plant Biol 11: 443–448.

LI et al. / Turk J Biol

159

Wang S, Wu HJ, Qiao JQ, Ma LL, Liu J, Xia YF, Gao XW (2009). Molecular mechanism of plant growth promotion and induced systemic resistance to Tobacco mosaic virus by Bacillus spp. J Microbiol Biotechnol 19: 1250–1258.

Wang Y, Ohara Y, Nakayashiki H, Tosa Y, Mayama S (2005). Microarray analysis of the gene expression profile induced by the endophytic plant growth-promoting rhizobacteria, Pseudomonas fluorescens FPT9601-T5 in Arabidopsis. Mol Plant Microbe Interaction 18: 385–396.

Yedidia I, Shoresh M, Kerem Z, Benhamou N, Kapulnik Y, Chet I (2003). Concomitant induction of systemic resistance to Pseudomonas syringae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl Environ Microbiol 69: 7343–7353.

Zamir D, Ekstein-Michelson I, Zakay Y, Navot N, Zeidan M, Eshed Y, Harel E, Pleban T, Van-Oss H, Kedar N et al. (1994). Mapping and introgression of a Tomato yellow leaf curl virus tolerance gene, Ty-1. Theor Appl Genet 88: 141–146.

Zhang S, Yang X, Sun M, Sun F, Deng S, Dong H (2009). Riboflavin-induced priming for pathogen defense in Arabidopsis thaliana. J Integr Plant Biol 51: 167–174.

Zhou WW, Zhang LX, Zhang B, Wang F, Liang Z, Niu T (2008). Isolation and characterization of ZH14 with antiviral activity against Tobacco mosaic virus. Can J Microbiol 54: 441–449.

Zhou X, Xie Y, Tao X, Zhang Z, Li Z, Claude MF (2003). Characterization of DNAβ associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A. J Gen Virol 84: 237–247.