Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11

7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11

1/37


2/37


3/37

3

INTRODUCTION48

Phosphorus (P) is an essential macroelement for plants, and its bioavailability is often49

limited in soil because it forms highly insoluble iron/aluminum oxide complexes (11).50

Several bacteria are known to solubilize phosphate from these soil complexes, rendering51

phosphorus available to plants and thereby improving plant growth. Among P-solubilizing52

microorganisms, rhizosphere-colonizing pseudomonads are of major interest as they possess53

many other plant-beneficial traits, such as the capacity to directly improve growth, induce54

systemic resistance in plants and suppress soilborne diseases (15). A recent metagenomic55

analysis of rhizosphere microbiomes has shown that -proteobacteria (with pseudomonads56

being the most important group of rhizosphere-associated -proteobacteria) are enriched in57

disease suppressive soils and also in response to attack by fungal pathogens (26). Fluorescent58

Pseudomonas spp. have received special attention because they are efficient root colonizers,59

and strains belonging to a subgroup that produces the potent antifungal metabolites 2,4-60

diacetylphloroglucinol (DAPG) and hydrogen cyanide (HCN) are particularly efficient in61

providing protection against several fungal pathogens of different plants species (15, 16, 18).62

Phosphate solubilization by Pseudomonas spp. in soil is mainly associated with the63

production and excretion of gluconic acid, which chelates the cations bound to phosphate,64

thereby releasing the element (7). The production of this acid implies the direct oxidation of65

glucose catalyzed by a periplasmic membrane-bound glucose dehydrogenase (GDH), which66

forms a complex with the cofactor pyrroloquinoline quinone (PQQ).67

PQQ also serves as a redox cofactor for various bacterial dehydrogenases other than68

GDH, but is not produced in animals or plants. Several studies with bacterial mutants unable69

to produce PQQ and gluconic acid have demonstrated the intimate relation of the cofactor to70

phosphate solubilization processes (7, 17). Beside its relevant role in P-solubilization, PQQ is71

reported to be a potent growth-promoting factor for bacteria and plants, has antioxidant72


4/37

4

properties (5), and is directly related to the production of antimicrobial substances (7, 14, 36)73

as well as to the induction of systemic plant defenses (17). Hence, the cofactor PQQ has74

multiple plant beneficial effects.75

The genes responsible for PQQ production have been cloned and sequenced in several76

bacterial genera, including Pseudomonas, Methylobacterium, Acinetobacter, Klebsiella,77

Enterobacterand Rhanella (5, 14, 17, 36, 42). In P. fluorescens B16, the PQQ operon is78

formed by eleven genes,pqqA, -B, -C, -D, -E, -F, -H, -I, -J, -KandpqqM(5). ThepqqCgene79

encodes the pyrroloquinoline quinone synthase C (PqqC), which is the best characterized80

enzyme in the pathway and catalyzes the final step of the PQQ biosynthesis, namely81

cyclization and oxidation of the intermediate 3a-(2-amino-2-carboxy-ethyl)-4,5-dioxo-82

4,5,6,7,8,9-hexahydroquinoline-7,9-dicarboxylic acid to PQQ (22).83

No studies have yet focused on the evolutionary history and the genetic diversity of PQQ84

in bacteria, although this would be particularly interesting for the agriculturally important85

genus Pseudomonas. Previous studies on the occurrence, diversity and evolution of plant-86

associatedPseudomonas spp. have mostly focused on the diversity of the 16S rRNA(4, 31,87

33), other housekeeping genes (4, 8, 32) or biocontrol-relevant genes involved in the88

suppression of various plant pathogenic fungi (6, 8, 9, 18, 31, 33, 40). In addition, little is89

known about the occurrence ofpqq genes amongPseudomonas species. The main aim of this90

study was therefore to investigate the phylogeny of thepqqCgene and to evaluate whether it91

could serve as a marker to study the diversity and evolution in pseudomonads. To this end,92

we designed primers for the amplification ofpqqCspecifically in the genus Pseudomonas.93

The phylogeny ofpqqCwas then inferred from sequences ofPseudomonas reference strains94

and ofPseudomonas spp. isolated from wheat roots and compared to that of the two95

housekeeping genes rpoD and gyrB. To capture most of the pqqCdiversity present in the96

wheat root samples that we studied, we used cultivation-dependent and cultivation-97


5/37

5

independent approaches. Finally, we related the pqqC phylogeny to the phosphate98

solubilizing activity of the pseudomonads investigated.99

100


6/37


7/37

7

amplification, sequencing ofpqqC, rpoD and gyrB genes and for phosphate solubilisation126

studies (described below).127

Total DNA extraction from root samples. The total DNA from root pieces (0.5 g) and128

50 ml root suspension (prepared as described above) was extracted, using a Fast DNA Spin129

Kit for soil (MP Biomedicals, Irvine, CA, USA). The frozen samples were briefly thawed130

overnight at 4C, and root pieces were added to DNA extraction tubes. The remaining root131

suspension was centrifuged at 3500 rpm for 20 min, and 50 l of the resulting pellets were132

additionally added to the extraction tubes. Total DNA was further extracted according to the133

manufacturers recommendations but using reduced volumes of the sodium phosphate and134

MT buffers. DNA was diluted to a concentration of 10 ng/l. DNA extracts were then135

subjected topqqCPCR amplification, cloning and sequencing.136

Design ofpqqCprimers pqqCr1 and pqqCf1. Alignment of thepqqCregions retrieved137

from the GenBank was performed using the multiple sequence alignment program ClustalW138

1.8 (41) to determine regions conserved only within the genus Pseudomonas. The primers139

pqqCr1 (5-CAGGGCTGGGTCGCCAACC-3) and pqqCf1 (5-140

CATGGCATCGAGCATGCTCC-3), which amplify a 546-bp long (including primer141

sequences)pqqCfragment, were designed and their specificity tested against DNA sequences142

available in GenBank with the program Molecular Evolutionary Genetics Analysis (MEGA)143

software version 4.0 (41). Furthermore, pqqC primer specificity was tested by PCR144

amplification (see below) on 57 reference Pseudomonas strains (i.e., 37 DAPG-producing145

fluorescent pseudomonads, and 20 pseudomonads not producing DAPG, representing the146

major phylogenetic groups of thePseudomonas genus) and on bacterial strains representative147

of 12 different non-Pseudomonas genera, mostly found in the soil environment (listed in148

Table 1). For phylogenetic analyses, a subset of 36Pseudomonas reference strains were used149

as described below.150


8/37

8

PCR assays. PCRamplifications ofpqqCfrom bacterial DNA lysates were carried out in151

