APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 1988, p. 38-42 Vol. 54, No. 10099-2240/88/010038-05$02.00/0Copyright C 1988, American Society for Microbiology

Nucleotide Sequence and Expression of the Enterobacter aerogenesox-Acetolactate Decarboxylase Gene in Brewer's Yeast

HIDETAKA SONE,* TOSHIO FUJII, KEIJI KONDO, FUMIO SHIMIZU, JUN-ICHI TANAKA,AND TAKASHI INOUE

Central Laboratories of Key Technology, Kirin Brewery Co., Ltd., Takasaki, Gunma 370-12, Japan

Received 11 May 1987/Accepted 30 September 1987

The nucleotide sequence of a 1.4-kilobase DNA fragment containing the a-acetolactate decarboxylase geneof Enterobacter aerogenes was determined. The sequence contains an entire protein-coding region of 780nucleotides which encodes an a-acetolactate decarboxylase of 260 amino acids. The DNA sequence coding fora-acetolactate decarboxylase was placed under the control of the alcohol dehydrogenase I promoter of the yeastSaccharomyces cerevisiae in a plasmid capable of autonomous replication in both S. cerevisiae and Escherichiacoli. Brewer's yeast cells transformed by this plasmid showed a-acetolactate decarboxylase activity and wereused in laboratory-scale fermentation experiments. These experiments revealed that the diacetyl concentrationin wort fermented by the plasmid-containing yeast strain was significantly lower than that in wort fermentedby the parental strain. These results indicated that the a-acetolactate decarboxylase activity produced bybrewer's yeast cells degraded a-acetolactate and that this degradation caused a decrease in diacetyl production.

Diacetyl (DA) produces what is probably one of the mostcommon off flavors in beer (taste threshold of about 0.1mg/liter). Intensive efforts have been made to elucidate themechanisms of formation and removal of DA and to de-crease DA concentration in young beer (T. Inoue and Y.Yamamoto, Proc. Am. Soc. Brewing Chemists, p. 198,1970). At present, the decrease of DA concentration isachieved mainly by controlling the fermentation temperatureand the length of the beer maturation process.The beer-making process is divided into two main stages:

fermentation and maturation. Fermentable sugars in wortare converted to ethanol during the main fermentation,which takes about 1 week. The maturation process requiresabout 6 weeks for the removal of undesirable flavor compo-nents (including DA), dissolution of carbon dioxide, and chillhaze stabilization. The latter two processes require about 10days. Undesirable volatile compounds, such as acetal-dehyde, and sulfur compounds are also removed in about 10days. Therefore, the reduction of the DA concentration isthe process which makes the maturation process take as longas 6 weeks.DA is formed from a-acetolactate (AL), an intermediate of

the isoleucine-valine pathway in yeast cells (17). Much of theAL is metabolized within the yeast cell into valine andleucine, while a small amount leaks into wort and is con-verted to DA solely by non-enzyme-catalyzed oxidativedecarboxylation. During the maturation process, DA istaken up by the yeast cell and reduced to acetoin by diacetylreductase. Taking the above-mentioned facts together, it isclear that a reduction of DA concentration in young beercould be easily achieved by reducing the amount of ALproduced during main fermentation.For this purpose, several enzymatic and genetic experi-

ments were performed. a-Acetolactate decarboxylase(ALDC) (EC 4.1.1.5) converts AL directly to acetoin and isfound in several Enterobacter spp., Lactobacillus spp., andBacillus spp. (8). Godtfredsen et al. have shown that theaddition of ALDC to freshly fermented beer reduces theconcentration ofAL and allows the level of DA to fall below

* Corresponding author.

the taste threshold value (S. E. Godtfredsen, M. Ottesen, P.Sigsgaard, K. Erdal, T. Mathiasen, and B. Ahrenst-Larsen,Proc. 19th European Brewery Convention and Congress,London, p. 161, 1983).We aimed to reduce AL concentration in young beer by

constructing yeast strains having ALDC activity. For thispurpose, we tried to express the ALDC gene of Enterobacteraerogenes in brewer's yeast cells.

