7. MOLECULAR CHARACTERIZATION AND ...shodhganga.inflibnet.ac.in/bitstream/10603/96409/12/13...Molecular studies on Azadirachta indica Department of Biotechnology, Gulbarga University,

Molecular studies on Azadirachta indica

Department of Biotechnology, Gulbarga University, Kalaburagi. 179

7. MOLECULAR CHARACTERIZATION AND AMPLIFICATION OF

DIACYLGLYCEROL ACYLTRANSFERASE (DGAT) GENE FROM

AZADIRACHTA INDICA

Diacylglycerol acyltransferase (DGAT: EC 2.3.1.20) is the only enzyme in the

Kennedy pathway that is exclusively committed to the synthesis of storage oil in plants.

In this study, identification and amplification of the DGAT gene from neem, an important

oil seed crop is reported. Metabolic pathway engineering in oil seed crops is burgeoning

and promising technique to obtain a desirable oil quality and more yield for biodiesel

production and to further applications. Fatty acid biosynthesis and assembly into

triacylglycerol (TGA) are highly regulated at the biochemical level. Thus, identification

and amplification of respective enzyme in this pathway are of major importance for the

genetic manipulation. In plants, Fatty acid biosynthesis have been found localized in

plastids and exported to the endoplasmic reticulum for synthesis of TAG through the

enzymes of Kennedy pathway.

DGAT is a transmembrane enzyme that functions in the final step of TAG

biosynthesis, catalyzing the acylation of sn-1, 2-diacylglycerol (DAG) at the sn-3

position using an acyl-CoA substrate. DGAT has been proposed to be the rate-limiting

enzyme in plant storage lipid accumulation (Ichihara et al., 1988 and Perry et al., 1993).

Consequently, DGAT is considered a key enzyme for biotechnological purposes; it might

be utilized to increase oil content in plant species (Lardizabal et al., 2008 and Xu et al.,

2008). DGAT over expression causes a net increase in seed oil content in Arabidopsis

(Jako et al., 2001). Additional evidence is also available from studies of Glycine max



(Settlage et al., 1998), Brassica napus (Lock et al., 2009) and Zea mays (Zheng et al.,

2008).

Acyl-CoA diacylglycerol acyltransferase (DGAT) catalyzes the final and

committed step in TAG biosynthesis, and has been identified as the rate-limiting enzyme

for oil accumulation in some oil crops (Ichihara et al., 1988 and Lung et al., 2006). Three

acyltranferase glycerol-3 phosphate acyltranferase (GPAT), lysophosphatidic acid

acyltranferase (LPAT) and diacylglycerol acyltranferase (DGAT, EC 2.3.1.20) are

involved in the storage lipid bioassembly and catalyze the step wise acylation of the

glycerol backbone (Kennedy et al., 1956 and Ohlrogge et al., 1995).

Two gene families of DGAT-DGAT1 and 2 are reported to be mainly responsible

for TAG synthesis in plants, and mammals (Lardizabal et al., 2001). The DGAT1 gene

family has high sequence similarity with acyl CoA cholesterol acyltranferase (ACAT),

while DGAT2 family, identified first in the oleogenous fungus Morteriella ramaniana

shows no sequence similarity to the member of the DGAT1 gene family.

The cloning and functional expression of a DGAT gene in plants was first

reported in Arabidopsis thaliana (Hobbs et al., 1999). Seed specific over expression of

DGAT, cDNA in Arabidopsis enhances the oil deposition and its activity was increased

by 10-70%. In another study silencing of DGAT, in tobacco has been found to cause a

reduction in seed oil content. DGAT has been isolated and characterized from several

plant species including Brassica napus, Ricinus community, Evonymus alatus, Olea

europaea, Nicotina tobacum.



