Chemotactic activation of Dictyostelium AGC-family kinases AKT

983Research Article

IntroductionAKT protein kinases have consensus kinase, regulatory, and PH (pleckstrin homology) localization domains (Song et al., 2005);the latter allows recruitment to membrane-associatedphosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3], aproduct of phosphoinositide 3-kinase (PI3K) and related lipidmoieties (Park et al., 2008). Full activation of mammalian AKTrequires phosphorylation at two sites, a phosphoinositide-dependentkinase 1 (PDK1) site within the kinase activation loop and a PDK2site within the C-terminal hydrophobic motif (HM) (Alessi et al.,1996a; Chan and Tsichlis, 2001). The former is phosphorylated byphosphoinositide-dependent kinase 1 (PDK1), and the latter byTORC2, a multi-protein complex that includes the TOR (target of rapamycin) kinase (Sarbassov et al., 2005). Once activated, AKT phosphorylates substrates at the consensus motif(R/K)X(R/K)XX(S/T) (Alessi et al., 1996b; Obata et al., 2000).

Dictyostelium discoideum has been proven a unique and powerfulmodel for functional studies of AKT and related AGC [cAMP-dependent protein kinase (PKA), cGMP-dependent protein kinase(PKG) and protein kinase C (PKC)] protein kinases during cellularsignaling, chemotaxis, and development (McMains et al., 2008; Meiliet al., 2000; Meili et al., 1999). Individual Dictyostelium chemotaxtoward nutrient signals (e.g. folate) and propagate under nutrient-abundant conditions but, upon starvation, initiate multicellulardevelopment; developing cells secrete cAMP, which functions as aprimary signaling molecule, a chemoattractant, and a morphogen todirect multicellular development (McMains et al., 2008).

The closely related protein kinases AKT and PKBR1 ofDictyostelium are integrated in multiple pathways to organize cellpolarity, chemoattractant sensing, and differentiation (Kamimura etal., 2008; McMains et al., 2008; Meili et al., 2000; Meili et al., 1999).Dictyostelium AKT is a definitive ortholog of metazoan AKT,sharing highly related kinase, regulatory, and N-terminal PH domains(Tanaka et al., 1999). Although PKBR1 has similar kinase and C-terminal regulatory domains, it lacks the defining PH domain (Meiliet al., 2000). PKBR1 is myristoylated and associates with membranecompartments independently of PtdIns(3,4,5)P3. The shared kinaseand regulatory domains, but different localization motifs, suggestfunctional overlap and specialized activities of AKT and PKBR1.

Previous data had shown that AKT and PKBR1 are phosphorylatedat both PDK1 and PDK2/HM sites during development in responseto the chemoattractant cAMP (Kamimura et al., 2008). But theseparate functions of these phosphorylations in the regulation of AKTand PKBR1 activity had not been addressed and the specific role ofPDK1 is unknown. Using a series of Dictyostelium strains that aredefective in PtdIns(3,4,5)P3-, PDK1- and TORC2-signaling or thatexpress phospho-site mutants of AKT and PKBR1, we investigatedcommon and distinct pathways that regulate AKT and PKBR1 inresponse to stimulation during growth by folate and development bycAMP. We demonstrate that PDK1 in Dictyostelium is activatedindependently of PI3K/PtdIns(3,4,5)P3 signaling, but that PDK1-sitephosphorylation is absolutely required for activation of both AKTand PKBR1; phosphorylation by TORC2 is insufficient to activateeither kinase. However, PDK1 and TORC2 show cooperative

Chemotactic activation of Dictyostelium AGC-familykinases AKT and PKBR1 requires separate butcoordinated functions of PDK1 and TORC2Xin-Hua Liao, Jonathan Buggey* and Alan R. Kimmel‡

Laboratory of Cellular and Developmental Biology, NIDDK, National Institutes of Health, Bethesda, MD 20892-8028, USA*Present address: School of Medicine, Georgetown University, Washington, DC 20057, USA‡Author for correspondence ([email protected])

Accepted 21 December 2009Journal of Cell Science 123, 983-992© 2010. Published by The Company of Biologists Ltddoi:10.1242/jcs.064022

SummaryProtein kinases AKT and PKBR1 of Dictyostelium belong to the AGC protein kinase superfamily. AKT and PKBR1 are phosphorylatedat similar sites by phosphoinositide-dependent kinase 1 (PDK1) and TORC2 kinases; however, they have different subcellular localizingdomains. AKT has a phosphoinositide 3-kinase (PI3K)/phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3]-regulated PH(pleckstrin homology) domain whereas PKBR1 is myristoylated and persistently membrane localized. Using strains defective forPI3K/PtdIns(3,4,5)P3-, PDK1- and TORC2-signaling or strains that express phospho-site mutants of AKT and PKBR1, we dissect thedifferent roles of PI3K/PtdIns(3,4,5)P3, PDK1 and TORC2. We show that activation of AKT and PKBR1 requires PDK1-sitephosphorylation, but that phosphorylation by TORC2 is insufficient for AKT or PKBR1 activation. However, PDK1-site phosphorylationis dependent on phosphorylation by TORC2, which suggests that there is regulatory coordination among PDK1, TORC2 and theirphospho-site targets. This defines a separate input for signaling in control of chemotaxis and dependency on PDK1 function. We alsodemonstrate that PDK1 in Dictyostelium functions independently of PI3K/PtdIns(3,4,5)P3. Finally, we show that AKT and PKBR1exhibit substrate selectivity and identify two novel lipid-interacting proteins preferentially phosphorylated by AKT. Despite certainsimilarities, AKT and PKBR1 have distinct regulatory paths that impact activation and effector targeting, with PDK1 serving a centralrole.

Key words: PDK1, Chemotaxis, PI3K/PtdIns(3,4,5)P3, BAR domains, PH domains, TORC2

Jour

nal o

f Cel

l Sci

ence

984

interactions. Loss of phosphorylation at the PDK2/HM site preventsphosphorylation at the PDK1 site. Thus, previously defined functionsof TORC2 are dependent upon PDK1. In addition, loss of PDK1enzyme may lead to reduced phosphorylation at the PDK2/HM site.PDK1 thus defines a new regulatory input for signaling downstreamof the chemoattractant receptors. Finally, we show that AKT andPKBR1 exhibit substrate selectivity and identify two novel lipid-interacting proteins preferentially phosphorylated by AKT. Our dataprovide unique mechanistic differences for the regulation and functionof AKT and PKBR1 and context for the complexity of PDK1 andTORC2 regulation of multiple AGC protein kinases.