Previously, we cloned the ALDC gene of E. aerogenes bydirect measurement ofALDC activity (24). In this paper, wedescribe the molecular characteristics of the E. aerogenesALDC gene and the construction of recombinant brewer'syeast strains having ALDC activity. We conducted labora-tory-scale beer fermentations to study the characteristics ofthe new brewer's yeast cells, and we found a reduction ofDA during fermentation with the new brewer's yeast cells.

MATERIALS AND METHODS

Microorganisms. Brewer's lager yeast strain Saccha-romyces uvarum K1084 was from our stock collection andwas used as a parent yeast strain. Saccharomyces cerevisiaeS288C (ot SUC2 mal gal2 CUP]; ATCC 26108) was used forbacteriophage library construction.

Escherichia coli MM294 (F- endAl hsdRJ7 supE44 thi-J)and DH1 (F- recAl endAl gyrA96 thi-l hsdR17 supE44[relAl?]) were used as hosts for plasmid construction (1, 9).E. coli JM109 [recAl endAl gyrA96 thi hsdRJ7 supE44 relAlA(lac-proAB) (F' traD36 proAB lacIq ZAM15)] was used as ahost for the DNA nucleotide sequencing vector pUC12 (25).

Plasmids and phage. Plasmid pUAll, which contains thecloned ALDC gene from E. aerogenes, was previouslydescribed (24). Plasmid pUC12 was used as a DNA sequenc-ing vector (25). Plasmid pUC18 and the yeast-E. coli shuttlevector YEp13 were used for plasmid construction (5, 25).Plasmid pUC-4K was purchased from Pharmacia Co., Ltd.,Uppsala, Sweden. Plasmid DNA was prepared by themethod of Birnboim and Doly (3).Phage vector EMBL3 arms (7) were purchased from

Vector Cloning Systems Co., Ltd., San Diego, Calif. Prep-

38

on Decem

ber 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

LOW-a-ACETOLACTATE-PRODUCING BREWER'S YEAST 39

aration of phage DNA was carried out as described byManiatis et al. (19).Media and materials. E. coli strains were grown in LB

medium (19) at 37°C. For the cultivation of strains containingthe plasmid, ampicillin was added at a concentration of 50,ug/ml.

Finished malt wort, which was to be used for practicalbrewing, was obtained from our brewery (110 Plato, 30%[wt/vol] adjuncts).

Restriction endonucleases, T4 DNA ligase, Si nuclease,the Klenow fragment of E. coli DNA polymerase I, bacterialalkaline phosphatase, endonuclease BAL 31, and HindIIIlinker were purchased from Takara Shuzo Co., Kyoto,Japan, and used as directed by the supplier.The antibiotic Geneticin G418 was purchased from

GIBCO Laboratories, Life Technologies, Inc., ChagrinFalls, Ohio. The A DNA in vitro packaging kit and [oa-32P]dCTP were purchased from Amersham InternationalBuckinghamshire, England. The M13 sequencing kit waspurchased from Takara Shuzo Co. and Amersham Interna-tional. dITP was purchased from Pharmacia Co., Ltd.

Oligodeoxynucleotides for DNA sequencing, plaque hy-bridization, and DNA fragment attachment were chemicallysynthesized with an automated DNA synthesizer (AppliedBiosystems, Foster City, Calif.).

Transformations. E. coli transformations were carried outby the method of Hanahan (9).

Yeast transformation was performed by the method of Itoet al. (15), with the following modifications. Yeast cells weregrown in 200 ml of YPD medium (2% Bacto-Peptone [DifcoLaboratories, Detroit, Mich.], 1% yeast extract, 2% glucose)at 30°C to the stationary phase (optical density at 600 nm,>10) with shaking. The cells were harvested, washed oncewith sterilized water, and suspended in 2 ml of 0.1 M lithiumacetate-10 mM Tris hydrochloride-1 mM EDTA (pH 7.5).To a 1-ml portion of this suspension, 2-mercaptoethanol(final concentration, 1%) was added, and the mixture wasincubated at 30°C for 1 h with shaking. A 0.2-ml portion ofthis suspension was transferred to an Eppendorf tube andallowed to stand for 30 min at 30°C after the addition of 2 to3 jig of plasmid DNA and 50 ,ug of calf thymus DNA (thelatter DNA acted as carrier DNA). Polyethylene glycol 4000(0.8 ml of a 35% solution) was added, and the suspensionwas mixed thoroughly. After standing for 1 h at 30°C, the cellsuspension was pulse heated at 42°C for 5 min, and then cellswere harvested and suspended in a mixture of 0.9 ml of YPDmedium and 0.1 ml of 10% filtered yeast extract. Afterincubation at 30°C for 18 to 20 h with shaking, a portion ofthe cell suspension was plated on a selective YPGL (2%Bacto-Peptone, 1% yeast extract, 2% glycerol) agar platecontaining Geneticin G418 (10 ,ug/ml). The agar plates wereincubated at 30°C for 5 to 7 days, and the colonies thatappeared were tested for ALDC activity to select the truetransformants.

