CIRCULATING STRAINS Mycobacterium tuberculosis ISOLATED FROM EXTRA-PULMONARY TUBERCULOSIS PATIENTS IN KELANTAN, MALAYSIA

South Asian Journal of Multidisciplinary Studies (SAJMS) ISSN:2349-7858 Volume 2 Issue 1

Published By: Universal Multidisciplinary Research Institute Pvt Ltd

CIRCULATING STRAINS Mycobacterium tuberculosis ISOLATED

FROM EXTRA-PULMONARY TUBERCULOSIS PATIENTS

IN KELANTAN, MALAYSIA

Nur Izzah Farakhin Ayub, Mohd Fazli Ismail and Siti Suraiya Md Noor*

Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia



ABSTRACT

Molecular genotyping of Mycobacterium tuberculosis from extra-pulmonary tuberculosis

(EPTB) isolates based on DNA polymorphism of direct-repeat locus were carried out in

Kelantan state of Malaysia. In this study a total of 131 clinical samples from suspected EPTB

cases were collected. We analysed fifty-nine samples by using spacer oligonucleotide typing

(spoligotyping). The genotypes obtained were compared to SITVIT WEB, a M. tuberculosis

molecular markers international database containing 7104 spoligotype patterns worldwide.

From this study, thirty spoligotype patterns with fifteen known Shared International Type

(SITs) and fifteen unknown SITs were identified. Five known lineages have been identified

with Beijing (38.9 %, n = 23) as the most prevalent genotype followed by EAI (30.5 %, n =

18), T, (8.5 %, n = 5), H (1.7 %, n = 1) and BOV (1.7 %, n = 1) lineages.

Keywords: Extra-pulmonary tuberculosis, Mycobacterium tuberculosis, shared international

type, spoligotyping.



INTRODUCTION

For centuries long, tuberculosis (TB) has been known to mankind as devastating plague. It was inferred to present as early as prehistory period of time and continued to kill people until today. It has been reported that TB is a second most common cause of death globally after human immunodeficiency virus infection and acquired immune disease syndrome (HIV/AIDS). In 2013, 9 million of incidence cases corresponding to 126 cases per 100 000 population and 1.5 of TB death were estimated globally (WHO, 2013).

This airborne disease is caused by M. tuberculosis, a most common strain of mycobacteria that cause pulmonary TB in human. It may also infect other parts of the body causing EPTB, representing about 15 to 20 % of active TB cases. Despite of its low prevalence, EPTB still posed a threat as high morbidity and mortality is noted both in developed and developing countries (Yang et al., 2004). The circumstance is due to atypical clinical manifestation, difficulty in obtaining specimen for laboratory confirmation and paucibacillary characteristic of the specimens which in turn had complicated the clinical diagnosis and worsen the scenario in EPTB cases. In Malaysia, 13.5 % of EPTB cases were notified in 2013 representing 5947 of a total of 24071 cases (WHO, 2013).

Knowledge on TB transmission has been greatly enhanced since the introduction of molecular typing technique for M. tuberculosis in the early 1990s. These techniques exploit variable regions particularly in highly conserved genome of M. tuberculosis to generate DNA fingerprints which are specific to a particular strain. According to Evans et al. (2004), an ideal molecular typing must be accurate, discriminatory and reproducible. Spoligotyping is an alternative typing method to simultaneously detect and differentiate MTBC strains (Kamerbeek et al., 1997). Its exploits DNA polymorphism present at one particular chromosomal locus, the Direct Repeat (DR) region that is uniquely present in MTBC strains (Hermans et al., 1991). Many molecular typing studies had proven spoligotyping to be a simple, cheap, rapid, and robust (Kamerbeek et al., 1997; Brudey et al., 2006). It can detect and type strains directly on various clinical specimens without the need of culture.

The information about genetic variability of M. tuberculosis circulating strains associated with extra-pulmonary involvement in Malaysia is very limited. It is believed that this study was the first typing study of M. tuberculosis carried out on extra-pulmonary isolates. The only available studies did not specified the origin of the clinical isolates either from pulmonary, extra-pulmonary or both (Dale et al., 1999; Ngeow et al., 2006; Fazli et al., 2014). The information is very crucial to provide an overview of phylogenetic structure of M. tuberculosis associated with EPTB, which in turns offer a new insight into the natural of history of the EPTB disease in our population. For this purpose, a reliable typing method with a good strain differentiation is needed. Hence, in this study, we aim to evaluate genotype pattern among EPTB cases in Kelantan, Malaysia.