20-l mixtures containing 1 x ThermoPol Buffer (New England Biolabs, Inc., Beverly, MA,152

USA) 100 M of each dNTP, 0.4 M of each forward and reverse primer, 0.75 U Taq DNA-153

Polymerase (5000 U/ml, New England Biolabs, Inc.) and 2 l of genomic DNA. The154

following thermocycling conditions were used: initial denaturation at 96C for 10 min155

followed by 30 cycles of 96C for 30 s, 63C for 30 s, 72C for 1 min and final elongation at156

72C for 10 min. ForpqqC amplification from roots, 20 ng total DNA extracts, 5%157

dimethylsulfoxide (Sigma-Aldrich, St. Louis, MO, USA) and 5% bovine serum albumin were158

added to the PCR mix, and thermocycling conditions were slightly modified from those159

described above, i.e. 35 cycles instead of 30, denaturing and annealing times of 1 min and an160

elongation time of 2 min per cycle. The presence of amplified fragments was checked by161

standard gel electrophoresis and ethidium bromide staining.162

The genes involved in the biosynthesis of HCN (hcnA, hcnB), DAPG (phlD) and163

phenazine (phzF), respectively, and two housekeeping genes (gyrB and rpoD) were amplified164

with primers and the annealing temperatures listed in Table 2,using the same thermocycling165

conditions as for thepqqCgene.166

Prior to ligation and sequencing reactions, all PCR amplicons were purified on a167

MultiScreen PCR plate (Millipore, Molsheim, France), resuspended in 30 l of sterile double-168

distilled water and quantified using Nanodrop ND-1000 (NanoDrop Technologies,169

Wilmington, DE, USA).170

pqqCcloning. PurifiedpqqCfragments amplified from DNA extracted from root samples171

were cloned using the TA cloning vector pJET1.2 (CloneJet PCR cloning kit; Fermentas,172

Glen Burnie, USA). The constructs were transformed into chemically competent E. coli One173

Shot TOP 10 cells (Invitrogen, Carlsbad, USA), and a total of 107 transformants (3040 per174

root sample replicate) containing the pJET1.2_pqqCconstruct were selected for sequencing.175


9/37

9

Sequencing of the pqqC, rpoD and gyrB genes. Sequencing reactions were performed176

with 310 ng of purified PCR product and primers at a final concentration of 0.16 M, using177

an ABI PRISM BigDye Terminator v3.0 cycle sequencing kit (Applied Biosystems, Foster178

City, CA, USA) according to manufacturer's instructions. The obtained products were179

cleaned by gel-filtration through Sephadex G-50 columns (Amersham Biosciences, Uppsala,180

Sweden) on MultiScreen HV plates (Millipore). Purified products were sequenced using an181

ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) at the182

Genetic Diversity Centre of the ETH Zrich. DNA sequences were edited using the183

Sequencher package (Gene Codes, Ann Arbor, MI, USA). Sequences of 507 bp-long pqqC184

fragments (without primer sequences) were submitted to the GenBank under accession185

numbers JN397402560 (76 sequences from cloned pqqC fragments, 33 pqqC sequences186

amplified from wheat root isolates and 50 pqqC sequences from Pseudomonas reference187

strains). Sequences of 533536 bp-long gyrB fragments and of 581587 bp-long rpoD188

fragments from 5 (gyrB) and 8 (rpoD) reference pseudomonads and from 32 (gyrB) and 33189

(rpoD) wheat root isolates were submitted to the GenBank under accession numbers190

JN397569573, JN397607638, JN397561568 and JN397574606, respectively.191

Phylogenetic analysis. Pseudomonas phylogenies shown in Figs. 1, 2, S1, S2 and S3192

were inferred from pqqC, rpoD and gyrB sequences from a selection of 36 Pseudomonas193

reference strains, including 12 DAPG-producing and 14 non DAPG-producing fluorescent194

pseudomonads listed in Table 1 (underlined strains) and GenBank sequences of 10195

Pseudomonas strains: P. aeruginosa UCBPP-PA14 (GenBank database accession number:196

CP000438.1), P. entomophila L48 (CT573326.1), P. mendocina ymp (CP000680.1), P.197

putida GB-1 (CP000926.1), P. putida KT2440 (AE015451.1), P. putida W619198

(CP000949.1), P. stutzeri A1501 (CP000304.1), P. syringae pv. phaseolicola 1448A199

(CP000058.1), P. syringae pv. syringae B728a (CP000075.1), P. syringae pv. tomato200


10/37

10

DC3000 (AE016853.1). The alignment of DNA sequences was performed with ClustalW 1.8201

implemented in the MEGA software version 4.0 package (41). Phylogenetic trees were202

constructed with the MEGA software version 4.0 (41), using the neighbor-joining(NJ)203

method (35) for trees shown in Figs. 1, 2, S1, S2 and S3 or with the PhyML 3.0 phylogeny204

software (12), using the maximum likelihood (ML) method for trees additionally included in205

the ShimodairaHasegawa test (see below). The genetic distances were computed, based on206

the maximum composite likelihood estimated by using the TamuraNei model, MEGA207

software version 4.0 (41). The nucleotide sequences of thepqqC,gyrB and rpoD genes from208

Pseudomonas aeruginosa PAO1, P. aeruginosa UCBPP-PA14, Pseudomonas mendocina209

ymp andPseudomonas stutzeri A1501 were used as outgroups.210

The ShimodairaHasegawa (SH) test (37) implemented in the phylogenetic analysis by211

maximum likelihood (PAML) software package version 3.14 (44) was performed to compare212

different ML and NJ trees of the Pseudomonas genus (36 reference strains) inferred from213

single and concatenated loci.214

pqqC sequence analysis. The GC content, the diversity index () and ratios of non-215

synonymous to synonymous substitutions (dN/dS) were calculated forpqqC sequences216

derived from i) a subset of 19 reference Pseudomonas strains representing the main217

phylogenetic groups as defined by Mulet et al. (29) includingsix strains of theP. fluorescens218

group 1 (LMG2172, Pf0-1, 30-84, CHA0, 2-79, SBW25), four strains of the P. syringae219

group 2 (LMG2152, DC3000, B728a, 140BA), five strains of theP. putida group 3 (P3, GB1,220

W619, KT2440, L48) and four strains of theP. aeruginosa group 4 (PAO1, UCBPP-PA14,221

ymp, A1501) and ii) aPseudomonas wheat root population illustrated in Fig. 2B representing222

106 different operational taxonomical units (OTUs). The GC content and nucleotide diversity223

() indexes were calculated with the DnaSP program version 5 (34). The index expresses224