ResultsAKT and PKBR1 are differentially phosphorylated andactivated by stimulation with folate and cAMPWe compared regulation of AKT and PBR1 by chemotacticsignaling during growth and development. We chose antibodies thatspecifically recognize phosphorylated sequences within the kinase[PDK1 site; pTFCGTPEYLAPE (pT278 for AKT and pT309 forPKBR1)] and C-terminal HM regulatory [PDK2/HM site;FEGFpTYVA (pT435 for AKT and pT470 for PKBR1)] domainsidentical in both AKT and PKBR1 (Fig. 1A). AKT and PKBR1show low PDK1- and PDK2/HM-site phosphorylations in quiescentcells, but rapid (<15 seconds), transient phosphorylation duringgrowth in response to folate and development in response to cAMP(Fig. 1B). Although the predicted sizes of AKT and PKBR1 arenearly identical, they migrate differently. Mobilities were confirmedusing purified proteins, and phosphorylation specificity confirmedwith akt-, pkbR1- and akt/pkbR1-null strains (Fig. 1B,supplementary material Fig. S1A,B).

AKT and PKBR1 exhibit substrate preferencesThe AKT and PKBR1 kinase domains are extremely related andphosphorylate the same substrate motif (R/K)X(R/K)XX(pS/pT)as mammalian AKTs (Alessi et al., 1996b; Kamimura et al., 2008;Obata et al., 2000). Following stimulation with folate or cAMP,we detected a series of phospho-proteins (P300, P250, P165, P105,P95, P78, P65 and P53) using the -AKT phospho-substrate probe(Fig. 1C). Although each protein generally responds to both folateand cAMP, their relative stimulations to each vary. This suggeststhat there may be differential actions of AKT and PKBR1 duringgrowth compared with development. Partly this relates to thediffering relative expression levels of AKT and PKBR1 duringgrowth and development (Meili et al., 2000; Meili et al., 1999).Regardless of chemoattractant, the substrate phosphorylationsfollow similar induction kinetics for AKT/PKBR1 phosphorylationand are absent in cells lacking both AKT and PKBR1(supplementary material Fig. S1C). Some of the proteins may havebeen previously identified (Kamimura et al., 2008); P250 may beTalin B, P105 may be RasGef5 or PI5K, and P65 may beRhoGAP/GacQ. P300, P165 and P95 are not yet characterized;proteins P78 and P53 had not been previously identified (seebelow).

We focused on the preferential targets for each kinase.Phosphorylation of P78 and P53 is most sensitive to loss of AKT(Fig. 1D), but is enhanced in folate- and cAMP-stimulated pkbR1-null cells, whereas P65 phosphorylation levels are significantlysuppressed in pkbR1-null cells (Fig. 1E). Other proteins are lessspecifically impacted by loss of either AKT or PKBR1. Weconclude that P78/P53 and P65 phosphorylations represent specificreadouts for the activities of AKT and PKBR1, respectively.

AKT and PKBR1 are differentially sensitive to regulationby TORC2The PDK2/HM site within the C-terminal regulatory domain of AGCkinases is primarily phosphorylated by the TOR kinase, as part ofTORC2 (Kamimura et al., 2008; Lee et al., 2005; Sarbassov et al.,2005). Loss of the TORC2 subunit Rictor [rapamycin-insensitivecompanion of mTOR; Dictyostelium Pia, (pianissimo)] does not alterexpression of AKT or PKBR1 (Lee et al., 2005), but blocks cAMP-induced phosphorylation at both PDK1 and PDK2/HM sites ofPKBR1 (Kamimura et al., 2008), and mostly blocks phosphorylationof AKT (Fig. 2A); substrate phosphorylations (P78, P65 and P53)by AKT and PKBR1 are also blocked (Fig. 2A). Whereas folate-stimulated phosphorylation of AKT and PKBR1 is inhibited inrictor(pia)-null cells, basal phosphorylation of AKT at both PDK1and PDK2/HM sites persists and AKT substrates P53 and P78 exhibitconstitutive basal phosphorylation (Fig. 2A). Thus, Rictor(Pia) (orperhaps even TORC2) is not required for all PDK2/HMphosphorylations in Dictyostelium.

Because the PDK1 site of PKBR1 is not phosphorylatedfollowing cAMP stimulation of rictor(pia)-null cells, PDK1phosphorylation must be dependent upon phosphorylation at thePDK2/HM site. A similar observation has been described in certainmammalian cells in which TORC2 activity has been biochemicallyinhibited (Garcia-Martinez et al., 2009). Although TORC2 isrequired to activate PKBR1 (Kamimura et al., 2008; Lee et al.,2005), it may not directly regulate enzymatic activity, but couldfunction primarily to facilitate phosphorylation by PDK1, a principalregulatory pathway for activity of metazoan AKTs (Balendran etal., 1999; Yang et al., 2002).

We also examined TORC2 regulation of AKT and PKBR1 incells deficient in TORC2 components Lst8 (lethal with sec-thirteenprotein 8) and SIN1 [SAPK (stress-activated MAP kinase)interacting protein 1; Dictyostelium RIP3 (Ras-interacting protein3)]. lst8-null cells resemble a weaker phenotype of rictor(pia)-nulls,with reduced PDK1- and PDK2/HM-site phosphorylations, anddelayed and suppressed AKT/PKBR1 substrate phosphorylation(Fig. 2B). More dramatic differences between PDK2/HM phospho-regulation of AKT and PKBR1 are observed in cells lackingSIN1(RIP3) (Fig. 2C). sin1(rip3)-null cells show weakphosphorylation of PKBR1, but phosphorylation of AKT issignificantly upregulated by both folate and cAMP when comparedwith that in wildtype (WT) cells. sin1(rip3)-null cells also exhibita significant increase in the phosphorylation of the AKT substratesP78 and P53. These data partially explain the comparatively weakdevelopmental phenotype of sin1(rip3)-null cells compared withrictor(pia)-nulls (Lee et al., 2005) and suggest that the subunitcomposition of TORC2 can influence its substrate targeting.

AKT and PKBR1 are differentially sensitive to PI3KsignalingClass I PI3Ks are the primary kinases that generate PtdIns(3,4,5)P3.Dictyostelium has at least five class I PI3Ks. pi3k1-5-null strain haslow levels of PtdIns(3,4,5)P3 during development. Whereas AKTkinase activity is unresponsive to cAMP stimulation in this strain,PKBR1 is membrane-associated independently of PtdIns(3,4,5)P3

levels and is activated independently (Kamimura et al., 2008; Leeet al., 2005; Meili et al., 2000; Takeda et al., 2007). To understandmechanistic differences, we monitored effects of varying levels ofPtdIns(3,4,5)P3 in response to folate and cAMP.

pi3k1-6-null cells are mutated for all five PI3K class I genes plusa more distantly related PI3K gene, pikH (Hoeller and Kay, 2007).

Journal of Cell Science 123 (6)

Jour

nal o

f Cel

l Sci

ence

985PDK1/TORC2 regulation of Dictyostelium AGC kinases

Basal and stimulated phosphorylation of AKT at PDK1 andPDK2/HM sites are significantly inhibited in pi3k1-6-null and pi3k1-5-null strains (Fig. 3A,B). By contrast, phosphorylation of PKBR1was unchanged.