METHODOLOGY

STUDY SETTINGS A total of 131 clinical samples from suspected EPTB cases were collected from Hospital Universiti Sains Malaysia (HUSM), Kelantan and National Public Health Laboratory (NPHL), Kota Bharu, Kelantan from December 2012 to October 2014. The study was



conducted at Research Laboratory, Medical Microbiology and Parasitology Laboratory, School of Medical Sciences, Universiti Sains Malaysia (USM), Kelantan. SAMPLE PROCESSING AND CULTURE Samples from sterile sites such as cerebrospinal fluid and pleural fluid were inoculated directly in Lowenstein Jensen (LJ) medium while presumably contaminated samples such as urine and pus were decontaminated using Modified Petroff method (4% sodium hydroxide) before culturing on Ogawa medium.

DNA ISOLATION In this study, lysates containing DNA from positive culture colonies were prepared using a simple boiling method as described previously (Svastova et al., 2002). For culture negative clinical specimens, genomic DNA was extracted using DNA Mini kit, a commercial kit by QIAGEN. The procedure was performed as per manufacturers instructions. IDENTIFICATION OF M. tuberculosis COMPLEX BY IS6110 PCR AMPLIFICATION Extracted DNA was tested for the presence of M. tuberculosis complex DNA by the amplification of a 541 bp fragment of the insertion sequence, IS6110 (Kox et al., 1994). Samples showing the presence of 541 bp band under UV transillumination were considered as positive and were subjected to further characterization by spoligotyping technique. A PCR reaction of 25 l reaction mixtures was set up containing a final concentration of 1X PCR buffer, 1.5 mM MgCl2, 200 M dNTP, 1.0 U of Taq polymerase and 10 pmole of primers (PT-8, 5 GTGCGGATGGTCGCAGAGAT 3 and PT-9, 5 CTCGATGCCCTCACGGTTCA 3) with the PCR condition of 95 C of initial denaturation for 3 min followed by 30 cycles of denaturation (95 C for 1 min), annealing (60 C for 30 sec) and extension (72 C for 1 min) and a final additional extension of 5 min at 72 C. A positive control (1 ng of M. tuberculosis DNA) and a negative control (distilled water) were included in each experiment. A plasmid DNA pTOPO (H. pylori glmM gene) was also incorporated as internal control in order to rule out the false negative results.

GENOTYPING Spoligotyping technique was done as described by Kamerbeek et al., (1997) was performed using a commercial kit by Ocimum Biosolution with slightly modification. Briefly, a set of primer (DRa-biotin labelled, 5 GGT TTT GGG TCT GAC GAC 3 and DRb, 5 CCG AGA GGG GAC GGA AAC 3) were used to amplify the whole DR region by PCR. 50 l of the following reaction mixture were used for the PCR: 1x PCR buffer, 3mM of MgCl2, 0.2 mM dNTP, 20 M primers and 0.5 U Taq polymerase. The mixture was heated for 3 min at 96C and subjected to 45 cycles of 1min at 96C, 1 min at 55C, and 30 s at 72C prior subjected to final extension of 5 min at 72 C . These amplified products was hybridized to spoligotyping membrane incorporated with a set of 43 immobilized oligonucleotides, each corresponding to one of the unique spacer DNA sequences within the DR locus. Detection of hybridized DNA was done by using enhanced chemiluminescent (ECL) detection liquid followed by exposure to X-ray film. Observed spoligotype patterns on film were recorded. DATA ANALYSIS Spoligotye patterns obtained were compared with those available in SITVIT WEB, available online at http://www.pasteur-guadeloupe.fr:8081/SITVIT_ONLINE/. A shared international type (SIT) is defined as a spoligotype that shared by two or more patients isolates while an



orphan is designated to a single isolate that does not match to any reported SIT in the database repository. Note that the term lineage or its synonymous, clade or family is defined as a group of the related genotypes. Difference among the lineages of the isolates with regard to sites of infection and demographic variables were analysed by using chi squared test and Fishers exact test as appropriate using STATA 9.0. The relationship of spoligotype patterns found was analysed by spoligoforest tree, a cluster graph that visualize the relatedness of the spoligotype patterns in study setting using SpolTools software (Tanaka et al., 2006; Reyes et al., 2008; Tang et al., 2008) which is available online at http://www.emi.unsw.edu.au/spolTools/.

RESULT

59 samples from various EPTB sites that showed a positive amplification of 541 bp fragment of the insertion sequence IS6110 (Figure 1) were analyzed for further characterization by spoligotyping. Each sample represents one patient (more deta. Most samples were from pleural (55.9 %, n = 33) followed by lymph node (27.1 %, n = 16), central nervous system (8.5 %, n = 5), abdominal (3.4 %, n = 2), genitourinary system (3.4 %, n = 2) and others (3.4 %, n = 2) which represented sites from skeletal (1.7 %, n = 1).

The mean ages of the patients were found to be 40.3 years (4-77 years) with majority of them (71.2 %, n = 42) lie in 15 to 54 years age group. Male were found to be predominant (67.8 %, n = 40) (male to female sex-ratio of 2.1). Of 36 patients, 9 (25.0 %) were found HIV sero positive. Drug susceptibility testing (DST) for 36 isolates showed that 32 isolates were pan sensitive while 4 isolates were resistant to at least one of the drugs. No MDR- TB isolates was found.