11/37

11

the genetic diversity or polymorphism of a gene in a population, with = 0 meaning no225

polymorphism and = 1 indicating maximal polymorphism.226

In order to identify the type of selection acting on pqqC,gyrB and rpoD codons, the fast227

single-likelihood ancestor (SLAC) counting method was applied. The SLAC method is228

available in a free public web implementation (http://www.datamonkey.org) and compares229

the ratio of non-synonymous (dN) and synonymous (dS) codon changes of a given population230

assuming neutral evolution, providing information about the type of selective constraint231

acting on the proteins (20). AdN/dS< 1 indicates purifying selection, dN/dS > 1 positive232

selection, and a dN/dS 1 neutral selection.233

Phosphate solubilisation activity ofPseudomonas isolates. The ability ofPseudomonas234

strains/isolates to solubilize phosphate was measured for 41 pseudomonads reference strains235

and 29 wheat root isolates belonging each to a different rpoD-gyrB operational taxonomical236

unit (OTU) (Table S1) on solid NBRIP medium (30) as follows. LB overnight cultures of237

bacterial strains were used to spot-inoculate (5 l) the NBRIP plates, which were then sealed238

with parafilm and incubated in the dark at 27C for 19 days. Solubilization of tri-239

calciumphosphate resulted in the formation of clear halos around the bacterial colonies. The240

solubilization activity per bacterial strain was evaluated by subtracting the diameter of the241

colonies from the entire diameter of the halos (7). Strains were divided into four classes242

according to their P-solubilization activity: 1, very low activity (0.04.4 mm); 2, low activity243

(4.55.4 mm); 3, medium activity (5.56.4 mm); and 4, strong activity (6.57.5 mm). Three244

to six replicate plates were prepared for each strain.245

P solubilisation data were statistically analysed using SYSTAT 12 (Systat Software, Inc.,246

San Jose, CA, USA) at the probability threshold of 0.05. Data were first analyzed by analysis247

of variance (ANOVA), and pairwise mean comparisons of different (sub)groups were248

subsequently done, using Tukeys range test.249

250


12/37

12

RESULTS251

Primer specificity and pqqCabundance in pseudomonads. The pqqCf1 and pqqCr1252

primers pair was specific for the genusPseudomonas and did not amplify any of the twelve253

other tested genera. ThepqqCgene could be amplified in all tested pseudomonads, i.e. in 57254

reference strains (37 DAPG-producing fluorescent pseudomonadsand 20 pseudomonads not255

producing DAPG belonging to at least nine different species) and in 140 wheat root isolates256

from a Swiss field site belonging to the Pseudomonas genus based on similarity levels257

determined by BLAST search of sequenced gyrB orrpoD fragments. All strains produced a258

single amplicon, except DAPG-producing strains of the multilocus group E (strains F96.27,259

P97.38, P97.6, P97.1 and F96.26) (8) and P. aeruginosa PAO1, which produced unspecific260

PCR products.261

Phylogenetic comparison between pqqCand the two housekeeping genes rpoD and262

gyrB within the genus Pseudomonas. The phylogeny of the pqqCgene was compared to263

that of the two housekeeping genes rpoD and gyrB for 36 Pseudomonas reference strains,264

including known biocontrol strains and other strains found in soil environment. To allow a265

better resolution of the Pseudomonas phylogeny, the rpoD and gyrB sequences were266

concatenated as done by Yamamoto et al. before inferring the phylogenetic tree (Fig. 1A)267

(43). The tree based on pqqCsequences (Fig. 1B) showed phylogenetic clusters similar to268

those of the tree inferred from the concatenated housekeeping genes (Fig 1A). Nevertheless,269

there were some emplacement differences. First, in the concatenated rpoD-gyrB tree, theP.270

syringae strains (thin lined box, Fig. 1) were well separated from the P. fluorescens main271

group as defined in Mulet et al. (29), whereas in the pqqC tree, they clustered within this272

group. Second, in the rpoD-gyrB tree, the group of DAPG and PLT producers (thick lined273

box, Fig.1) were located within the P. fluorescens group and clustered close to the P.274


13/37

13

chlororaphis subgroup (dashed lined box, Fig. 1) while in the pqqC tree, these strains275

clustered apart from theP. fluorescens group.276

Single-locus trees often display incongruent topologies when compared with one another.277

Concatenation of two or more loci has been shown to increase the resolution of the inferred278

phylogenies (43). Assuming that thegyrB-rpoD tree (Fig. 1A) represents a good explanation279

of the species phylogeny of the genus Pseudomonas (43), we compared different tree280

topologies based on single loci (gyrB, rpoD, and pqqC) and concatenated loci (gyrB-pqqC,281

gyrB-rpoD-pqqCand rpoD-pqqC) to that reference tree using the SH test. ThepqqCtree was282

found to be the only single locus tree incongruent with the gyrB-rpoD reference tree (P


14/37

14

Interestingly, only two wheat root isolates (RW09-C22 and RW09-C29) shared the same300

OTU as some cloned pqqC fragments. This means a total of 108 different OTUs were301

detected in the wheat rhizosphere population investigated. The amount of total pqqC302

pseudomonads on the roots of the wheat plants and in the bulk soil was quantified by the303

Most Probable Number Technique (MPN) and resulted in 2.83E+08 pseudomonads per g root304

and 1.77E+06 pseudomonads per g soil, respectively.305

Phylogenetic analyses of pseudomonads colonizing the roots of field grown wheat306

based on pqqCor concatenated rpoD-gyrB sequences. Phylogenetic trees were inferred307

from concatenated rpoD-gyrB and frompqqCsequences of 36 reference pseudomonads and308

136 pseudomonads isolated from wheat roots (Figs. 2A and S2). Moreover a pqqC309

phylogenetic tree was constructed which additionally included 107 cloned pqqCsequences310

obtained from a cultivation-independent method (Fig. 2B). In the rpoD-gyrB tree (Fig. 2A)311

two lineages and four main groups were identified according to Mulet et al. (29), i.e. the P.312

fluorescens lineage containingP. fluorescens (group 1),P. syringae (group 2) andP. putida313

(group 3), and the P. aeruginosa lineage containing P. aeruginosa, P. mendocina and P.314

stutzeri (group 4). TheP. fluorescens group 1 was further subdivided into seven subgroups;315

i.e. 1a (DAPG producers,P. kilonensis andP. corrugata), 1b (containingP. fluorescens Pf0-316

1), 1c (P. chlororaphis), 1d (DAPG and PLT producers),1e (wheat isolates from this study),317

1f (containingP. fluorescens 2-79) and 1g (containingP. fluorescens SBW25).318

ThepqqCtrees displayed a topology similar to that of the rpoD-gyrB tree; however, some319

differences in group allocations were detected. Remarkably, in bothpqqCtrees (Figs. 2B and320