We reasoned that loss of the PtdIns(3,4,5)P3 phosphatase PTENmight stabilize the minimal levels of PtdIns(3,4,5)P3 synthesizedin cells lacking PI3K1-5 and rescue AKT response, withoutimpacting PKBR1 (Fig. 3B). Secondary loss of PTEN in cellslacking PI3K1-5 showed rescue of AKT phosphorylation inresponse to both folate and cAMP, and increased phosphorylation

of AKT targets P78 and P53. P78 and P53 responses were alsoenhanced in pten-null cells compared with those in WT cells;phosphorylation of PKBR1 was unchanged in both PTEN-deficientstrains (Fig. 3B,C).

To follow PtdIns(3,4,5)P3 signaling further we studied dose-dependent effects of LY294002 (LY), a phosphoinositide kinase-related kinase (PIKK)-family inhibitor, on phosphorylation atPDK1 and PDK2/HM sites. LY is often presumed to have‘specificity’ for PI3K, but at high concentrations can targetmammalian TOR kinase (Brachmann et al., 2009; Toral-Barza et

Fig. 1. AKT and PKBR1 are activated bychemoattractant stimulation with cAMP andfolate and phosphorylate preferential substrates.(A)Generic diagram of AKT and PKBR1 withphosphorylated threonine at PDK1 and PDK2/HMsites. (B-E)WT, akt–/pkbR1–, akt–, and pkbR1–

cells were collected seconds (S) followingstimulation with cAMP or folate and assayed byimmunoblot with -phospho-PDK1 site (p-PDK1),-phospho-PDK2 site (p-PDK2), -actin, and/or-AKT substrate motif (p-Substrate). Wildtype(WT) substrate bands are indicated. P78 and P53are preferentially phosphorylated by AKT. P65 ispreferentially phosphorylated by PKBR1.

Jour

nal o

f Cel

l Sci

ence

986

al., 2005). LY effects on AKT and PKBR1 were markedly distinct(Fig. 3D). AKT phosphorylation at both PDK1 and PDK2/HM siteswas identically inhibited with an EC50 of ~15 M, whereas ~100 M of LY was required to inhibit both PKBR1-sitephosphorylations to 50%.

At low concentrations (<30 M), LY is relatively specific forPI3K/AKT and inhibits recruitment of AKT to membranecompartments and availability for phosphorylation by PDK1 andTORC2. Thus, the inhibitory effects of LY on PDK1- and PDK2/HM-site phosphorylations are perfectly superimposable for AKT.

At higher concentrations (>100 M) of LY, PDK2/HM-sitephosphorylation of PKBR1 is inhibited. Because phosphorylationat the PDK2/HM site is required for PDK1 phosphorylation, theinhibitory effects of LY on PDK1- and PDK2/HM-sitephosphorylations are also perfectly superimposable. Theseconclusions differ from previous assumptions about the effects ofLY in Dictyostelium, which have uniformly viewed LY as specificfor PI3K and AKT, regardless of the concentrations used.Furthermore, since both PDK1- and PDK2/HM-sitephosphorylations of PKBR1 are resistant to the inhibitory effects

of LY on PI3K, PDK1 kinase activity in Dictyostelium must functionindependently of PtdIns(3,4,5)P3 signaling.

Dictyostelium PDK1 regulates AKT and PKBR1,chemotaxis and development independently ofPtdIns(3,4,5)P3

As genetic and biochemical inactivation of TORC2 simultaneouslyblocks phosphorylation at both PDK2/HM and PDK1 sites,significance of PDK1 phosphorylation in the regulation of AKTand PKBR1 is unknown. To separate the PDK1 and TORC2 kinasefunctions, we identified two Dictyostelium PDK1 orthologs, PdkAand PdkB, with conserved PDK1-type kinase domains as well asC-terminal PH domains characteristic of all PDK1 kinases. We alsogenerated strains deficient in either gene or in both.

pdkA- and pdkA/B-null cells showed no detectable PDK1phosphorylation of PKBR1 when stimulated with folate, and onlyminimal levels with cAMP (Fig. 4A). Loss of PdkB alone had onlyminimal impact on the phosphorylations and activities of AKT andPKBR1. Thus, PdkA appears to be the predominant regulatorykinase for both PKBR1 and AKT. PDK2/HM phosphorylation of


Fig. 2. AKT and PKBR1 are differentiallysensitive to regulation by TORC2.(A-C)WT, rictor–(pia–), and SIN1–(rip3–)cells were collected following stimulationwith cAMP or folate and assayed byimmunoblot with -phospho-PDK1 site (p-PDK1), -phospho-PDK2 site (p-PDK2), -actin and -AKT substrate motif (p-Substrate).

Jour

nal o

f Cel

l Sci

ence


PKBR1 was observed in folate- and cAMP-stimulated pdkA- andpdkA/B-null cells but, compared with WT and pdkB-null cells, P65phosphorylation was undetected in folate-treated cells, and highlyreduced in cAMP-treated cells. Thus, PDK2/HM-sitephosphorylation, in the absence of PDK1-site phosphorylation, isnot sufficient for activation of PKBR1. AKT regulation wassimilarly impacted. In folate-treated pdkA- and pdkA/B-null cells,AKT has basal PDK1 phosphorylation and activated PDK2/HM-site phosphorylation, but only poor phosphorylation of the AKTsubstrates P78 and P53. In cAMP-treated pdkA- and pdkA/B-nullcells, PDK2/HM-site phosphorylation of AKT was reduced slightly.

As expected of cells that poorly activate AKT and PKBR1, pdkA-null cells do not aggregate at low density in submerged culture (Fig.4B), whereas aggregation of pdkB-null cells is similar to that in

WT cells (data not shown). When plated on solid substrata at highcell densities, pdkA-null cells formed much smaller aggregates andterminal developmental structures compared with those of WT cells(Fig. 4C), whereas pdkB-null cells formed smaller aggregates thandid the WT. However, the pdkA/B-null cells have more severedevelopmental defects and fail to develop during the 24 hour time-course, which suggests there are developmental regulatory functionsfor PDK1 beyond AKT and PKBR1.

Although phosphorylation at the PDK1 site is critical for activationof AKT and PKBR1, PKBR1 is activated independently of PI3K.The LY and pi3k-null data reconcile these observations and showthat PDK1 phosphorylation in Dictyostelium occurs independentlyof PtdIns(3,4,5)P3-signaling. To examine this more directly, weexpressed a GFP-PdkA fusion in pdkA-null cells and monitored lipid

Fig. 3. AKT and PKBR1 are differentiallyregulated by PI3K signaling. (A-C)WT,pi3k1–6–, pi3k1-5–, pi3k1-5–/pten– and pten–

cells were collected following stimulationwith cAMP or folate and assayed byimmunoblot with -phospho-PDK1 site (p-PDK1), -phospho-PDK2 site (p-PDK2), -actin and -AKT substrate motif (p-Substrate). (D)Differential effects of LY onPDK1/2 phosphorylation of AKT andPKBR1. WT cells were pre-treated withvarious doses of LY and collected 15 secondsfollowing stimulation with folate; they wereassayed by immunoblot with -phospho-PDK1 site (p-PDK1), -phospho-PDK2 site(p-PDK2) and -actin. Bandphosphorylations were quantified andnormalized to 1 for 0M LY.