Nucleotide sequence determination. The DNA nucleotidesequence was determined by the modified dideoxy chaintermination method of Sanger et al. (23), with denaturedplasmids used as the templates (10). For certain fragments,dITP was used instead of dGTP to reduce the compressionartifact (21), and chemically synthesized sequencing primerswere used when commercial primers were not practical. Thenucleotide sequence was analyzed by a gene informationanalyzer system, GENIAS, purchased from Mitsui Knowl-edge Industry Co., Tokyo, Japan.ALDC assay. Yeast cells were grown to about 108 cells per

ml. Cells were harvested from 1 ml of culture by centrifuga-

tion, suspended in 250 ,ul of breaking buffer (100 mM Trishydrochloride [pH 8.0], 1 mM dithiothreitol, 20% [vol/vol]glycerol), and then chilled. Cells were disrupted by vortex-ing with 0.8 g of 0.5-mm-diameter glass beads (ToshinrikoCo., Ltd., Tokyo, Japan) as described by Rose and Botstein(22).ALDC activity was measured by the method of L0ken and

St0rmer (18) as described previously (24). One unit ofALDCactivity is defined as the amount of protein that forms 1 pumolof acetoin per min at 37°C. Protein concentration wasdetermined with a protein assay kit (Bio-Rad Laboratories,Richmond, Calif.).

Laboratory-scale fermentation experiments. Yeast cellswere precultured in 50 ml of wort without shaking at 20°C for3 days. Subsequently, yeast cells were cultured in 1 liter offresh wort at 8°C for 10 days. Centrifuged yeast pellets (2.5g) were suspended in 500 ml of wort for fermentationexperiments; the suspensions were kept at 8°C for 7 days.Yeast cells were removed by centrifugation, and the super-natant was analyzed as follows. Total DA (DA, AL, 2,3-pentanedione, and hydroxybutyrate) was determined by themethod of Inoue (14). Apparent extract was determined asfollows. The specific gravity of a sample was determineddensitometrically with an automatic analyzer for beer,SCABA (Servo Chem AB, Stockholm, Sweden), and con-verted to extract content (dehumidified solid content aspercent by weight). Since the sample generally containsalcohol, the extract content determined by this method islower than the true extract content and is referred to as theapparent extract. The yeast multiplication ratio was esti-mated by measurement of wet weights before and after thefermentation test.

RESULTS

Nucleotide sequence of the ALDC gene. The ALDC gene ofE. aerogenes has been cloned in E. coli on the basis ofALDC activity and has been found in the 1.7-kilobase (kb)BamHI-PstI fragment (24). By subsequent subcloning, it wasconfirmed that the ALDC gene is located in the 1.4-kbBamHI-EcoRV fragment (Fig. 1). The pUC12-derived plas-mid contained this 1.4-kb fragment and was designated aspUAR5. The complete nucleotide sequence of the fragmentwas determined for both DNA strands as described inMaterials and Methods.The nucleotide sequence of the 1.4-kb fragment is shown

in Fig. 2 along with the deduced amino acid sequence of the

0 0.5 1.0

E SA S H A S SAA SS, . .~ .

2

3

4

5

6

1.43 kb

AA S A B a

s~~~ I

*_[ * A L D C

-_*_-9 bFIG. 1. Restriction endonuclease map of the cloned ALDC frag-

ment. (a) Physical map of 1.4-kb EcoRV-BamHI fragment. (b)Coding potential of this DNA in all six reading frames. Symbols: [,open reading frame region; *, noncoding region. Restriction endo-nuclease sites are as follows: E, EcoRV; S, Sau3AI; A, AluI; H,HincII; and B, BamHI.