Lane 1, 100 bp marker; lane 2, negative control PCR (distilled water); lane 3-10, clinical samples; lane 11, positive control PCR (1 ng M. tuberculosis) Figure 1: Polymerase chain reaction (PCR) amplification of 541 bp fragment of IS6110

In this study, 30 distinct spoligotype patterns (n = 59 isolates) were found, of which 44 isolates were assigned into 15 SIT patterns available in database. Of 44 isolates, 35 isolates were found to be clustered into 6 SITs, ranging from 2 to 22 isolates per cluster while 9 isolates were founds to be unique SITs (Table 1). On the other hand, 15 unknown SIT patterns

1 2 3 4 5 6 7 8 9 10 11

541 bp

100 bp

500 bp

1000 bp



have been identified with single isolate each (Table 2). 10 patterns are not yet reported in SITVIT Web database. Another 5 patterns have already existed and present as unique strains in a whole database.

The most predominant spoligotype patterns found in the present study were SIT 1/ Beijing (50.0 %, n = 22) followed by SIT 48/ EAI1-SOM (6.8 %, n =3), SIT 51/T1 (6.8 %, n =3), SIT 745/EA SOM (6.8 %, n =3), SIT 236/EAI1-SOM (5.4 %, n =2) and SIT 256/EAI1-SOM (5.4 %, n =2). SITs 89, 265, 735, 739, 875, 944, 1183 and 1243 were uniquely present in this study. From a total of 59 isolates, 48 isolates had been categorized into five lineages. Another 11 isolates including 10 orphan isolates and 1 isolates of a defined SIT (SIT 944) were assigned as unknown lineage by SITVIT Web database. Beijing (38.9 %, n = 23) was found to be the most predominant lineages followed by EAI (30.5 %, n = 18) and T (8.5 %, n = 5). There were also a single BOV and Haarleem isolates present in this study.

Out of a total 625 isolates reported in previous study in Malaysia (based on SITVIT Web database), SIT1/Beijing strain was found to be the most predominant strain, accounted for 238 isolates (38.1 %) followed by SIT19/EAI2-Manila (6.89 %, n = 43), SIT745/EAI1-Som (4.17 %, n = 26) and SIT51/T1 (3.04 %, n = 19). It was noted that SIT19/EAI2-Manila was not found in this study. In terms of worldwide distribution with 3 % of a given SITs (Table 3), it was revealed that these strains had showed a noticeable phylogeographical predominance in Asia regions. The most notably observed was SIT 745/ EAI1-SOM (0.6 % of a total SIT worldwide distribution, n = 313), which was reported only from Asia regions, particularly South-eastern Asia and South Asia regions with 92.9 % of them solely isolated from Malaysia. On the other hand, SIT1/Beijing was found only 10.8 % (n = 5800) of the total SIT worldwide distribution (n = 53830) with the majority of the isolates (42.8 %) were isolated in Asia regions (Southeastern Asia 15.6 % ; South Africa,11.9 % ; East Asia, 9.6 % ; North Asia,8.1 % ; South Asia, 5.3 % and West Asia, 4.2 %) regions.

It was noted that halves of the patients in 15 to 54 age group (n = 21) were infected with Beijing genotype (Table 4). This observation was significant as there was a statistically difference between strains (Beijing and non-Beijing) and age groups (p = 0.019). EAI (5 isolates, 55.6 %) was found to be the most predominant lineage isolated from HIV-positive patients (9 isolates) and was observed as the solely lineage isolated from genitourinary system. However, no significant associations observed between lineages and site of infection (Table 5).

Genetic association and possible mutation of spoligotypes of M. tuberculosis obtained in the study were visualized by spoligoforest tree Frunchterman Reingold. Each node in the spoligoforest represents a spoligotype and was colored based on M tuberculosis lineages. Existing spoligotype pattern were labelled according to their SITs number, for example, SIT 1 = 1; SIT 48 = 48 and SIT 51 = 51 while orphan pattern were labelled as Or1- Or15. From the analysis, the spoligoforest consists of four trees (connected components) and fifteen disconnected nodes.The largest tree comprised SIT 1/ Beijing (n = 22) and was observed to have probable parental link with Or 11. Meanwhile, the second largest tree with SIT 236/ EAI at the root comprises seven spoligotype patterns including one orphan pattern, Or 15 descended from SIT 256/ EAI. Majority of the disconnected nodes found in the study were from orphan strains with unknown lineage ( Or 1, Or 3, Or 4, Or 6, Or 7 and Or 12