Jour

nal o

f Cel

l Sci

ence

988

interaction specificity (Fig. 4D). Although GFP-PdkA can rescue themutant phenotype, it exhibits no PtdIns(3,4,5)P3-binding specificitywhen compared with a control, the PH domain of CRAC. Further,structural predictions of the PdkA and PdkB PH domain are notconsistent with PtdIns(3,4,5)P3 interaction (Park et al., 2008). Incontrast to mammalian PDK1, Dictyostelium PDK1 functionsindependently of PtdIns(3,4,5)P3 signaling (Fig. 4D).

PDK2/HM-site phosphorylation of PKBR1 and AKT is notsufficient for kinase activation by folate or cAMPThe TORC2-inactivation studies indicate that PDK1-sitephosphorylation of AKT and PKBR1 is dependent upon

phosphorylation at the PDK2/HM site, but data from pdkA- andpdkA/B-null cells indicate that PDK2/HM-site phosphorylationsalone are insufficient for activation of AKT and PKBR1. To addressinter-dependency of PDK1 and PDK2/HM phosphorylation moredirectly, we studied cells expressing PDK1- or PDK2/HM-site-specific mutants of AKT and PKBR1, respectively; T309A andT470A for PKBR1, and T278A and T435A for AKT.

Re-expression of PKBR1WT in pkbR1-null cells fully rescuedfolate- and cAMP-regulated phosphorylation of PKBR1, substratephosphorylation of P65, and development (Fig. 5A,B). pkbR1-nullcells expressing the PDK2/HM mutant PKBR1T470A was similar tothe pkbR1-null parental. There was no rescue of PDK1


Fig. 4. Dictyostelium PDK1 regulates AKT andPKBR1, and chemotaxis and developmentindependently of PtdIns(3,4,5)P3. (A)WT, pdkA–,pdkB– and pdkA/B– cells were collected followingstimulation with cAMP or folate and assayed byimmunoblot with -phospho-PDK1 (p-PDK1), -phospho-PDK2 site (p-PDK2), -actin and -AKTsubstrate motif (p-Substrate). (B)WT and pdkA– cellswere plated in submerged culture at 1�105 cells/cm2

and imaged after 8 hours. (C)WT, pdkA–, pdkB– andpdkA/B– cells were plated on solid substrata anddeveloped for 24 hours; arrows indicate sori ofterminally differentiated organisms. (D)Lipid bindingassay for PdkA. Cell extracts from pdkA-nullsexpressing functional GFP-PdkA were incubated with aPIP lipid strip, as indicated. Bound proteins weredetected with -GFP. WT cells expressing GFP or GFPfused to CRAC were controls. Relative expression wasdetermined by immunoblot with -GFP. (E)PI3K,PDK1 and TORC2 regulation of AKT and PKBR1.PI3K regulates PtdIns(3,4,5)P3 accumulation andrecruitment of AKT to membranes. Membrane-boundAKT and PKBR1 are phosphorylated by PDK1 andTORC2 independently of PI3K.

Jour

nal o

f Cel

l Sci

ence


phosphorylation, consistent with PDK1-site phosphorylationrequiring phosphorylation at the PDK2/HM site, and no rescue ofp65 substrate phosphorylation or of development.

Focus on the PDK1 mutant PKBR1T309A is more revealing (Fig.5A,B). Expressed PDK1 mutant PKBR1T309A in pkbR1-null cellsfails to phenotypically rescue P65 substrate phosphorylation or

development; despite the high levels of PDK2/HM phosphorylation,the PKBR1T309A-expressing cells are phenocopies of the pkbR1-null parent.

Similar functional conclusions can be derived from studies ofmutated AKT. Expression of AKTWT rescues phosphorylation ofAKT, P78 and P53 (Fig. 5C). Expression of the PDK1 mutant

Fig. 5. PDK2/HM phosphorylation of PKBR1and AKT is not sufficient for activation bycAMP. (A)pkbR1– cells transfected with controlvector or vectors engineered to expressPKBR1WT, PKBR1T309A, or PKBR1T470A andcollected following stimulation with cAMP orfolate and assayed by immunoblot with -phospho-PDK1 (p-PDK1), -phospho-PDK2site (p-PDK2), -actin, and -AKT substratemotif (p-Substrate). (B)The various pkbR1–

strains (see Fig. 5A) were plated on solidsubstrata and developed for 24 hours; arrowsindicate terminally differentiated organisms.(C)akt– cells transfected with control vector orvectors engineered to express AKTWT,AKTT278A, or AKTT435A and collected followingstimulation with either cAMP or folate andassayed by immunoblot with -phospho-PDK1(p-PDK1), -phospho-PDK2 site (p-PDK2), -actin and -AKT substrate motif (p-Substrate).(D)A generic diagram of AGC kinases AKTand PKBR1 indicating the coordination ofkinases PDK1 and TORC2 to phosphorylate thethreonine residues in the kinase and C-terminaldomains, respectively, at PDK1 and PDK2/HMsites.

Jour

nal o

f Cel

l Sci

ence

990

AKTT278A in akt-null cells shows PDK2/HM-site phosphorylation,no PDK1-site phosphorylation, and no rescue of P78 and P53phosphorylation above vector controls. Only weak PDK1phosphorylation of AKT is observed with the PDK2/HM mutantAKTT435A.

We conclude that PDK1-site phosphorylation is an obligatoryactivation step for both PKBR1 and AKT, but phosphorylation byTORC2 is wholly insufficient for their activations. AlthoughTORC2 is essential for the activation of AKT and PKBR1, it mayprimarily function to make AKT and PKBR1 permissive fortargeting by PDK1 (Fig. 5D). Potentially, TORC2 has only minimalimpact on the overall enzymatic activity of AKT and PKBR1.

Possibly other interacting and coordinating processes regulatePDK1 and TORC2 phosphorylation of AKT and PKBR1. AlthoughPDK2/HM-site phosphorylation of AKT and PKBR1 is unaffectedif the PDK1 is unphosphorylated, PDK2/HM-site phosphorylationmay be impacted by loss of the PDK1 enzymes (Fig. 4A,D).

The two preferential AKT substrates possess lipid-interacting motifsTo identify substrates preferentially targeted by AKT, we used folateto stimulate strains fully deficient (i.e. akt-null) or hyper-activated(e.g. rip3- or pten-null) for AKT (see Fig. 1D, Fig. 2C, Fig. 3C).Cell extracts from rip3-null cells that had been stimulated with folatefor 15 seconds show very high levels of P78 and P53phosphorylation, whereas these phosphorylations are highlysuppressed in folate-treated akt-null cells (Fig. 6A). By contrast,phosphorylation of the PKBR1 substrate P65 is observed in akt-

null cells. We purified the substrates using immobilized antibodiesto the AKT phospho-substrate site. Immunoblot confirmed enrichedrecovery of AKT substrates P78 and P53 from the rip3- and pten-null cells (Fig. 6A).