VOL. 54, 1988

on Decem

ber 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENVIRON. MICROBIOL.

EcoRVTACCTGAAACTGACGAATGAGCGCGAAAATTTTGGGATGAAAAGCAI'CTGAACTGGTGATGCCAATCGACAGGTTGCCGTTCAGACCGCG

CGCGATGCCGCGGGCTTTCTCCAGCGCGGCGTCGCTCAGCGCCAGGATCTTACAGGCGTCCTCGTAGOAAGGCTTCTCCCGCTTCGGTTAG

CTCCACACCTCTCGTCAGACGCCTGAACAGCGGCGTGCCCACTTCCI'CTTCGAGCCGTTTGA?'CTGCTGACTCAGAGGAGGCTGTGAAAT

TCAAACCAGCATGGATTCTATATTGGAACTCTCTGCTGAATCGGGTCAACATTTATTTAACCTTTATAAATAAAGTTGAAGAGGACGA0CHincII

10 20 30 40 50 60 70 80 90ATGATGATGCACTCATCTGCCTGCGACTGTCAGGCGAGCTTATGCGAGACCCTGCGCGGGTTCTCCGCTAAACATCCTGACAGCGTGATCMetMetMetHisSerSerAlaCysAspCysCluAlaSerLeuCysGluThrLeuArgGlyPheSerAlaLysHisProAspSerValIle

100 110 120 130 140 150 160 170 180TATCAGACATCGCTAATGAGCGCCCTGCTAAGCGGTGTCTACGAAG(;GGACACCACCATCGCCGATCTGCTGGCACATGGTGATTTTGGTTyrGlnThrSerLeuMetSerA1aLeuLeuSerGlyValTyrGluG1yAspThrTrhrIeAlaAspLeuLeuA1aHisG1yAspPheGly

190 200 210 220 230 240 250 260 270CTGGGCACCTTCAACGAGCTGGACGGCGAAATOATTGCCTTCAGCAGCCAGGTGTACCAGCTGCGCGCCGACGGCAGCGCACGCGCCGCGLeuGlyThrPheAsnGluLeuAspGlyGl'uMetleAlaPheSerScrGInValTyrGLnLeuArgAlaAspGlySerAlaArgAlaAla

280 290 300 310 320 330 340 350 360AAGCCAGACCAGAAAACGCCGTTCGCGGTGATGACCTGGTTCCAGCCGCAGTACCGCAAAACCTTTGATGCGCCGGTCAGCCGTCAGCAGLysProGluGlnLysThrProPheAlaValMetThrTrpPheGlnProGlnTyrArgLysThrPheAspAlaProValSerArgGlnGln

370 380 390 400 410 420 430 440 450ATCCACGACGTGATCGACCAGCAAATTCCCTrCGGATAACCTGTTCTGCGCGCTGCGCATCGACGGCAACTTCCGCCACGCCCACACCCGTIleHisAspValIleAspGlnG1nIlePro!ierAspAsnLeuPheCysA1aLeuArgIleAspClyAsnPheArgH1sA1aHisThrArg

460 470 480 490 500 510 520 530 540ACCGTACCGCGTCAGACGCCGCCATACCGCGCGATGACCGACGTGCTGGACGACCAGCCGGTGTTCCGCTTTAACCAGCGTGAAGGGTGThrValProArgGlnThrProProTyrArgAlaMetThrAspOValLeuAspAspGlnProValPheArgPheAsnCGnArgGluGlyVa

550 560 570 580 590 600 610 620 630CTGGTTGGGTTCCGCACGCCGCAGCATATGCAGCGCATCAACGTGGCCGGCTATCACGAACATTTCATTACCGACGACCGTCAGGGCGGGLeuValGlyPheArgThrProGlnHisMetGlnGlyI 1eAsnValAlaGlyTyrHIsGluHisPheIleThrAspAspArgG1nGlyGly

640 650 660 670 680 690 700 710 720GGACATCTGCTGGATTACCAGCTGGACAGCGGCGTGCTCACCTTTGGCGAAATACACAAGCTAATGATTGACCTGCCCGCCGACAGCGCGGlyHisLeuLeuAspTyrGlnLeuGluSer(;lyValLeuThrPheGlyGluIleHisLysLeuMetIleAspLeuProAlaspSerAla