Table 1: Spoligotyping pattern, octal codes, SIT and clade of M. tuberculosis isolates among EPTB patients (n = 44) SIT Spoligotyping Pattern Octal Code Sublineage Lineage n (%) Unique/

clustered SIT 1 000000000003771 Beijing Beijing 22 (50.0) Clustered 48 777777777413731 EAI1-SOM EAI 3 (6.8) Clustered 51 777777777760700 T1 T 3 (6.8) Clustered 89 674000003413771 EAI2-nonthaburi EAI 1 (2.3) Unique 236 777777777413771 EAI5 EAI 2 (4.5) Clustered 256 777777777413671 EAI5 EAI 2 (4.5) Clustered 265 000000000003371 Beijing Beijing 1 (2.3) Unique 581 777777677560671 T1 T 1 (2.3) Unique 735 777776777413731 EAI1-SOM EAI 1 (2.3) Unique 745 777777777413131 EAI1-SOM EAI 3 (6.8) Clustered 875 777717777760731 T2 T 1 (2.3) Unique 939 775777777413771 EAI5 EAI 1 (2.3) Unique 944 777777774000071 Unknown Unknown 1 (2.3) Unique 1183 777777777413331 EAI1-SOM EAI 1 (2.3) Unique 1243 777377777720771 H3 H 1 (2.3) Unique



Table 2: Demographic information, spoligotyping pattern, octal codes and sublineage of orphan strains among EPTB patients (n =15) Strain ID Sex/Age Spoligotyping Pattern Octal Code Sublineage/Lineage OR 1 M/9 616766177770600 Unknown OR 2 M/60 474077777413071 EAI3-IND/EAI OR 3 F/61 777767477764771 Unknown OR 4 F/3 777665577733771 Unknown OR 5 M/69 777737775413731 EAI1-SOM/EAI OR 6 M/22 175165767753771 Unknown OR 7 M/22 577767777013771 Unknown OR 8 M/71 676767777777600 BOV/BOV OR 9 F/23 777737777413700 EAI5/EAI OR 10 F/25 777777777004071 Unknown OR 11 M/15 002000044013771 Unknown OR 12 F/22 774000057413771 Unknown OR 13 M/44 477437777413771 EAI5/EAI OR 14 M/37 674000003413771 Unknown OR 15 F/57 777767777413671 Unknown


9

Table 3: Frequency of SITs observed in this study (5 %, n = 3) and their worldwide distribution

Lineage SIT

No. of SIT identified in this study, n = 44

No. of given SIT in SITVIT WEB, n = 53830

No. of given SIT reported from Malaysia in SITVIT WEB, n = 625

Distribution in regions with 3% of a given SIT

Distribution in countries with 3% of a given SIT

N % N % n % Beijing 1 22 50 5800 10.8 238 38.1 AMER-N 32.8, ASIA-SE 15.6,

AFRI-S 11.9, ASIA-E 9.6, ASIA-N 8.1, ASIA-S 5.3, ASIA-W 4.2

USA 32.7, ZAF 11.9, RUS 8.0, VNM 6.7, JPN 6.2

EA1 48 3 6.8 313

0.6 9 1.4 EURO-N 31.3, ASIA-S 23.6, AFRI-N 18.2, AFRI-S 6.1, ASIA-E 6.1 AMER-N 4.2

DNK 18.9, BGD 16.9, NLD 15.0, GBR 6.4, IND 6.4, ZAF 6.1, USA 4.2, SAU 3.5, SWE 3.2

745 3 6.8 28 0.05 26 4.2 ASIA- SE 92.9, ASIA-S 7.1 MYS 92.9, IND 7.1 T 51 3 6.8 193 0.4 19 3.0 AMER-N 21.8, EURO-E 16.6,

AMER-S 16.1, EURO-S 14.5, ASIA-SE 10.4, CARI 13.5

USA 21.8, AUT 12.4, ITA 11.9, MYS 9.8, HTI 8.8, NRA 5.7, GLP 4.7, GUF 4.7, VEN 3.6


10

Table 4: Comparison of demographic and clinical data, drug resistance pattern, site of infection and lineage of EPTB isolates (n =59).

Table 5: Association between MTB lineage and site of infection

Characteristic M. tuberculosis lineage (%) Total Beijing BOV EAI H T Unknown

Gender Male Female

16 (40.0) 7 (36.8)

1 (2.5) 0

13 (32.5) 5 (12.5)

0 1 (2.5)

4 (10.0) 1 (2.5)

6 (15.0) 5 (12.5)

40 19

Age group < 15 15-54 54

0 21 (50.0) 2 (14.3)

0 0 1 (7.1)

0 11(26.2) 7 (50.0

0 1 (2.4) 0

1 (33.3) 3 (7.1) 1 (7.1)

2 (66.7) 6 (14.3) 3 (21.4)

3 42 14

HIV Positive Negative

1 (11.1) 11 (40.7)

0 1 (3.7)

5 (55.6) 8 (29.6)

0 0

2 (22.2) 2 (7.4)