Immunopurified proteins from akt- and rip3-null cells wereseparated by electrophoresis, extracted from the 78 and 53 kDa gelregions, and analyzed by LC/MS/MS peptide sequencing. For P78,we obtained 25 unique peptides/25 unique spectra that identified(100% probability) a novel 86 kDa protein from Dictyostelium. NoDictyostelium peptides were identified in the 78 kDa region fromthe akt-null control. For the 53 kDa region, we also identified asingle Dictyostelium protein (53 kDa) (99% probability). To confirmthat both P78 and P53 were AKT targets, we fused a TAP-codingsequence with the endogenous genomic loci and demonstrated thatboth P78 and P53 exhibited a gel mobility shift to a new proteinband that was co-detected with -TAP (Fig. 6B).

The amino acid sequence of P78 offers several interestingcharacteristics (Fig. 6C). Its N-terminus is defined by a protein-protein interacting SAM (sterile alpha motif) module and adownstream PH-domain; we refer to P78 as PHAPS, PH/AKT-preferential substrate. Structural considerations suggest that the PHdomain of PHAPS would not interact strongly with PtdIns(3,4,5)P3

(Park et al., 2008) and so it would not be simultaneously recruitedto membrane compartments with AKT. Re-examination of theLC/MS/MS peptide sequencing data confirms the phospho-peptideTTpTISIGK, within a consensus AKT recognition motif,KKRTTpTISIGK (Fig. 6C). During characterization studies, wedetected two PHAPS genes (supplementary material Fig. S2).

P53 has an N-terminal BAR (Bin/Amphiphysin/Rvs) domain anda C-terminal SH3 domain and is termed SHAPS, SH3/AKT-preferential substrate (Fig. 6C). The SH3 motif is a wellcharacterized protein-protein interaction domain and the BARmotif is implicated in lipid binding and membrane curvaturesensing (Frost et al., 2009; Itoh and Takenawa, 2009; Peter et al.,2004). SHAPS may be a Dictyostelium equivalent of the bridgingintegrator (or amphiphysin) proteins implicated in cell polarizationand phagocytosis in several species (Prendergast et al., 2009).

DiscussionDictyostelium AGC kinases AKT and PKBR1 are phosphorylatedat PDK1 and PDK2/HM sites, have similar kinase domains, andphosphorylate the same substrate motif (Fig. 1A). However, theyhave distinct regulatory inputs. Dictyostelium AKT activationrequires PI3K signaling; inhibition of PtdIns(3,4,5)P3 signalingblocks AKT recruitment to membrane compartments andconsequent phosphorylation by both PDK1 and TORC2. PKBR1lacks a defining AKT regulatory PH-domain and is activatedindependently of PI3K/PtdIns(3,4,5)P3 (Kamimura et al., 2008; Leeet al., 2005; Meili et al., 2000; Meili et al., 1999). We nowdemonstrate an essential function for PtdIns(3,4,5)P3-independentregulation of PDK1 in the activation of both AKT and PKBR1 (Fig.4E). We also describe unique interactions and dependencies ofPDK1 and TORC2 in AKT and PKBR1 regulations and differentialspecificity toward downstream targets (Fig. 5D). These dataemphasize a new regulatory input in the pathway through PDK1that is separate from PI3K or TORC2 (Fig. 4E).

Phosphorylation of the PDK2/HM site by Dictyostelium TORC2has been well described. However, its contribution to AKT andPKBR1 activity has not been clear and the function of PDK1phosphorylation has been entirely unknown. We now show thatphosphorylation of the PDK2/HM site is completely insufficient


Fig. 6. Purification and identification of AKT preferential substratesPHAPS and SHAPS. (A)akt– and rip3– cells were lysed 15 seconds afterfolate stimulation. Samples from cell lysates and AKT-substrateimmunoprecipitations (IP) were immunoblotted with -phospho-AKTsubstrate. (B)Confirmation of P78 and P53 as AKT substrates. The TAPepitope was fused to the endogenous P78 and P53 gene loci by targetedhomologous recombination; there are two P78 genes in Dictyostelium(supplementary material Fig. S2) and only 1 P53 gene. Equivalent cell samplevolumes of WT, P78-TAP or P53-TAP cells were collected at various timesfollowing stimulation with folate and assayed by immunoblot with -phospho-AKT substrate and -TAP. A new band detected by both antibodies isindicated by an arrow in each TAP cell and is absent in WT cells. P53 isdetected only in WT cells. (C)Structure of PHAPS and SHAPS. PHAPS (P78)contains SAM and PH domains and the phosphorylated AKT motifKKRTTpT. SHAPS (P53) contains BAR and SH3 domains.

Jour

nal o

f Cel

l Sci

ence


for activation of either PKBR1 or AKT. Neither is activated in theabsence of PDK1-site phosphorylation, data and conclusionsconsistent with observations in other systems, where activation ofAKT absolutely requires phosphorylation by PDK1 (Bellacosa etal., 1998; Mora et al., 2003; Williams et al., 2000). In contrast tomammalian PDK1, Dictyostelium PDK1 lacks PtdIns(3,4,5)P3-binding specificity and functions independently ofPI3K/PtdIns(3,4,5)P3 signaling (Fig. 4E). These conclusions arefurther supported by structural analysis of the PH domains of PdkAand PdkB (Park et al., 2008).

While activation of both PKBR1 and AKT requiresphosphorylation by PDK1, phosphorylation by PDK1 is mediatedby PDK2/HM-site phosphorylation (Fig. 5D); PKBR1 (or AKT) isinactive in cells that lack functional TORC2 or that express PKBR1(or AKT) carrying a PDK2/HM phospho-site mutation. PDK2/HM-site phosphorylation by TORC2 in the regulation of AKT activityis complex and has differing functions. PDK2/HM-sitephosphorylation can allosterically enhance AKT activity (Biondiet al., 2000), can slightly broaden substrate specificity of activatedAKT (Jacinto et al., 2006), but can also promote interactions withPDK1 to promote AKT phosphorylation at the PDK1 site withinits kinase activation loop (Balendran et al., 1999; Yang et al., 2002).This latter mechanism may be the significant regulatory role ofTORC2 in the activation of AKT and PKBR1 in Dictyostelium.However, PDK1 and PDK2/HM-site phosphorylations may be toorapid to demonstrate that PDK2/HM-site phosphorylation precedesthat of PDK1 (Fig. 4E, Fig. 5D). Alternatively, in the absence ofPDK2/HM-site phosphorylation, phosphorylation of the PDK1 sitemay occur normally, but become rapidly de-phosphorylated.

Although PDK1 phosphorylation of AKT and PKBR1 requiresphosphorylation at the PDK2/HM site, the opposite is not the case.PDK2/HM-site phosphorylation persists in AKT and PKBR1protein kinases that carry PDK1 phospho-site mutations.Nonetheless, data from cells lacking PdkA suggest the potential forfunctional interaction between PDK1 and TORC2 that mediatesefficient phosphorylation of AKT and PKBR1 at both PDK1 andPDK2/HM sites (Fig. 5D). Dictyostelium may provide a uniqueapproach to study interactions among PDK1 and PDK2/HM sitesand their upstream kinases, PDK1 and TORC2. It should be notedthat, although absolute cross-dependency of PDK1- and PDK2/HM-site phosphorylations is not universal, similar mechanisms mayoccur in other systems (Garcia-Martinez et al., 2009; Jacinto et al.,2006; Williams et al., 2000).