S2B) including or not sequences from non-cultivated pseudomonads, subgroup 1d (DAPG321

and PLT producers) clearly clustered away from the P. fluorescens group whereas the P.322

syringae group clustered within the P. fluorescens group. In the pqqC tree that is based on323

sequences of cultivated pseudomonads only (Fig. S2B), subgroup 1c which contains the P.324


15/37

15

chlororaphis strains also clustered outside theP. fluorescens group and close to subgroup 1d.325

ThreepqqCsequences from non-cultivated pseudomonads did not fit in any of the four main326

groups and were thus designated as group 5 (one sequence) which clustered close to the P.327

syringae group and group 6 (two sequences) which clustered close to theP. aeruginosa group328

(Fig. 2B). Finally, four different sequences derived from the pqqC clone library clustered329

within theP. fluorescens group 1 but away from any defined subgroup and were thus defined330

as subgroup 1h.331

Phylogenetic distribution of cultivated and non-cultivated pseudomonads from332

wheat roots based on pqqC. Nearly all of 140 root-isolated pseudomonads as well as the333

great majority (98%) of the 107 cloned pqqC sequences derived from the cultivation-334

independent approach were found to cluster within theP. fluorescens group 1 (Fig. 2B, Table335

3). However, their distribution among the subgroups of group 1 was different. The majority336

of cloned pqqC sequences (84%) was located in subgroup 1g. In contrast, most of the337

cultivated bacteria were distributed within subgroups 1b (34%), 1g (29%), 1f (19 %) and 1e338

(12%). Interestingly, subgroups 1a, 1d and 1f contained only cultivated whereas subgroup 1h339

contained only non-cultivated bacteria.340

pqqC, gyrB and rpoD GC contents and polymorphism. To gain an insight into the341

polymorphism and the selective pressure acting onpqqC, the GC content, the diversity index342

() and ratios of non-synonymous to synonymous substitutions (dN/dS) were calculated for343

the genusPseudomonas and a wheat root population (Table 4). The nucleotide diversity ()344

of strains representing the genusPseudomonas was 0.145 forpqqC. This value was situated345

between the values of the housekeeping genesgyrB (0.125) and rpoD (0.236), indicating a346

polymorphism ofpqqCgreater thangyrB but lower than rpoD. For all the investigated data347

sets, synonymous to non-synonymous substitutions (dN/dS) ratios were significantly below 1,348

indicating that the selective pressure acting onpqqC, gyrB and rpoD is purifying (Table 4).349


16/37

16

Phosphate solubilization activity and presence of hcnAB and phlD genes. The350

relationship between the pqqC phylogeny and the P-solubilization activity and also the351

presence ofhcnAB andphlD genes which are known to be involved in antifungal activity of352

fluorescent pseudomonads was investigated (Table S1). DAPG and PLT producing reference353

strain CHA0 of subgroup 1d and the RW09-C21 isolate of subgroup 1a were the strongest354

phosphate solubilizers (7.25 mm halo size on NBRIP agar plates). Isolate RW09-C25 of355

subgroup 1b exhibited the lowest solubilization activity (1.25 mm halo size). When356

comparing the average solubilization activities of the different phylogenetic groups, the357

highest solubilization activity was found for bacteria of subgroup 1d, with an average halo358

size of 6.74 mm, which was significantly (P value < 0.05) higher than that of the other359

subgroups (Table 3). All other (sub)groups were generally more heterogeneous in their360

solubilization activity and did not differ significantly from one another. Nevertheless,361

subgroup 1g (average halo size = 6.02 mm) also contained some isolates with high362

solubilization properties (Table S1). Among the bacteria isolated from wheat roots only six363

were found to contain thehcnAB genes, five among them also contain thephlD gene and are364

located in subgroup 1d (Table S1).365

366

367


17/37

17

DISCUSSION368

This work represents the first study on the phylogeny of a gene involved in the369

pyrroloquinoline quinone (PQQ) biosynthesis in the genus Pseudomonas. We furthermore370

provide data on the frequency and diversity of this gene, pqqC, in a natural Pseudomonas371

rhizosphere population. The development of a Pseudomonas-specific primer pair targeting372

pqqCallowed us to detect the gene by PCR in all tested species ranging from human- and373

plant-pathogenic pseudomonads (P. aeruginosa,P. corrugata andP. syringae) to plant- and374

soil-associated non-pathogenic pseudomonads (P. fluorescens, P. kilonensis, and P. putida)375

and also in all the pseudomonads we have isolated from wheat roots. Overall, this suggests376

thatpqqCis ubiquitous in the genus Pseudomonas. Although PQQ seems to be present also377

in a majority of other bacterial genera, it is not ubiquitous, since especially species and378

strains, that live in anaerobic environments and do not use glucose as carbon source produce379

PQQ-dependent GDH but not the PQQ cofactor, thus the enzyme remains inactive in these380

bacteria (1). In contrast, the majority of the Pseudomonas species are strictly aerobic381

organisms and glucose oxidizers.382

So far, mainly 16S rRNA and a few other housekeeping genes were considered to be383

suitable for studying species phylogeny (43), because they are conserved and ubiquitous384

among genera. Here, we demonstrate the usefulnessofpqqC, a gene which is involved in385

plant-beneficial activities for phylogeny studies in the genusPseudomonas. The pqqCgene386

delineated similar phylogenetic groupsas the concatenated rpoD-gyrB genes (43) when387

considering reference pseudomonads only (Fig. 1), demonstrating that pqqCis conserved. It388

is worth noting, however, that the emplacement of some strains, such as those from subgroup389

1d (with reference strains CHA0 and Pf 5) and group 2 (P. syringae), in the pqqCtree was390

different from that of those in the rpoD, gyrB and rpoD-gyrB trees. Similar findings were391

obtained by de Souza et al. for the topology of the gacA gene, which encodes a global392


18/37

18

regulator of secondary metabolites production (6). Interestingly in thepqqCbased trees (Fig.393