1 (11.1) 5 (18.5)

9 27

DST Sensitive Resistant

17 (53.1) 2 (50.0)

0 0

8(25.0) 1 (25.0)

1 (3.1) 0

3 (9.4) 1 (25.0)

3 (9.4) 0

32 4

Site of infection CNS Abdominal Genitourinary system Lymph node Pleural Skeletal

1 (20.0) 1 (50.0) 0 7 (43.8) 13 (39.4) 1 (100.0)

0 0 0 0 1 (3.0) 0

1 (20.0) 0 2 (100.0) 6 (37.5) 9 (27.3) 0

0 0 0 0 1 (3.0) 0

2 (40.0) 0 0 1 (6.3) 2 (6.1) 0

1 (20.0) 1 (50.0) 0 2 (12.5) 7 (21.2) 0 (0)

5 2 2 16 33 1

Total 59


11

Lineage Sites of infection OR (95% Confidence interval) Abdominal CNS Genitourinary Lymph node Pleural Skeletal Beijing 1.59

(0.09 - 26.7) 0.36

(0.38 - 3.19) - 1.31

(0.41 - 4.21) 1.16

(0.40 - 3.33) 1.59

(10.0 - 26.7) BOV - - - - - -

EAI - 0.54

(0.05 - 5.24) - 2.26

(0.68 - 7.53) 0.56

(0.18 - 1.73) -

Haarlem - - - - - -

T - 11.3 (0.64 - 95.8)

- 0.65 (0.06 - 6.29)

0.53 (0.08 - 3.45)

-

Others 4.70 (0.27 - 81.6)

- - - 1.01 (0.27 - 3.78)

-


12

Figure 2: Spoligoforest tree of all M. tuberculosis spoligotype patterns- Fruchterman Reingold tree

Beijing

BOV

EAI

H

T

Unknown


13

DISCUSSION

Malaysia is a country with the intermediate burden of TB. Kelantan, a state located in the north-east of Peninsular Malaysia contributed to 6.3 % of a total TB cases in 2012. Recent advances in molecular typing, for instance spoligotyping, provides a robust tool to analyse the heterogeneity of M. tuberculosis strains as well as their transmission patterns. This will aid in monitoring dynamics of these strain within a study population and better understanding of epidemiology of the disease.

In this study, circulating strains of M. tuberculosis obtained from 59 patients with EPTB representing Kelantan state were determined using spoligotype patterns with the reference to SITVIT WEB database. We found the single most prevalent M. tuberculosis SIT was SIT 1 (50.0 %), belongs to Beijing lineage, which is characterized by deletion of spacer 1 until 34 of DR locus. Similar finding also has been reported in previous studies with the prevalence of 45.7 % and 25.1 % by Ngeow et al., (2006) and Fazli et al., (2014) respectively. In addition, a previous IS6110 - RFLP study from Malaysia also reported Beijing genotype as the most common strain in Peninsular Malaysia (Dale et al., 1999). This circumstance might be due to a successful clonal expansion of a Beijing genotype into a naive population. A high prevalence of this genotype was also observed in neighbouring countries of Malaysia such as Thailand, Vietnam and Myanmar ranges from 30 to 55 % (Prodinger et al., 2001; Anh et al., 2000; Phyu et al., 2009) and other countries in East Asia regions (Jou et al., 2005; Chan et al., 2001; Choi et al., 2010). In contrast, Beijing genotype was seen less frequent in Caribbean and Eastern Europe and almost totally absent from Central America and Middle Africa regions (Demay et al, 2012). The origin of the genotype from Beijing, a capital of Peoples Republic of China (van Sooligen et al., 1995) and its dominancy in the province since 1950s (Qian et al., 1999) play an important role in dissemination of the genotype throughout Asia. It is postulated that this favourable condition might be explained due to previous emigration and historical trade and diplomatic relation between the Asia countries.

Our study had reported 15 unknown spoligotype patterns (Table 2). They emerge from existing strains due to absence of few spacers sequences of DR locus. A significant association of orphan strains with EPTB was noted in previous studies in Pakistan and Turkey (Tanveer et al., 2008; Gunal et al., 2011). This may be explained as pulmonary strains may be easily transmitted via aerosol routes, leading to a greater transmission and strain clustering compared to extra pulmonary strains. Identification of these strains may be a key factor in understanding the disease transmission among EPTB patients. In this study, all orphan strains appeared as a unique strain indicating a sporadic pattern of cases, which could not be associated with disease transmission in the study population. Surprisingly, one of the patterns belongs to M. bovis family, a primary causative TB agent in bovine. It was revealed that the patient was having a close physical contact with potentially infected animal as he was an animal breeder. Previous studies had reported respiratory transmission is was possible in people regularly handling infected animal (Sunder et al., 2009). Here, we deduced that there is unknown proportion of human cases caused by M. bovis and further studies should be done to estimate the prevalence of this zoonotic infection in our settings.