Despite the differences in their regulation and localization (Fig.4E), AKT and PKBR1 have been viewed as functionally identicaland inferred to exhibit minimal substrate preference (Kamimura etal., 2008). However, in addition to the distinct regulatory paths foractivation of AKT and PKBR1, we now demonstrate that thesekinases have substrate preferences and identify two novel AKTsubstrates, PHAPS and SHAPS. Both PHAPS and SHAPS havelipid-binding motifs and protein interaction domains. No equivalentPHAPS protein is identified in other systems. SHAPS, however, ispart of the BIN/amphiphysin family. Consistent with the targetedphosphorylation of SHAPS following chemotactic stimulation,BIN/amphiphysin proteins are implicated in a wide array ofmembrane processes, including actin function, interaction with smallGTPases and other signaling pathways, and clathrin-mediatedendocytosis (Frost et al., 2009; Peter et al., 2004; Yamada et al.,2007). PHAPS and SHAPS may function as adapters to recruitcomponents to membrane compartments and are potentiallyregulated by differential states of phosphorylation.

Materials and MethodsStrains and genesDictyostelium strain ID names are: akt– (DBS0236784), pkbR1– (DBS0236785),akt–/pkbR1– (DBS0236785), pi3k1-6– (DBS0252653), pi3k1-5– (DBS0252652),pi3k1-5–/pten– (DBS0252654), pten– (DBS0252655), rip3– and pia– strains werecourtesy of Richard Firtel (UCSD, La Jolla, CA). akt–/pkbR1– and pi3k1-6– strainswere grown in association with Klebsiella aerogenes bacteria.

Gene ID names are SHAPS (DDB_G0288895), PHAPS (DDB_G0271552), PdkA(DDB_G0281471), PdkB (DDB_G0284489), AKT (pkbA DDB_G0268620) andPKBR1 (pkbG DDB_G0290157).

Dictyostelium developmentGrowing cells were washed and spread evenly on pre-boiled black filters on wetpaper pads. For aggregation, growing cells were washed and incubated in microtitrewells. After 8 hours, cells in the center of each well were imaged.

AKT and PKBR1 phosphorylationcAMP and folate stimulations are modifications (Liao and Kimmel, 2009).Immunoblots used -phospho-PDK1 site (Cell Signaling), -phospho-PDK2/HM site(Cell signaling), -phospho-AKT Substrate (Cell Signaling), and -Actin (Santa CruzBiotechnology).

AKT, PKBR1, PdkA, SHAPS and PHAPSAKT and PKBR1 were mutated using QuikChange II (Stratagene). pGEX was usedfor bacterial expression and PDXA was used for Dictyostelium expression.

We used primer pairs 5�-GGATCCATGTCAACAGCACCAATTAAACATG-3�and 5�-CTCGAGTTATCTTAAATGTTCAGATTCAGCGAC-3� to amplify AKT andprimers pairs 5�-GGATCCATGGGAAAAGGACAAAGTAAAATAAAG-3� and 5�-CTCGAGTTAATCCTTTAAGATTGAATCAGCTACA-3� to amplify PKBR1 proteincoding regions from mRNA. Point mutations at PDK1 and PDK2/HM sites weremade in the TA vector using QuikChange II site-Directed Mutagenesis Kit(Stratagene). pGEX was used for bacterial expression and PXDA was used forexpression in Dictyostelium.

pGEX-6p-1-AKT or pGEX-6p-1-PKBR1 cells were grown overnight, diluted to OD~0.1, and shaken at 23°C to OD ~0.4. 0.3 mM IPTG was added to induce expression.After 6 hours, bacteria were pelleted and resupended in 1� PBS plus protease inhibitorcocktail. Lysozyme was added to 100 ng/ml for 10 minutes and samples were frozenin a dry ice-isopropanol bath and thawed at 4°C overnight. The thawed samples werecentrifuged at 50,000 g for 1 hour. Supernatant was added to 500 l of equilibratedsepharose 4B beads and rotated gently for 1 hour. After 3 rounds of wash, beads wereadded with cleavage buffer and precession protease (GE healthcare). After rotatinggently at 4°C for 4 hours, the AKT or PKBR1 was eluted from beads.

The PdkA locus was targeted using pLPBPP. pLPBLP-TAP contained the TAP-coding sequence fused upstream of BlastR in pLPBLP and was used for TAP tagfusions to PHAPS and SHAPS.

To construct the pdkA-null strain, PDKA genomic DNA was amplified using primerpairs 5�-CCTTAATGCTAAAATTTCGGTGTC-3� and 5�-TTTTTGAGGATTAT -GAGCAACATCTTCT-3� and cloned into pCR4-TOPO (Invitrogen). The resultingplasmid was linearized within the genomic sequence with BglII and blunt-end ligatedto the SmaI sites flanking the Blasticidin resistant cassette in pLPBPP (Faix et al., 2004).

To construct the pdkB-null strain, we prepared left and right arm recombinationfragments. Primer pairs 5�-GCGGCCGCAACAATGGCTA GATG ATCA AGTT -ATTC-3� and 5�-ACTAGTCTTCTTTTTGGTAACGACCATTTATC-3� were used toamplify the left arm from genomic DNA; the right arm was amplified using primerpairs 5�-AAGCTTTCCAAGATATATAAATCCATTACCAACTC-3� and 5�-GTC -GACGAAATGTCTTGATCTTCCTTTTGAG-3�. The left arm and right arms werethen inserted into pLPBLP.

For PHAPS mutagenesis, we prepared left and right arm recombination fragments.Primer pairs 5�-GCGGCCGCGAGTTGTGTTGTGGTTTACACGTC-3� and 5�-ACTAGTGCAACCAAATCATCTTCTGTTAATTCTG-3� were used to amplify theleft arm from genomic DNA; the right arm was amplified using primer pairs 5�-AAGCTTCAACCTATGCTCTTCAAGATAAAG-3� and 5�-GTCGACGATTTCC -CAGAAAGTTGAACGG-3�. The left arm and right arms were then inserted intopLPBLP.

pLPBLP-TAP contained the TAP coding sequence fused upstream of BlastR inpLPBLP. The TAP sequence was amplified from plasmid PKK4 (kindly provided byRalf Graph, Ludwig-Maximilians University, Munich, Germany) using primer pairs5�-AAGCTTGC ATGCTCAATGGAAAAGAGAAGATGGAAAAAG-3� and 5�-CCATGGTC AGGTT GACTTCCCCGCGGAAT-3�. The TAP fragment was excisedwith HindIII and NcoI and inserted into pLPBLP, generating pLPBLP-TAP. ForPHAPS-TAP fusion mutagenesis we prepared left and right arm recombinationfragments. The PHAPS left recombination arm was amplified using primer pairs 5�-GTC GACGAATGGAATATTAATGGTAAAGAACC and 5�-AAGCTTACCA -CCACCAT TAGTTTTTTCATCTTTTTTAGCAGTC-3�; the left arm terminated justupstream of the UAA stop codon in the genomic DNA. The PHAPS rightrecombination arm was amplified from genomic DNA using primer pairs 5�-ACTA -GTTA AAAATAGGCATTTTGCTCAAAC-3� and 5�-GCGGCCGCAT ACACTTA -ATGGTACCATTAAAGTGTG-3�. The left arm was then inserted in-frame with TAPinto pLPBLP-TAP; the right arm was ligated downstream.