1B and Fig. 2B), subgroup 1d was always phylogenetically well separated from the P.394

fluorescens main group 1. The phylogenetic incongruence between the pqqC tree and the395

rpoD-gyrB tree is in accordance with results obtained by Frapolli et al., which showed that396

single-locus topologies of different housekeeping genes were mostly incongruent when397

compared with each other (8). In fact, the addition ofpqqCto the rpoD-gyrB dataset resulted398

in a topology congruent to that of the concatenated rpoD-gyrB tree (Fig. S1). The clear399

demarcation, however, of subgroup 1d strains from other DAPG-producing fluorescent400

pseudomonads observed in other studies based on genetic and phenotypic traits (8, 18, 31) led401

to a comprehensive taxonomic study on CHA0/Pf-5-like strains, for which the name P.402

protegens was suggested (32). In the present study, the phylogenetic analysis of the pqqC403

gene of this species and its greater ability to solubilize phosphate than other strains (see404

below) points to the same conclusion with respect to the particular position of this group405

within the fluorescent pseudomonads.406

Purifying and/or neutral selection are major selective forces acting on housekeeping gene407

codons (8) to remove alleles that are deleterious or to preserve protein functions, respectively.408

Here, purifying selection acting on pqqC (dN/dS = 0.036) was detected when considering409

strains belonging to the major phylogenetic groups of the Pseudomonas genus described by410

Mulet et al. (29). Therefore, it can be assumed that pqqC plays an important role in the411

Pseudomonas genus. However, since pqqCis not constitutively expressed, and its regulation412

depends on environmental factors (42), it cannot substitute for loci commonly used for413

phylogenetic studies, such as 16 rRNA or housekeeping genes, but should be considered as a414

complementary molecular marker. Our results revealed that pqqCis an excellent marker to415

study the diversity of phosphate-solubilizing pseudomonads in rhizosphere populations (Figs.416

2B and S2B). In fact, pqqCpolymorphism found within the Pseudomonas genus was high417


19/37

19

enough (nucleotide diversity = 0.145) to ensure a resolving power similar to that obtained418

with rpoD (nucleotide diversity = 0.236) or gyrB (nucleotide diversity = 0.125).419

MoreoverpqqCallowed a clear grouping of DAPG-producing Pseudomonas strain into the420

five multilocus groups A, C, D, E, and F, as defined by Frapolli et al. (8), hence a421

differentiation at the sub-species level (Fig. S3)422

When comparing a cultivation-independent with a cultivation-dependent approach, we423

found that the first allowed the detection of more OTUs and that the proportion ofpqqC424

clones and Pseudomonas isolates per phylogenetic (sub)group was different (Table 3). The425

large majority of non-cultivated bacteria was included in subgroup 1g (with reference strain426

SBW25), whereas the cultivated isolates were more evenly distributed. Interestingly, only427

two out of a total of 108 OTUs were detected by both methods. Our data indicate that the two428

approaches detect different pseudomonads, thereby complementing each other. The429

cultivation-dependent method probably detects bacteria that are present in low numbers and430

thus below the detection limit of the cultivation-independent method but that grow very well431

in liquid culture; so these bacteria are selected for by the cultivation step. This finding is432

supported by other reports indicating that cultivation-dependent methods allow the433

identification of different genotypes than cultivation-independent methods (9, 45). Bobwhite,434

the variety used in this study seems to accumulate pseudomonads of subgroup 1g. For wheat,435

it is known that there is a cultivar-specific preference for certain Pseudomonas groups or436

genotypes. In a previous study we have shown that different wheat cultivars accumulate437

different genotypes of DAPG-producing pseudomonads (27)438

The fact that all analyzed pseudomonads were able to solubilize phosphate on NBRIP and439

that the pqqC gene was always amplified in these strains, suggests the presence of a440

functional PQQ enzyme. Pseudomonas spp. from the subgroup 1d (corresponding to the441

newly described P. protegens) were found to solubilize significantly more phosphate on442


20/37

20

NBRIP plates than pseudomonads from other (sub)groups. Similarly, Miller et al. (28)443

identified strains Pf-5 and CHA0 as superior P solubilizers and hypothesised that multiple444

copies ofpqqA and pqqB, confirmed by BLAST analysis of the sequenced genome of Pf-5445

(NC_004129), could lead to increased PQQ and gluconic acid production. Remarkably,446

besides being strong phosphate-solubilizers, the pseudomonads of subgroup 1d are potent447

biocontrol bacteria producing multiple antimicrobial substances such as DAPG, HCN, PLT448

and pyrrolnitrin. Another subgroup harboring many efficient phosphate-solubilizing bacteria449

was subgroup 1g (with reference strain SBW25). There are other studies that have identified450

Pseudomonas strains closely related to SBW25 as strong P-solubilizers (4, 13). For future451

studies, it would be interesting to test strong phosphate solubilizers selected from subgroups452

1d and 1g for efficacy in planta in comparison to strains of other phylogenetic backgrounds.453

In conclusion, we provide strong evidence for the ubiquitous presence of the pqqCgene454

in the genus Pseudomonas. Our results on pqqCdiversity indicate that this gene is conserved455

within the genus Pseudomonas and has a high phylogenetic resolving power comparable to456

that of the widely used gyrB and rpoD genes. pqqC therefore emerges as a novel marker,457

complementary to the conventionally used housekeeping genes, which is suited for458

phylogenetic studies on the genus Pseudomonas and for the analysis of Pseudomonas459

populations in natural habitats.460

461


21/37

21

ACKNOWLEDGMENTS462

We thank Andrea Foetzki, Carolin Luginbhl, Michael Winzeler, and other collaborators463

from the Swiss agricultural research station Agroscope Reckenholz-Tnikon ART for464

management of the field experiment and Aria Maya Minder and Tania Torossi from the465

Genetic Diversity Centre, ETH Zrich for technical support. This study was supported by the466

Swiss National Science Foundation (National Research Program NRP59, project 405940-467

115596).468

469


22/37

22

REFERENCES470

1. Adamovicz, M., T. Conway, and K. W. Nickerson. 1991. Nutritional471complementation of oxidative glucose metabolism in Escherichia coli via472

pyrroloquinoline quinone-dependent glucose dehydrogenase and the Entner-473

Doudoroff pathway. Appl. Environ. Microbiol. 57:20122015.474

2. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by475lysogenicEscherichia coli. J. Bacteriol. 62:293300.476

3. Brandl, H., S. Lehmann, M. A. Faramarzi, and D. Martinelli. 2008.477Biomobilization of silver, gold, and platinum from solid materials by HCN-forming478

microorganisms. Hydrometallurgy 94:1417.479

4. Browne, P., O. Rice, S. H. Miller, J. Burke, D. N. Dowling, J. P. Morrissey, and480F. OGara.2009.Superior inorganic phosphate solubilization is linked to phylogeny481

within thePseudomonas fluorescens complex. Appl. Soil Ecol. 43:131138.482

5. Choi, O., J. Kim, J. G. Kim, Y. Jeong, J. S. Moon, C. S. Park, and I.Hwang.4832008. Pyrroloquinoline quinone is a plant growth promotion factor produced by484