Previous studies had found Beijing genotype was associated with younger age, suggesting recent transmission in the population (Yang et al., 2012; Buu et al., 2012). In the study, Beijing genotype was also found to be associated with age group, yet, a further analysis in determining specific group using odd ratio (OR) could not be done statistically. Nonetheless, by observation, it was noted the proportion of older patients (> 55 age group) were lower among Beijing genotype compared to non - Beijing genotype. A further observation in


14

Table 4 showed halves of the patients in 15- 54 age group were infected with Beijing genotype. Hence, it was presumed the age group association observed in the study population was likely to reflect the endemic nature of Beijing genotype in Malaysia that is more prone to infect the most economically productive age group, mainly present in a latter group.

In relation to drug resistance, no significant association was observed among patients infected with Beijing genotype. This might be explained as drug resistance was not prominent in the study. The finding was disagreeable with former findings as Beijing genotype was frequently associated with drug resistance specifically MDR TB in various geographical settings (Glynn et al., 2002). According to Hanekom et al., (2011), the association hold true particularly in areas where the proportion of the Beijing genotype is increasing. The scenario could be worst due to socioeconomic deterioration, incompetent TB control management and prevalence of comorbid conditions. In Malaysia generally, Beijing genotype appeared to be endemic and not associated with the drug resistance (European Concerted Action on New Generation Genetic Markers Techniques for the Epidemiology Control of Tuberculosis, 2006).

Apart from that, there was no significant association observed between M. tuberculosis lineages and extra pulmonary sites of infection (Table 5). It was suggested frequency of the lineages depends more on geographical location rather than site of infection. The finding coincided with a study from North India as authors reported Central Asian (CAS) lineage remain confined in their study population as well as Indian subcontinent (Sankar et al., 2013). A very small proportion of the lineage was isolated from Malaysia and none from the present study. Besides that, SIT 745/EAI1-SOM which is particularly present in Malaysia was not reported in the North India proving that certain genotypes may have a minimum tendency to spread out. On the contrary, Beijing genotype was reported to be significantly associated with EPTB in Arkansas, USA (Kong et al., 2007) and was also found to be predominant among TBM patients in Thailand (Yorkangsukkamol et al., 2009; Faksri et al., 2011).

The phylogenetical tree (Figure 2) provided an overview of the parental links that probabyly exist between spoligotypes. The biggest node, SIT1/Beijing which was the most predominant genotype in our settings was located at the top of Fruchterman-Reingold tree without interconnection with other trees and descendent spoligotype. This may reflect the endemic stability feature of Beijing genotype in our settings which only had a very limited locally evolved Beijing variants (eg. in our study, SIT 265). On the contrary, majority of EAI genotypes were linked within a parental network (SIT 236) occupying the central position of the tree, suggesting ongoing local evolution of these lineage. SIT 745/ EAI1-SOM (26/28 isolates, 92.9 %) which was reported majority from Malaysia (Table 3) seems to be specific in Malaysia and was not widely spread in other countries. In parallel, recent sudy by Fazli et al., (2014) reported noticeable ongoing evolution of the SIT 745/EAI1-SOM in Malaysia and suggested reclassifiying SIT745/EAI1-SOM to SIT745/EAIMYS. It should therefore come as no suprise since EAI lineage is more prevalent in Southeast Asia and specific sublineages has been reported with phylogeographical specificity, e. g. EAI2-Manila in Phiiphines and EAI5-VNM in Vietnam (Douglas et al., 2003; Brudey et al., 2012). Unfortunately, our study did not clearly depicted the picture probably due to a small sample size. One also may noted a few orphan strains (OR 2, OR 5, OR 9 and OR 13) classifed as EAI lineages appeared at the tip of the tree without interconnection with the central parental network. These strains probably not represented well enough in the Kelantan TB endemic to have continued on infecting people.

Like other clinical studies, the present study also has several limitations. Since the study was the first baseline molecular typing study on EPTB isolates conducted in Malaysia particularly


15

in Kelantan state, conclusive findings could not be made. For this, a nationwide molecular typing on EPTB isolates should be initiated. However, such a preposition demand a huge economic implication. In addition, the study was carried out on comparatively small sample size, thus, overestimation of data could occur. Howbeit, study with a small number of subjects may offer expeditious investigation and research question can be addressed promptly. It is important to test a reliability of spoligotyping as first line genotyping tool in the M. tuberculosis strain diversity among EPTB isolates to avoid spending to many resources such as time and financial cost.