730 740 750 760 770 780TTTTTACAGGCCAACCTTCACCCCAGCAACCTTGATGCAGCGATCCGTTCCGTCGAAAACTAACAGGAGAACTATCGTGAACAGTGAGAAPheLeuGlnAlaAsnLeuHisProSerAsnLeuAspAlaAlaIleArgSerValGluAsn*'-

ACAGTCACGTCAGTGGGCGCACGGCGCCGATATGGTTGTCGGCCAGCTGGAAGCGCAGGGCGTGAAGCAGGTGTTCGGGATCC

FIG. 2. Nucleotide and deduced amino acid sequences of theALDC gene. The nucleotide sequence is numbered from the firstATG that serves as the initiation codon of the ALDC protein (+ 1).It is not yet clear which of the three ATGs is the initiation codon ofthe ALDC protein.

ALDC gene. To identify the open reading frames in thesequence, a computer program was used which fixed therelative positions of the initiation and termination codons inall six possible reading frames. The largest open readingframe (1 to 780) which could code for the 29-kilodaltonprotein seemed to be the region encoding the ALDC. Ourprevious study showing that the molecular mass of ALDC(by sodium dodecyl sulfate-polyacrylamide gel electropho-resis) is about 30 kilodaltons strongly supports this result.The G+C content of the ALDC-coding sequence (59.6%)

is higher than that of the E. aerogenes genome (53 to 54%)(4). At the 5' terminus of the putative ALDC-coding region,three ATGs were found as initiation codons. It is not yetclear which of the three ATGs is the initiation codon of theALDC gene. The Shine and Dalgarno complementarity(AGGA) was located 5 base pairs upstream from the firstATG (6, 16).

In both procaryotes and eucaryotes, a distinct bias wasobserved in the frequency with which a particular degener-ate codon is used to code for a particular amino acid (13).Codon usage of E. aerogenes ALDC mRNA is similar to thatof procaryotes, especially members of the family Enterobac-teriaceae.

Construction of the expression plasmid. An expressionvector, pAK2, was constructed from the yeast-E. coli shuttlevector YEp13 as follows (and as shown in Fig. 3). ASalI-XhoI fragment carrying the yeast LEU2 gene and aSacl-SmaI fragment carrying the 2,um and pBR322 se-quences were isolated after cleavage of YEp13 with thecorresponding endonuclease. Both fragments were treatedwith S1 nuclease and Klenow polymerase I and ligated withT4 DNA ligase. The small HindIll fragment of a resultantplasmid was replaced with synthesized oligo(A) which con-tained SacI, SmaI, BglII, and XhoI sites. Since one end ofoligo(A) was 5'-AGCTC, this junction was no longer cleavedby Hindlll after ligation. As a result, this plasmid (named

YEp13K) had unique cloning sites: Sall, BamHI, HindlIl,Sacl, BgllI, and XhoI, in that order.A DNA fragment with the ADHI promoter sequence was

cloned from the EMBL3 phage library of S. cerevisiaeS288C on the basis of the published DNA sequence (2). Afterthe DNA fragment was tailored, about 1.5 kb of the BamHI-HindlIl fragment was obtained as the ADHI promoter sothat the 3' end was 14 base pairs upstream from the initiationcodon ATG (unpublished observation) and inserted betweenthe BamHI and HindIll sites of YEp13K (named pAK2).The expression plasmid pALG24 was constructed frompAK2 as follows. pUAR5 containing the ALDC gene wascleaved with HinclI, ligated to HindlIl linkers, and cleavedwith HindlIl and BamHI. The HindIII-BamHI fragmentcontaining the ALDC gene was isolated and inserted be-tween the HindIII and BglII sites of pAK2. The othercomponent of pALG24, the antibiotic G418 resistance genefrom the 1.7-kb Sall fragment of pUC4K (Pharmacia Co.,Ltd.), was used as a dominant marker in yeast cells.