Pseudomonas fluorescens B16. Plant Physiol. 146:657668.485

6. de Souza, J. T., M. Mazzola, and J. M. Raaijmakers . 2003. Conservation of the486response regulator gene gacA inPseudomonas species. Environ. Microbiol. 5:1328487

1340.488

7. de Werra, P., M. Pechy-Tarr, C. Keel, and M. Maurhofer. 2009. Role of gluconic489acid production in the regulation of biocontrol traits ofPseudomonas fluorescens490

CHA0. Appl. Environ. Microbiol.75:41624174.491

8. Frapolli, M., G. Dfago, and Y. Monne-Loccoz. 2007. Multilocus sequence492analysis of biocontrol fluorescent Pseudomonas spp. producing the antifungal493

compound 2,4-diacetylphloroglucinol. Environ. Microbiol. 9:19391955.494


23/37

23

9. Frapolli, M., Y. Monne-Loccoz, J. Meyer, and G. Dfago. 2008. A new DGGE495protocol targeting 2,4-diacetylphloroglucinol biosynthetic gene phlD from496

phylogenetically contrasted biocontrol pseudomonads for assessment of disease-497

suppressive soils. FEMS Microbiol. Ecol. 64:468481.498

10.Gobbin, D., F. Rezzonico, and C. Gessler. 2007. Quantification of the biocontrol499agent Pseudomonas fluorescens Pf153 in soil using a quantitative competitive PCR500

assay unaffected by variability in cell lysis- and DNA-extraction efficiency. Soil Biol.501

Biochem. 39:16091619.502

11.Goldstein, A. H. 1986. Bacterial solubilization of mineralphosphates: historical503perspective and future prospects. Am. J. Alternative Agr. 1:5157.504

12.Guindon, S., F. Lethiec, P. Duroux, and O. Gascuel. 2005. PHYML Onlinea505web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids506

Res. 33:W557W559.507

13.Gulati, A., P. Rahi, and P. Vyas. 2008. Characterization of phosphate-solubilizing508fluorescent pseudomonads from the rhizosphere of seabuckthorn growing in the cold509

deserts of Himalayas. Curr. Microbiol. 56:7379.510

14.Guo, Y. B., J. Li, L. Li, F. Chen, W. Wu, J. Wang, and H. Wang .2009. Mutations511that disrupt either thepqq or thegdh gene ofRahnella aquatilis abolish the production512

of an antibacterial substance and result in reduced biological control of grapevine513

crown gall. Appl. Environ. Microbiol. 75:67926803.514

15.Haas, D., and G. Dfago. 2005. Biological control of soil-borne pathogens by515fluorescent pseudomonads. Nat. Rev. Microbiol. 3:307319.516

16.Haas, D., and C. Keel. 2003. Regulation of antibiotic production in root-colonizing517Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev.518

Phytopathol. 41:117153.519


24/37

24

17.Han, S. H., C. H. Kim, J. H. Lee, J. Y. Park, S. M. Cho, S. K. Park, K. Y. Kim, H.520B. Krishnan, and Y. C. Kim. 2008. Inactivation ofpqq genes ofEnterobacter521

intermedium 60-2G reduces antifungal activity and induction of systemic resistance.522

FEMS Microbiol. Lett. 282:140146.523

18.Keel, C., D. M. Weller, A. Natsch, G. Dfago, R. J. Cook, and L. S. Thomashow.5241996. Conservation of the 2,4-diacetylphloroglucinol biosynthesis locus among525

fluorescent Pseudomonas strains from diverse geographic locations. Appl. Environ.526

Microbiol. 62:552563.527

19.King, E., M. K. Ward, and D. E. Raney . 1954. Two simple media for the528

demonstration of pyocanin and fluorescin. J. Lab. Clin. Med. 44:301307.529

20.Kosakovsky Pond, S. L., A. F. Y. Poon, and S. D. W. Frost . 2007. Estimating530selection pressures on alignments of coding sequences analyses using HyPhy.531

www.hyphy.org/pubs/hyphybook2007.pdf.532

21.Landa, B. B., J. M. Cachinero-Daz, P. Lemanceau, R. M. Jimnez-Daz, and C.533Alabouvette. 2002. Effect of fusaric acid and phytoanticipins on growth of534

rhizobacteria andFusarium oxysporum. Can. J. Microbiol. 48:971985.535

22.Magnusson, O. T., H. Toyama, M. Saeki, A. Rojas, J. C. Reed, R. C. Liddington,536J. P. Klinman, and R. Schwarzenbacher. 2004. Quinone biogenesis: structure and537

mechanism of PqqC, the final catalyst in the production of pyrroloquinoline quinone.538

Proc. Natl. Acad. Sci. U.S.A. 101:79137918.539

23.Mavrodi, D. V., T. L. Peever, O. V. Mavrodi, J. A. Parejko, J. M. Raaijmakers,540P. Lemanceau, S. Mazurier, L. Heide, W. Blankenfeldt, D. M. Weller, and L. S.541

Thomashow. 2010.Diversity and evolution of the phenazine biosynthesis pathway.542

Appl. Environ. Microbiol. 76:866879.543


25/37

25

24.McGowan, S. J., M. Sebaihia, L. E. Porter, G. S. A. B. Stewart, P. Williams, B.544W. Bycroft, and G. P. C. Salmond. 1996. Analysis of bacterial carbapenem545

antibiotic production genes reveals a novel beta-lactam biosynthesis pathway. Mol.546

Microbiol. 22:415426.547

25.McSpadden Gardener, B. B., D. V. Mavrodi, L. S. Thomashow, and D. M.548Weller. 2001. A rapid polymerase chain reaction-based assay characterizing549

rhizosphere populations of 2,4-diacetylphloroglucinol-producing bacteria.550

Phytopathology 91:4454.551

26.Mendes, R., Kruijt, M., de Bruijn, I., Dekkers, E., van der Voort, M., Schneider,552

J. H. M., Piceno, Y. M., DeSantis, T. Z., Andersen G. L., Bakker, P. A. H. M.,553

and J. M. Raaijmakers. 2011. Deciphering the rizosphere microbiome for disease-554

suppressive bacteria. Science 332:10971100.555

27.Meyer, J. B., M. P. Lutz, M. Frapolli, M. Pchy-Tarr, L. Rochat, C. Keel, G.556Dfago, and M. Maurhofer. 2010. Interplay between wheat cultivars, biocontrol557

pseudomonads, and soil. Appl. Environ. Microbiol. 76:61966204.558

28.Miller, S., P. Browne, C. Prigent-Combaret, E. Combes-Meynet, J. Morrissey,559and F. OGara. 2010. Biochemical and genomic comparison of inorganic phosphate560

solubilization inPseudomonas species. Environ. Microbial. Rep. 2:403411.561

29.Mulet, M., J. Lalucat, and E. Garca-Valds. 2010. DNA sequence-based analysis562of thePseudomonas species. Environ. Microbiol. 12:15131530.563