5. CONCLUSION The study provides an overview of M. tuberculosis heterogeneity from extrapulmonary isolates which may serve as a reference material for further genotyping studies on estimating the actual prevalence of M. tuberculosis associated with EPTB in Kelantan and Malaysia generally. We found that Beijing as the most predominant genotype and bulk of the strains associated with EPTB in our region also caused by new strain that is not available in the SITVIT WEB database. We suggest further study with larger sample size using spoligotyping as a first-line genotyping tools with the additional of secondary typing for a better discrimination of M. tuberculosis isolates. 6. REFERENCES Anh DD, Borgdorff MW, Van LN, Lan NT, van Gorkom T, Kremer K, et al. Mycobacterium

tuberculosis Beijing genotype emerging in Vietnam. Emerg Infect Dis. 2000;6(3):302-5. Brudey K, Driscoll JR, Rigouts L, Prodinger WM, Gori A, Al-Hajoj SA, et al.

Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC microbiology. 2006;6(1):23.

Buu TN, van Soolingen D, Huyen MN, Lan NT, Quy HT, Tiemersma EW, et al. Increased transmission of Mycobacterium tuberculosis Beijing genotype strains associated with resistance to streptomycin: a population-based study. PloS one. 2012;7(8):e42323.

Chan M, Borgdorff M, Yip C, De Haas P, Wong W, Kam K, et al. Seventy percent of the Mycobacterium tuberculosis isolates in Hong Kong represent the Beijing genotype. Epidemiology and infection. 2001;127(01):169-71. Choi GE, Jang MH, Song EJ, Jeong SH, Kim JS, Lee WG, et al. IS6110-Restriction Fragment Length Polymorphism and Spoligotyping Analysis of Mycobacterium tuberculosis Clinical Isolates for Investigating Epidemiologic Distribution in Korea. Journal of Korean Medical Science. 2010;25(12):1716-21.

Dale JW, Nor RM, Ramayah S, Tang TH, Zainuddin ZF. Molecular epidemiology of tuberculosis in Malaysia. Journal of Clinical Microbiology. 1999;37(5):1265-8.

Demay C, Liens B, Burguire T, Hill V, Couvin D, Millet J, et al. SITVITWEBA publicly available international multimarker database for studying Mycobacterium tuberculosis genetic diversity and molecular epidemiology. Infection, Genetics and Evolution. 2012;12(4):755-66.

Douglas JT, Qian L, Montoya JC, Musser JM, Van Embden JDA, Van Soolingen D, et al. Characterization of the Manila Family of Mycobacterium tuberculosis. Journal of Clinical Microbiology. 2003;41(6):2723-6.


16

European Concerted Action on New Generation Genetic, M., Techniques for The, E. & Control Of, T. (2006). Beijing/W Genotype Mycobacterium tuberculosis and Drug Resistance. Emerging Infectious Diseases, 12, 736-743.

Evans JT, Hawkey PM, Smith EG, Boese KA, Warren RE, Hong G. Automated High-Throughput Mycobacterial Interspersed Repetitive Unit Typing of Mycobacterium tuberculosis Strains by a Combination of PCR and Nondenaturing High-Performance Liquid Chromatography. Journal of Clinical Microbiology. 2004;42(9):4175-80.

Faksri, K., Drobniewski, F., Nikolayevskyy, V., Brown, T., Prammananan, T., Palittapongarnpim, P., Prayoonwiwat, N. & Chaiprasert, A. (2011). Epidemiological trends and clinical comparisons of Mycobacterium tuberculosis lineages in Thai TB meningitis. Tuberculosis, 91, 594-600.

Fazli I, Couvin D, Izzah F, Zaidah R, Rastogi N, Suraiya S. Study of Mycobacterium tuberculosis Complex Genotypic Diversity in Malaysia Reveals a Predominance of Ancestral East-African-Indian Lineage with a Malaysia-Specific Signature. PloS one. 2014;9(12):e114832.

Glynn, J. R., Whiteley, J., Bifani, P. J., Kremer, K., Van Soolingen, D., Glynn, J., Whiteley, J., Bifani, P., Kremer, K. & Van Soolingen, D. (2002). Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerging infectious diseases,8, 843.

Gomes T, Vinhas SA, Reis-Santos B, Palaci M, Peres RL, Aguiar PP, et al. Extrapulmonary tuberculosis: Mycobacterium tuberculosis strains and host risk factors in a large urban setting in Brazil. PloS one. 2013;8(10):e74517.

Gunal, S., Yang, Z., Agarwal, M., Koroglu, M., Arici, Z. & Durmaz, R. (2011). Demographic and microbial characteristics of extrapulmonary tuberculosis cases diagnosed in Malatya, Turkey, 2001-2007. BMC Public Health, 11, 154.

Hanekom, M., Gey Van Pittius, N., Mcevoy, C., Victor, T., Van Helden, P. & Warren, R. (2011). Mycobacterium tuberculosis Beijing genotype: A template for success. Tuberculosis, 91, 510-523.