Brewer's yeast transformation. Dominant markers, such asgenes for drug resistance, are needed for the transformationof brewer's yeast cells. In our experiment, to introduce theALDC gene into brewer's yeast strain K1084, we used theantibiotic G418 resistance gene as a marker. Using the

AGCTTATGATTACGAGCTCCCGGGCAGATCTCGGCCTCCAGO1IigoA ATACTAATGCTCGAGGGCCCGTCTAGAGCCGGAGCTCTCGAHindIII SacI SmaI BglII XhoI

FIG. 3. Construction of the expression plasmid. Symbols: 2,2,um sequence; , pBR322 sequence; *, synthesized oligo(A); El,ADHI promoter sequence. The direction and approximate locationof the respective gene transcripts are indicated by arrows. Restric-tion endonuclease sites are as follows: B, BamHI; Bg, BgIll; H,HindIII; R, EcoRI; S, Sacl; Sm, SmaI; X, XhoI. (X)/(Sa), (S)/(Sm),and (B)/(Bg), Nonfunctional sites.

40 SONE ET AL.

on Decem

ber 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

LOW-os-ACETOLACTATE-PRODUCING BREWER'S YEAST 41

modified transformation technique described in Materialsand Methods, we obtained 60 to 120 transformants per ,ug ofDNA. We used YPGL plates (see Materials and Methods) toselect transformants, because many background substancesappeared when YPD plates were used. Interestingly, cellsharvested from the stationary phase showed the best com-petence in this method.

Effects of ALDC activity on fermentation characteristics.K1084 transformed with pALG24 by the method describedabove had ALDC activity (2 to 3 U/mg of protein), while theparental strain, K1084, had no activity. With transformedyeast K1084(pALG24), laboratory-scale fermentation exper-iments were carried out by the standard method of ourlaboratory as described in Materials and Methods. Therewas no substantial difference in the fermentation perfor-mances of both strains. The total DA content of young beerfermented by K1084(pALG24) was very much lower thanthat of young beer fermented by the original strain, K1084,while the wort fermented by KI084(pALG24) was not dis-tinguishable from the other with respect to beer character-istics (Table 1).

DISCUSSION

In this paper, we report the nucleotide sequence of the E.aerogenes ALDC gene and show that brewer's yeast cellscontaining ALDC activity are useful in reducing AL concen-tration during laboratory-scale beer fermentation.

Nucleotide sequence of E. aerogenes ALDC gene. Althoughthe region upstream (up to -100) from the translational startwas AT rich (63%), no sequence was evident which wasstrongly homologous to the consensus -10 and -35 regionsproposed for E. coli (11). Thus, we could not unequivocallyidentify the promoter(s) for this gene without additionalmolecular and biological information. Interestingly, this up-stream region also contained a 13-base inverted repeat(TCAAC-TTTATTTA) which might affect gene expression.Further investigation is necessary to define the possible roleof this sequence.No typical transcriptional terminator was found in the 3'

noncoding sequence, suggesting that the ALDC gene may bethe first gene of an operon (other genes may follow theALDC gene).

Expression of the ALDC gene in brewer's yeast. Severalstudies concerning the introduction of desirable characteris-tics into brewer's yeast cells have been performed. Meadenand Tubb introduced a yeast glucoamylase gene (P. G.Meaden and R. S. Tubb, Proc. 20th European BreweryConvention and Congress, Helsinki, Finland, p. 219, 1985).Hinchliffe and Box (E. Hinchliffe and W. G. Box, Proc. 20thEuropean Brewery Convention and Congress, Helsinki,

TABLE 1. Analysis of young beer brewed by brewer's yeasthaving ALDC activity

Beer characteristic

Total Apparent Apparent % YeastStrainDA etatattenuationi Ehnlmulti-

(mg/liter) (° Plato) dee (vol/vol) plicatibon(%)a ~~~~ratio'KI084(pALG24) 0.15 1.7 84.4 4.9 4.2K1084 0.68 1.6 85.4 5.0 4.3

a [(Extract content of wort - apparent extract of beer)/extract content ofwort] x 100.

b Yeast cell wet weight after fermentation/yeast cell wet weight beforefermentation.

Finland, p. 267, 1985) and Cantwell et al. (B. Cantwell, G.Brazil, J. Hurley, and D. McConnell, Proc. 20th EuropeanBrewery Convention and Congress, Helsinki, Finland, p.259, 1985) introduced the Bacillus subtilis 3-glucanase gene.They also reported that most brewer's yeast strains had lowtransformation efficiencies.