30.Nautiyal, C. S. 1999. An efficient microbiological growth medium for screening564phosphate solubilizing microorganisms. FEMS Microbiol. Lett. 170:265270.565

31.Ramette, A., M. Frapolli, G. Dfago, and Y. Monne-Loccoz. 2003. Phylogeny of566HCN synthase-encoding hcnBCgenes in biocontrol fluorescent pseudomonads and its567


26/37

26

relationship with host plant species and HCN synthesis ability. Mol. Plant Microbe568

Interact. 16:525535.569

32.Ramette, A., M. Frapolli, M. Fischer-Le Saux, C. Gruffaz, J. M. Meyer, G.570Dfago, L. Sutra, and Y. Monne-Loccoz. 2011.Pseudomonas protegens sp. nov.,571

widespread plant-protecting bacteria producing the biocontrol compounds 2,4-572

diacetylphloroglucinol and pyoluteorin. Syst. Appl. Microbiol. 34:180188.573

33.Rezzonico, F., G. Dfago, and Y. Monne-Loccoz. 2004. Comparison of ATPase-574encoding type III secretion system hrcN genes in biocontrol fluorescent575

pseudomonads and in phytopathogenic proteobacteria. Appl. Environ. Microbiol.576

70:51195131.577

34.Rozas, J., J. C. Sanchez-DeL Barrio, X. Messeguer, and R. Rozas . 2003. DnaSP,578DNA polymorphism analyses by the coalescent and other methods. Bioinformatics579

19:24962497.580

35.Saitou N., and M. Nei. 1987. The neighbor-joining method: a new method for581reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406425.582

36.Schnider, U., C. Keel, C. Voisard, G. Dfago, and D. Haas . 1995. Tn5-directed583cloning ofpqq genes fromPseudomonas fluorescens CHA0: mutational inactivation584

of the genes results in overproduction of the antibiotic pyoluteorin. Appl. Environ.585

Microbiol. 61:38563864.586

37.Shimodaira, H. and M. Hasegawa. 1999. Multiple comparisons of log-likelihoods587with applications to phylogenetic inference. Mol. Biol. Evol. 16:11141116.588

38.Silby, M. W., et al. 2009. Genomic and genetic analyses of diversity and plant589interactions ofPseudomonas fluorescens. Genome Biol. 10:R51.590


27/37


28/37

28

FIG. 1. Phylogenetic relationships among 36 Pseudomonas reference strains, including612

known biocontrol strains described in Table 1. The neighbor-joining (NJ) trees were inferred613

from concatenated sequences of the two housekeeping genes rpoD andgyrB (1130 bp) (1A)614

and frompqqC(507 bp) sequences (1B). Only bootstrap values greater than 50% are shown.615

Scale bar = 0.02 substitutions per site. Thin-lined box: P. syringae group, dashed-lined box:616

P. chlororaphis group and thick-lined box: subgroup 1d (containing strains described as P.617

protegens by Ramette et al., (32). Capital letters following the names of DAPG-producing618

strains indicate the multilocus group defined by Frapolli et al. (8).619

620

FIG. 2. Phylogenetic relationships amongPseudomonas reference strains and pseudomonads621

isolated from the rhizosphere of field-grown wheat in this study. The neighbor-joining (NJ)622

trees were inferred from concatenated sequences of the two housekeeping genes rpoD and623

gyrB (1130 bp) (2A) and from pqqC(507 bp) sequences (2B). Only bootstrap values greater624

than 50% are shown. Scale bar = 0.02 substitutions per site. Both trees include sequences of625

36 reference strains and of 136 pseudomonads isolated from wheat roots. Furthermore, the626

pqqC tree (2B) includes additional 107 partial pqqC sequences of non-cultivated bacteria627

(cloned sequences).Pseudomonas isolates are described as follows: the first and the second628

number indicate the number of isolates per OTU (operational taxonomic unit) and the OTU629

number, respectively, while C designates cultivated bacteria. Non-cultivated pseudomonads630

are described by NC preceded by a figure indicating the number of cloned sequences and631

followed by a figure in brackets describing the number of different OTUs identified from632

these sequences. Cultivated and non-cultivated bacteria were obtained from the same wheat633

roots sampled in a Swiss field. Capital letters following the names of reference strains634

indicate the multilocus group defined by Frapolli et al. (8). Font colours indicate phosphate635

solubilization classes on NBRIP medium (based on halo diameter) as described in the636


29/37

29

Material and Methods section and correspond to very low (violet), low (dark blue), medium637

(green), or strong (red) activity or not determined (black).638

639

640


30/37

30

TABLE 1. Bacterial strains and isolates used in this study641

Bacterial strains Comments Reference

DAPG-producing reference pseudomonads

(A)a: C*1A1, CM1'A2, K93.3, K94.31, P96.25, P97.30,

Q65c-80 b, Q128-87, S8-151, TM1B2(B): F113, K93.2, K94.37, P12, Q37-87

(C): Q2-87, Q7-87, Q12-87, Q86-87

(D): C10-186, C10-190, K93.52, PILH1, PITR2(E): F96.26, P97.1, P97.6, P97.38, F96.27

(F): CHA0, K94.41, PF, Pf-5, PGNL1, PGNR1, S8-62

(-): P97.26

Biocontrol8, 18

Reference pseudomonads, not producing DAPG

P. aeruginosa PAO1 T (LMG12228 T)Human pathogen,

biocontrol, type strainBCCM c

P. caricapapayae LMG2152 TPlant pathogen, type

strainBCCM

P. chlororaphis 30-84 Biocontrol 23P. chlororaphis DTR133 Soil bacterium 21

P. chlororaphis LMG1245 T Type strain BCCM

P. chlororaphis LMG5004 T Type strain BCCM

P. corrugata LMG2172 TPlant pathogen, type

strainBCCM

P. fluorescens 2-79 Biocontrol 23

P. fluorescens DSS73 Biocontrol C. Keel (UNIL) c

P. fluorescens KD Biocontrol 33

P. fluorescens LMG1794 T Type strain BCCM

P. fluorescens MIACH Soil bacterium This study

P. fluorescens GUGO Soil bacterium This study

P. fluorescens Pf0-1 Soil bacterium 38

P. fluorescens SBW25 Biocontrol 38

P. kilonensis 520-20T

(DSM13647T

) Type strain DMSZc

P. plecoglossicida PCPF1 Soil bacterium 3

P. putida LMG2257 T Type strain BCCM

P. putida P3 Soil bacterium C. Keel (UNIL)

P. rhizospherae IH5 T (LMG21640 T) Type strain BCCM

Non-Pseudomonas bacteria

Agrobacterium tumefaciens Plant pathogen C. Keel (UNIL)