Jour

nal o

f Cel

l Sci

ence

992

For SHAPS-TAP fusion mutagenesis we prepared left and right arm recombinationfragments. The SHAPS left recombination arm was amplified using primer pairs 5�-GTCGACCAATTCAGAGATATTAGATCTCGTCTTG-3� and 5�-AAGCTTACCA -CCACCACCACTTGTATGATTACATGGAACTAAAC-3�; the left arm terminatedjust upstream of the UAA stop codon in the genomic DNA. The SHAPS rightrecombination arm was amplified from genomic DNA using primer pairs 5�-ACTAGTTTATCAACATTCACTCTTTTTAACTTTATC-3� and 5�-GCGGCC -GCGTTGATTTGACACCAGTCTACCC-3�. The left arm was then inserted in-framewith TAP into pLPBLP-TAP; the right arm was ligated downstream.

The knock-out or TAP knock-in constructs were linearized and electroporated intoAX3 strain and transformants were selected for growth under blasticidin selectionpressure. Homologous recombinants were identified by genomic PCR and RT-PCR.TAP knock-in strains were also confirmed by immunoblot with TAP antibody (OpenBiosystems CAB1001).

PIP-strip binding assayThe protocol for the PIP-strip binding assay has been described previously (Comeret al., 2005). Briefly, 2�108 cells were collected, differentiated for 2 hours with cAMP,and resuspended in 2.5 ml of lysis buffer (10 mM Tris, pH 7.5, 0.2 M EGTA, 0.2M sucrose and protease inhibitor). Cells were lysed through a 5 m filter membrane,samples were centrifuged at 9500 g for 15 minutes, and the supernatant diluted into12 ml of TBST containing 1% nonfat dry milk and protease inhibitor. Extracts wereincubated overnight at 4°C with PIP strips (Echelon Bioscience) that had been pre-blocked with 1% nonfat dry milk in TBST. Strips were washed and assayed by bindingto -GFP (COVANCE).

Immunopurification of AKT preferential substratesCells were resuspended in PB (11.4 mM sodium phosphate, pH 6.5) at a density of5�107 cells/ml and starved for 30 minutes. Cells were stimulated at 50 M folicacid and lysed with an equal volume 2� NP-40 lysis buffer [2� PB, 1% NP-40, 100mM NaF, 4 mM Na3VO4, 50 mM sodium pyrophosphate, 400 M PMSF, 1 completemini, EDTA-free, protease inhibitor cocktail tablet (Roche)]. Cell lysates wereincubated on ice for 5 minutes and then centrifuged at 4°C for 30 minutes at 20,000g. Immobilized -phospho-AKT substrate resin [Cell Signaling Immobilized Phospho-(Ser/Thr) Akt substrate antibody] was added to the supernatant in a 1:10 ratio andallowed to incubate at 4°C overnight with gentle rotating. The resin was washedtwice with 1� NP-40 lysis buffer and twice with 1� RIPA buffer [150 mM NaCl,1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 8.0)]. Theproteins were eluted by gentle shaking with 8 M urea. The protein samples wereconcentrated and the buffer was replaced with 100 mM NaCl with sequential washesusing a Microcon YM-30 column (Millipore). The samples were resolved on a 3-8% gel, with prior reduction and alkylation, and visualized by silver staining(SilverQuest Silver Staining Kit, Invitrogen). Experimental and control gel bandswere excised, de-stained and washed according to SilverQuest, and subjected to in-gel trypsin digestion and peptide extraction (Shevchenko et al., 2006) using a MassPreprobot (Micromass/Waters modified Packard Multiprobe II). The resulting peptideextracts were analyzed by LC/MS/MS (NanoAquity, Waters). Data were automaticallysearched using the Mascot Daeomon and the NIH-CIT Mascot Server (Perkins et al.,1999). Flat files from these searches were used to generate Scaffold files (ProteomeSoftware).

We thank Xiuli Huang, Marielle Young and Colette Young forassistance in gene targeting experiments. David Eric Anderson wasinvaluable for mass spectrometric analyses. Finally, we thank Dictybaseand colleagues for various strains. This research was supported by theIntramural Research Program of the National Institutes of Health, theNational Institute of Diabetes and Digestive and Kidney Diseases.Deposited in PMC for release after 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/123/6/983/DC1

ReferencesAlessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and

Hemmings, B. A. (1996a). Mechanism of activation of protein kinase B by insulin andIGF-1. EMBO J. 15, 6541-6551.

Alessi, D. R., Caudwell, F. B., Andjelkovic, M., Hemmings, B. A. and Cohen, P. (1996b).Molecular basis for the substrate specificity of protein kinase B; comparison withMAPKAP kinase-1 and p70 S6 kinase. FEBS Lett. 399, 333-338.

Balendran, A., Casamayor, A., Deak, M., Paterson, A., Gaffney, P., Currie, R.,Downes, C. P. and Alessi, D. R. (1999). PDK1 acquires PDK2 activity in the presenceof a synthetic peptide derived from the carboxyl terminus of PRK2. Curr. Biol. 9, 393-404.

Bellacosa, A., Chan, T. O., Ahmed, N. N., Datta, K., Malstrom, S., Stokoe, D.,McCormick, F., Feng, J. and Tsichlis, P. (1998). Akt activation by growth factors isa multiple-step process: the role of the PH domain. Oncogene 17, 313-325.

Biondi, R. M., Cheung, P. C., Casamayor, A., Deak, M., Currie, R. A. and Alessi, D.R. (2000). Identification of a pocket in the PDK1 kinase domain that interacts with PIFand the C-terminal residues of PKA. EMBO J. 19, 979-988.

Brachmann, S., Fritsch, C., Maira, S. M. and Garcia-Echeverria, C. (2009). PI3K andmTOR inhibitors: a new generation of targeted anticancer agents. Curr. Opin. Cell Biol.21, 194-198.

Chan, T. O. and Tsichlis, P. N. (2001). PDK2: a complex tail in one Akt. Sci STKE 2001,PE1.

Comer, F. I., Lippincott, C. K., Masbad, J. J. and Parent, C. A. (2005). The PI3K-mediated activation of CRAC independently regulates adenylyl cyclase activation andchemotaxis. Curr. Biol. 15, 134-139.