Since brewer's yeast cells are polyploid prototrophs, adominant marker is necessary for selecting transformants.Although the copper resistance gene was used for theabove-mentioned studies as a selectable marker, we success-fully used the antibiotic G418 resistance gene as a dominantmarker to transform brewer's yeast cells.To transform brewer's yeast strain KI084, we examined

several methods which had been devised for laboratoryyeast strains (12, 15). Treatment of intact cells in thestationary phase with 2-mercaptoethanol was the most ade-quate method, although the frequency of transformation wasstill low (120 transformants per ,ug of DNA) compared withthat of laboratory yeast strains. This is the first case oftransformation of industrial brewer's yeast cells performedwithout the spheroplast step. We suggest that a suitabletransformation method be developed for each strain ofbrewer's yeast, because transformation efficiency dependson the strain.

It has been reported that the stability of the YEp-typeplasmid (2,um DNA-based plasmid) in a lager brewer's yeaststrain is extremely high (Cantwell et al., Proc. 20th Euro-pean Brewery Convention and Congress; Meaden and Tubb,Proc. 20th European Brewery Convention and Congress).We observed that the ALDC expression plasmid was alsomaintained stably in brewer's yeast strain KI084 even whencultured in wort without antibiotic G418 (more than 84%after 34 generations). This characteristic may be general inlager brewer's yeast cells and is preferable for practical beerproduction with yeast cells containing YEp-type plasmids.The codon usage of E. aerogenes mRNA coding for

ALDC is not similar to that of S. cerevisiae. For approxi-mately one-half of the amino acid families, codon choicepatterns are clearly different, and the ALDC gene containsseveral codons which are rare in S. cerevisiae. For example,60% (9 of 15) of arginine residues are coded by CGC in theALDC gene, while in 64 examined genes of S. cerevisiaeonly 3% of the arginine residues are coded by CGC (20).Similar phenomena are observed for leucine (59 and 8% arecoded by CUG in the ALDC gene and in S. cerevisiae,respectively), serine (65 and 8% are coded by AGC in theALDC gene and in S. cerevisiae, respectively), and proline(54 and 7% are coded by CCG in the ALDC gene and in S.cerevisiae, respectively). Despite the above-mentioned ob-servations, the ALDC activity which we introduced intobrewer's yeast cells successfully reduced total DA concen-tratioh during fermentation. This also means that (i) theALDC gene of E. aerogenes was expressed as an activeenzyme under the control of the ADHI promoter in yeastcells and that (ii) the ALDC activity produced byK1084(pALG24) was sufficient to decrease the AL concen-tration in young beer to about one-fourth. By using a

promoter stronger than the ADHI promoter or by adjustingthe codon usage of the ALDC gene to that for yeast cells, theALDC gene could be expressed more efficiently, and conse-

quently, AL concentration in young beer could be furtherreduced. Since ALDC converts AL, an intermediate of theisoleucine-valihe pathway, to acetoin, it is possible that a

yeast cell having high ALDC activity is starved of valine andleucine and therefore requires such amino acids, althoughtransformed yeast K1084(pALG24) required no amino acids.

VOL. 54, 1988

on Decem

ber 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENVIRON. MICROBIOL.

Ramos-Jeunehomme and Masschelein reported that an iso-leucine-valine-leucine auxotroph of a yeast strain whichproduced no AL had poor fermentation characteristics (C.L. Ramos-Jeunehomme and C. A. Masschelein, Proc. 16thEuropean Brewery Convention and Congress, Amsterdam,p. 267, 1977). For genetic engineering of brewer's yeaststrains, it is important not to change the fermentationcharacteristics except for those characteristic(s) which oneaims to change. We successfully engineered the low-AL-producing brewer's yeast strain which brewed a beer nor-mally in a laboratory-scale fermentation.

ACKNOWLEDGMENTS

We are grateful to Reisuke Takahashi, Toshihiko Ohno, andSetsuzo Tada for their valuable suggestions and to Shigeru Matsuki,Tadashi Ozawa, Nobuyoshi Ikeda, and Naomi Ushigome for theirtechnical assistance. We also thank the management of our com-pany for allowing this publication.