Hermans P, Van Soolingen D, Bik E, De Haas P, Dale J, Van Embden J. Insertion element IS987 from Mycobacterium bovis BCG is located in a hot-spot integration region for insertion elements in Mycobacterium tuberculosis complex strains. Infection and immunity. 1991;59(8):2695-705.

Jou R, Chiang CY, Huang WL. Distribution of the Beijing Family Genotypes of Mycobacterium tuberculosis in Taiwan. J Clin Microbiol. 2005;43(1):95-100.

Kamerbeek J, Schouls L, Kolk A, Van Agterveld M, Van Soolingen D, Kuijper S, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. Journal of Clinical Microbiology. 1997;35(4):907-14.

Kong, Y., Cave, M. D., Zhang, L., Foxman, B., Marrs, C. F., Bates, J. H. & Yang, Z. H. (2007). Association between Mycobacterium tuberculosis Beijing/W Lineage Strain Infection and Extrathoracic Tuberculosis: Insights from Epidemiologic and Clinical Characterization of the Three Principal Genetic Groups of M. tuberculosis Clinical Isolates. J Clin Microbiol, 45, 409-14.

Kox L, Rhienthong D, Miranda AM, Udomsantisuk N, Ellis K, Van Leeuwen J, et al. A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples. Journal of clinical microbiology. 1994;32(3):672-8.

Ngeow YF, Yap SF. Molecular Epidemiology and Population Genetics of Tuberculosis: Akademi Sains Malaysia; 2006.

Phyu S, Stavrum R, Lwin T, Svendsen S, Ti T, Grewal HM. Predominance of Mycobacterium tuberculosis EAI and Beijing lineages in Yangon, Myanmar. Journal of clinical microbiology. 2009;47(2):335-44.


17

Prodinger WM, Bunyaratvej P, Prachaktam R, Pavlic M. Mycobacterium tuberculosis isolates of Beijing genotype in Thailand. Emerg Infect Dis. 2001;7(3):483-4.

Qian L, Van Embden JDA, Van Der Zanden AGM, Weltevreden EF, Duanmu H, Douglas JT. Retrospective Analysis of the Beijing Family of Mycobacterium tuberculosis in Preserved Lung Tissues. J Clin Microbiol. 1999;37(2):471-4.

Reyes JF, Francis AR, Tanaka MM. Models of deletion for visualizing bacterial variation: an application to tuberculosis spoligotypes. Bmc Bioinformatics. 2008;9(1):496.

Sankar MM, Singh J, Angelin Diana SC, Singh S. Molecular characterization of Mycobacterium tuberculosis isolates from North Indian patients with extrapulmonary tuberculosis. Tuberculosis. 2013;93(1):75-83.

Sunder S, Lanotte P, Godreuil S, Martin C, Boschiroli ML, Besnier JM. Human-to-Human Transmission of Tuberculosis Caused by Mycobacterium bovis in Immunocompetent Patients. J Clin Microbiol. 2009;47(4):1249-51.

Svastova P, Pavlik I, Bartos M. Rapid differentiation of Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis by amplification of insertion element IS901.

Tanaka MM, Phong R, Francis AR. An evaluation of indices for quantifying tuberculosis transmission using genotypes of pathogen isolates. BMC infectious diseases. 2006;6(1):92.

Tang C, Reyes JF, Luciani F, Francis AR, Tanaka MM. spolTools: online utilities for analyzing spoligotypes of the Mycobacterium tuberculosis complex. Bioinformatics. 2008;24(20):2414-5.

Tanveer, M., Hasan, Z., Siddiqui, A., Ali, A., Kanji, A., Ghebremicheal, S. & Hasan, R. (2008). Genotyping and drug resistance patterns of M. tuberculosis strains in Pakistan. BMC Infectious Diseases, 8, 171.

Van Soolingen D, Qian L, De Haas P, Douglas JT, Traore H, Portaels F, et al. Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia. Journal of Clinical Microbiology. 1995;33(12):3234-8.

WHO. Global tuberculosis report. 2013. Yang C, Luo T, Sun G, Qiao K, Sun G, DeRiemer K, et al. Mycobacterium tuberculosis

Beijing strains favor transmission but not drug resistance in China. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2012;55(9):1179-87.

Yang Z, Kong Y, Wilson F, Foxman B, Fowler AH, Marrs CF, et al. Identification of risk factors for extrapulmonary tuberculosis. Clinical infectious diseases. 2004;38(2):199-205.

Yorsangsukkamol, J., Chaiprasert, A., Prammananan, T., Palittapongarnpim, P., Limsoontarakul, S. & Prayoonwiwat, N. (2009). Molecular analysis of Mycobacterium tuberculosis from tuberculous meningitis patients in Thailand. Tuberculosis, 89, 304-309.

Documents

CIRCULATING STRAINS Mycobacterium tuberculosis ISOLATED FROM EXTRA-PULMONARY TUBERCULOSIS PATIENTS IN KELANTAN, MALAYSIA