Bacillus mycoides A23 Not documented 10

Burkholderia cepacia Biocontrol C. Keel (UNIL)

Cupriavidus necatorJMP134 (LMG1197) Biodegradation BCCM

Escherichia coli DH5 Laboratory strainInvitrogen, Carlsbad,

CA, USA

Erwinia carotovora ATTn10 Plant pathogen 24

Photorhabdus luminescens TT01T (DSM15139 T) Insect pathogen, typestrain DMSZ

Rhodococcus sp. strain C125 (DSM44236) Biodegradation DMSZ

Sphingomonas herbicidovorans MHT (DSM11019 T)Biodegradation, type

strainDMSZ

Sphingobium japonicum UT26T (DSM16413T)Biodegradation, typestrain

DMSZ


31/37

31

Streptomyces scabies Sy9103 Plant pathogen C. Beaulieu (UdeS) c

Xanthomonas campestris LMG568TPlant pathogen, type

strainBCCM

Pseudomonas wheat root isolates

140 isolates representing 34 OTUs (see Fig. 2) described

as RW09-C1.x to RW09-C34.x (Table S1) where x standsfor the isolate number

Soil bacteria This study

a Letters in brackets indicate the multilocus group of DAPG-producing pseudomonad as defined by Frapolli et642

al. (8).643

b Underlined strains were included in the phylogenetic analysis presented in Figs. 1, 2 as well as Figs. S1 and644

S2 (supplemental material).645

c Abbreviations. BCCM: Belgian Co-ordinated Collections of Microorganisms. DSMZ: Deutsche Sammlung646

von Mikroorganismen und Zellkulturen GmbH..UNIL = University of Lausanne, Switzerland. UdeS: University647

of Sherbrooke, Canada.648

649


32/37

32

TABLE 2. Primers used in this study650

Gene product Primer sequence (5-3)Primer

name

Annealing

temperature (C)

Product

length (bp)

Target

geneReference

Pyrroloquinoline

quinone (PQQ)

oxidase

CAGGGCTGGGTCGCCAACC

CATGGCATCGAGCATGCTCC

pqqCf1

pqqCr163 546 pqqC This study

DNA gyrase subunit BTTCAGCTGGGACATCCTGGCCAA

TCGATCATCTTGCCGACRACCA

gyrBf

gyrBr265 584-587 gyrB 8

RNA polymerase

subunit D

ACTTCCCTGGCACGGTTGACCA

TCGACATGCGACGGTTGATGTC

rpoDf

rpoDr60 693-696 rpoD 8

Phenazine biosynthetic

enzyme

ATCTTCACCCCGGTCAACG

CCRTAGGCCGGTGAGAAC

Ps_up1

Ps_low157 427 phzF 23

2,4-DAPG type III

polyketide synthase

ACCCACCGCAGCATCGTTTATGAGC

CCGCCGGTATGGAAGATGAAAAAGTC

B2BF

BPR460 629 phlD 25

Hydrogen cyanide

biosynthetic enzymes

TGCGGCATGGGCGTGTGCCATTGCTGCCTGG

CCGCTCTTGATCTGCAATTGCAGGCC

PM2

PM7-26R 67 570 hcnAB 40

651


33/37

33

TABLE 3. Distribution ofpqqC sequences derived from cultivated and non-cultivated (cloned652

sequences) pseudomonads obtained from wheat roots among the phylogenetic groups defined in Fig.653

2 and phosphate solubilization activity of different phylogenetic groups654

Pseudomonas phylogenetic groups as defined in Fig. 2 Percentage of bacteria per

phylogenetic (sub)groupsa

P-solubilization

activity b

Main group Subgroup Cultivated

(C) bacteria

Non-cultivated

(NC) bacteria

Halo diameter (mm)

1.P. fluorescens

group

1a DAPG producers,

P. kilonensis andP.

corrugata

1 0 5.80 0.11 (n = 23) c

1b ContainingP.fluorescens Pf0-1

34 4 5.52 0.27 (n = 10)

1c P. chlororaphis 0 0 5.70 0.24 (n = 3)

1d DAPG and PLT

producers

4 0 6.74 0.17 (n = 7)* d

1e Wheat isolates

from this study

12 6 5.64 0.57 (n = 3)

1f ContainingP.

fluorescens 2-79

19 0 5.91 0.37 (n = 6)

1g ContainingP.

fluorescens SBW25

29 84 6.02 0.11 (n = 12)

1h Non-cultivated

bacteria from this

study

0 4 -

2.P. syringae 0 0 6.50 0.18 (n = 1)

3.P. putida 1 0 5.96 0.18 (n = 5)

4.P. aeruginosa,

P. mendocina and

P. stutzeri

0 0 5.80 0.22 (n = 2)

5. Non-cultivated

bacteria from this

study

0 1 -

6. Non-cultivated

bacteria from this

study

0 1 -


34/37


35/37

35

TABLE 4. GC content, nucleotide diversity () and non-synonymous (dN) to synonymous (dS)662

substitution rates of pqqC, gyrB and rpoD sequences among the Pseudomonas genus and663

pseudomonads from wheat roots.664

Group Gene GC % b dN/dS c

Pseudomonas genus (n=19) a pqqC 65.5 0.145 0.036

Pseudomonas genus (n=19) gyrB 56.3 0.125 0.035

Pseudomonas genus (n=19) rpoD 62.4 0.236 0.250

Pseudomonads representing a wheat

root population (n=106)

pqqC 64.2 0.097 0.044

665

a n, number of analyzed sequences. Pseudomonas genus (pqqC, gyrB and rpoD): six strains of the phylogenetic P.666

fluorescens group 1 (LMG2172, Pf0-1, 30-84, CHA0, 2-79, SBW25), four strains of theP. syringae group 2 (LMG2152,667

DC3000, B728a, 140BA), five strains of theP. putida group 3 (P3, GB1, W619, KT2440, L48) and four strains of the P.668

aeruginosa group 4 (PAO1, UCBPP-PA14, ymp, A1501). Pseudomonas spp. from wheat roots (onlypqqC): 30 RW09669

isolates and 76 clonedpqqCsequences all representing different OTUs.670

b, nucleotide diversity per site.671

c dS, number of synonymous substitutions per site; dN, number of non-synonymous substitutions per site.672

673


36/37


37/37

Documents

Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11