LITERATURE CITED1. Backman, K., M. Ptashne, and W. Gilbert. 1976. Construction

of plasmids carrying the cI gene of bacteriophage X. Proc. Natl.Acad. Sci. USA 73:4174-4178.

2. Bennetzen, J. L., and B. D. Hall. 1982. The primary structure ofthe Saccharomyces cerevisiae gene for alcohol dehydrogenaseI. J. Biol. Chem. 257:3018-3025.

3. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

4. Brenner, D. J. 1984. Facultatively anaerobic gram-negativerods, p. 408-600. In N. R. Krieg and J. G. Holt (ed.), Bergey'smanual of systematic bacteriology, vol. 1. The Williams &Wilkins Co., Baltimore.

5. Broach, J. R., J. N. Strathern, and J. B. Hicks. 1979. Transfor-mation in yeast: development of a hybrid cloning vector andisolation of the CAN] gene. Gene 8:121-133.

6. Doi, R. H., and L.-F. Wang. 1986. Multiple procaryotic ribonu-cleic acid polymerase sigma factors. Microbiol. Rev. 50:227-243.

7. Frischauf, A. M., H. Lehrach, A. Poustka, and N. Murray. 1983.Lambda replacement vectors carrying polylinker sequences. J.Mol. Biol. 170:827-842.

8. Godtfredsen, S. E., H. Lorck, and P. Sigsgaard. 1983. On theoccurrence of a-acetolactate decarboxylases among microorga-nisms. Carlsberg Res. Commun. 48:239-247.

9. Hanahan, D. 1983. Studies on transformation of Escherichia coliwith plasmids. J. Mol. Biol. 166:557-580.

10. Hattori, M., and Y. Sakaki. 1986. Dideoxy sequencing methodusing denatured plasmid templates. Anal. Biochem. 152:232-238.

11. Hawley, D. K., and W. R. McClure. 1983. Compilation andanalysis of Escherichia coli promoter DNA sequences. NucleicAcids Res. 11:2237-2255.

12. Hinnen, A., J. B. Hicks, and G. R. Fink. 1978. Transformation ofyeast. Proc. Natl. Acad. Sci. USA 75:1929-1933.

13. Ikemura, T. 1982. Correlation between the abundance of yeasttransfer RNAs and the occurrence of the respective codons inprotein genes. J. Mol. Biol. 158:573-597.

14. Inoue, T. 1982. Further studies on an improved micromethod fordetermination of total diacetyl in beer. Rep. Res. Lab. KirinBrewery Co. Ltd. 25:13-20.

15. Ito, H., K. Murata, and A. Kimura. 1984. Transformation ofintact yeast cells treated with alkali cations or thiol compounds.Agric. Biol. Chem. 48:341-347.

16. Kozak, M. 1983. Comparison of initiation of protein synthesis inprocaryotes, eucaryotes, and organelles. Microbiol. Rev.47:1-45.

17. Lewis, K. F., and S. Weinhouse. 1958. Studies in valine biosyn-thesis. II. a-Acetolactate formation in microorganisms. J. Am.Chem. Soc. 80:4913-4915.

18. L0ken, J. P., and F. C. St0rmer. 1970. Acetolactate decarboxy-lase from Aerobacter aerogenes. Eur. J. Biochem. 14:133-137.

19. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

20. Maruyama, T., T. Gojobori, S. Aota, and T. Ikemura. 1986.Codon usage tabulated from the GenBank genetic sequencedata. Nucleic Acids Res. 14:rlS1-r197.

21. Mills, D. R., and F. R. Kramer. 1979. Structure-independentnucleotide analysis. Proc. Natl. Acad. Sci. USA 76:2232-2235.

22. Rose, M., and D. Botstein. 1983. Construction and use of genefusions to lacZ (P-galactosidase) that are expressed in yeast.Methods Enzymol. 101:167-180.

23. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 174:5463-5467.

24. Sone, H., T. Fujii, K. Kondo, and J. Tanaka. 1987. Molecularcloning of the gene encoding a-acetolactate decarboxylase fromEnterobacter aerogenes. J. Biotechnol. 5:87-91.

25. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

42 SONE ET AL.

on Decem

ber 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from