Faix, J., Kreppel, L., Shaulsky, G., Schleicher, M. and Kimmel, A. R. (2004). A rapidand efficient method to generate multiple gene disruptions in Dictyostelium discoideumusing a single selectable marker and the Cre-loxP system. Nucleic Acids Res. 32, e143.

Frost, A., Unger, V. M. and De Camilli, P. (2009). The BAR domain superfamily:membrane-molding macromolecules. Cell 137, 191-196.

Garcia-Martinez, J. M., Moran, J., Clarke, R. G., Gray, A., Cosulich, S. C., Chresta,C. M. and Alessi, D. R. (2009). Ku-0063794 is a specific inhibitor of the mammaliantarget of rapamycin (mTOR). Biochem. J. 421, 29-42.

Hoeller, O. and Kay, R. R. (2007). Chemotaxis in the absence of PIP3 gradients. Curr.Biol. 17, 813-817.

Itoh, T. and Takenawa, T. (2009). Mechanisms of membrane deformation by lipid-bindingdomains. Prog. Lipid Res. 48, 298-305.

Jacinto, E., Facchinetti, V., Liu, D., Soto, N., Wei, S., Jung, S. Y., Huang, Q., Qin, J.and Su, B. (2006). SIN1/MIP1 maintains rictor-mTOR complex integrity and regulatesAkt phosphorylation and substrate specificity. Cell 127, 125-137.

Kamimura, Y., Xiong, Y., Iglesias, P. A., Hoeller, O., Bolourani, P. and Devreotes, P.N. (2008). PIP3-independent activation of TorC2 and PKB at the cell’s leading edgemediates chemotaxis. Curr. Biol. 18, 1034-1043.

Lee, S., Comer, F. I., Sasaki, A., McLeod, I. X., Duong, Y., Okumura, K., Yates, J. R.,3rd, Parent, C. A. and Firtel, R. A. (2005). TOR complex 2 integrates cell movementduring chemotaxis and signal relay in Dictyostelium. Mol. Biol. Cell 16, 4572-4583.

Liao, X. H. and Kimmel, A. R. (2009). Biochemical responses to chemoattractants inDictyostelium: ligand-receptor interactions and downstream kinase activation. MethodsMol. Biol. 571, 271-281.

McMains, V. C., Liao, X. H. and Kimmel, A. R. (2008). Oscillatory signaling and networkresponses during the development of Dictyostelium discoideum. Ageing Res. Rev. 7,234-248.

Meili, R., Ellsworth, C., Lee, S., Reddy, T. B., Ma, H. and Firtel, R. A. (1999).Chemoattractant-mediated transient activation and membrane localization of Akt/PKBis required for efficient chemotaxis to cAMP in Dictyostelium. EMBO J. 18, 2092-2105.

Meili, R., Ellsworth, C. and Firtel, R. A. (2000). A novel Akt/PKB-related kinase isessential for morphogenesis in Dictyostelium. Curr. Biol. 10, 708-717.

Mora, A., Davies, A. M., Bertrand, L., Sharif, I., Budas, G. R., Jovanovic, S., Mouton,V., Kahn, C. R., Lucocq, J. M., Gray, G. A. et al. (2003). Deficiency of PDK1 incardiac muscle results in heart failure and increased sensitivity to hypoxia. EMBO J.22, 4666-4676.

Obata, T., Yaffe, M. B., Leparc, G. G., Piro, E. T., Maegawa, H., Kashiwagi, A.,Kikkawa, R. and Cantley, L. C. (2000). Peptide and protein library screening definesoptimal substrate motifs for AKT/PKB. J. Biol. Chem. 275, 36108-36115.

Park, W. S., Heo, W. D., Whalen, J. H., O’Rourke, N. A., Bryan, H. M., Meyer, T. andTeruel, M. N. (2008). Comprehensive identification of PIP3-regulated PH domains fromC. elegans to H. sapiens by model prediction and live imaging. Mol. Cell 30, 381-392.

Perkins, D. N., Pappin, D. J., Creasy, D. M. and Cottrell, J. S. (1999). Probability-basedprotein identification by searching sequence databases using mass spectrometry data.Electrophoresis 20, 3551-3567.

Peter, B. J., Kent, H. M., Mills, I. G., Vallis, Y., Butler, P. J., Evans, P. R. and McMahon,H. T. (2004). BAR domains as sensors of membrane curvature: the amphiphysin BARstructure. Science 303, 495-499.

Prendergast, G. C., Muller, A. J., Ramalingam, A. and Chang, M. Y. (2009). BAR thedoor: cancer suppression by amphiphysin-like genes. Biochim. Biophys. Acta 1795, 25-36.

Sarbassov, D. D., Guertin, D. A., Ali, S. M. and Sabatini, D. M. (2005). Phosphorylationand regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-1101.

Shevchenko, A., Tomas, H., Havlis, J., Olsen, J. V. and Mann, M. (2006). In-gel digestionfor mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 1, 2856-2860.

Song, G., Ouyang, G. and Bao, S. (2005). The activation of Akt/PKB signaling pathwayand cell survival. J. Cell Mol Med 9, 59-71.

Takeda, K., Sasaki, A. T., Ha, H., Seung, H. A. and Firtel, R. A. (2007). Role ofphosphatidylinositol 3-kinases in chemotaxis in Dictyostelium. J. Biol. Chem. 282, 11874-11884.

Tanaka, K., Adachi, H., Konishi, H., Iwamatsu, A., Ohkawa, K., Shirai, T., Nagata,S., Kikkawa, U. and Fukui, Y. (1999). Identification of protein kinase B (PKB) as aphosphatidylinositol 3,4,5-trisphosphate binding protein in Dictyostelium discoideum.Biosci. Biotechnol. Biochem. 63, 368-372.

Toral-Barza, L., Zhang, W. G., Lamison, C., Larocque, J., Gibbons, J. and Yu, K.(2005). Characterization of the cloned full-length and a truncated human target ofrapamycin: activity, specificity, and enzyme inhibition as studied by a high capacityassay. Biochem. Biophys. Res. Commun. 332, 304-310.

Williams, M. R., Arthur, J. S., Balendran, A., van der Kaay, J., Poli, V., Cohen, P. andAlessi, D. R. (2000). The role of 3-phosphoinositide-dependent protein kinase 1 inactivating AGC kinases defined in embryonic stem cells. Curr. Biol. 10, 439-448.

Yamada, H., Ohashi, E., Abe, T., Kusumi, N., Li, S. A., Yoshida, Y., Watanabe, M.,Tomizawa, K., Kashiwakura, Y., Kumon, H. et al. (2007). Amphiphysin 1 isimportant for actin polymerization during phagocytosis. Mol. Biol. Cell 18, 4669-4680.

Yang, J., Cron, P., Good, V. M., Thompson, V., Hemmings, B. A. and Barford, D.(2002). Crystal structure of an activated Akt/protein kinase B ternary complex with GSK3-peptide and AMP-PNP. Nat. Struct. Biol. 9, 940-944.


Jour

nal o

f Cel

l Sci

ence

Documents

Chemotactic activation of Dictyostelium AGC-family kinases AKT