7.1 MATERIALS AND METHODS

7.1.1 Isolation of genomic DNA

0.2 g of Seeds were ground to powder with liquid nitrogen using a mortar and

pestle. It was suspended in CTAB (cethyltrimethyl ammonium bromide) extraction buffer

modified method of Rahmatollah et al., (2014). The extraction buffer contained, 2%

CTAB, 5 M NaCl, 0.5 M EDTA, 1 M Tris-HCl, pH 8.0, and 0.1% 2-mercaptoethanol,

0.1% activated charcoal. Sample was transferred to the eppendorf tube and vertexed for

5-10 times. Then tubes were centrifuged at 10,000 rpm for 15 min. Supernatant was

transfered to the new eppendorf tubes and 800µl of chloroform: isoamylalcohol (24:1)

was added. The content were mixed gently by vertexing, and centrifuged at 10,000 rpm

for 15 min. The aqueous layer was collected and precipitated by adding 0.8 volumes of

cold isopropanol. Mixed by inverting subsequently, the tubes were incubated at -200Cfor

1 h. The DNA was pelleted by centrifugation at 10,000 rpm for 15 min. The supernatants

were removed and the DNA pellet washed with 700 µl of 70% ethanol, repeating this

wash for two times. The pellet was dried for 10 minutes and then dissolved in 200 µl of

TE buffer.

7.1.1.1 Checking the presence of DNA

After DNA extraction, the existence and concentration of DNA were checked by

agarose gel electrophoresis. 0.7% agarose gel was prepared by boiling agarose in 1X Tris

acetate-EDTA (TAE) buffer. The prepared gel was poured into an electrophoresis plate

and left at room temperature for about 30 minutes for polymerization. 5 µl of newly

isolated genomic DNA and 1 µl of 6X loading buffer (bromophenol blue dye) were

mixed and then loaded into the wells of the gel. The DNAs were run on an agarose gel at



100V for about 30 minutes in 1X TAE buffer, stained in 0.5 µg/ml ethidium bromide (Et-

Br) solutions and then was visualized under UV light. The presence or absence of smears

and migration patterns of the bands on the gel corresponds to presence and the quality of

DNA

7.1.1.2 Purification of Genomic DNA

RNAase Treatment

The isolated genomic DNA was further purified by treating with RNAase to

remove RNA. To 100 μl of DNA isolated sample 5 µl of RNAase (5 mg/ml) was added

and incubated at 370C for 1 h.

Proteinase K Treatment

After incubation with RNAase, Proteinase K treatment was done to make the

DNA free from proteins. To the RNAase treated 100 μl DNA, 0.25 μl of Proteinase K (20

mg/ml) was added and incubated at 370C for 30 min. The reaction mixture was made up

to 500 μl with TE buffer and extracted with saturated phenol, chloroform, isoamyl

alcohol treatment.

7.1.1.3 Agarose gel electrophoresis

Agarose 0.7% (w/v) was prepared in 1X TAE buffer pH 8.0 (50X TAE buffer,

242 g Tris-base, 37.2 g EDTA, pH is adjusted with glacial acetic acid) by boiling for

homogeneity. The platform of electrophoresis was sealed on the open side by leucoplast.

The comb was adjusted to 1mm above the gel slab and 1cm from one sealed side. The

molten agarose was poured on to the platform and allowed to set at room temperature.

After setting the comb, leucoplast were carefully removed. The gel slab was placed in

electrophoretic chamber and 1X TAE buffer was poured into the chamber till the gel was



completely immersed in the buffer. DNA sample (2 μl) was mixed with 3 μl tracking dye

bromo phenol blue (BPB) (50% v/v glycerol, 1 mM EDTA pH 8.0, 0.25% v/v xylene

cyanol and distilled water) and the sample was loaded into the wells of agarose gel. The

loaded sample was electrophoresed at constant voltage (50V). After electrophoresis the

gel was observed under the gel documentation system.

7.1.2 RNA isolation

Total RNA was isolated using Trizol Reagent

1. 100 mg of tissue was homogenized in 1ml of Trizol reagent. Incubated for 5min

at room temperature and 200 µl of chloroform was added and centrifuged at

12000 rpm for 15 min at 40C.

2. Transferred the upper layer to the fresh tube with 0.5 ml of isopropyl alcohol for

precipitation of RNA.

3. Incubated at room temperature for 10 min.

4. Centrifuged at 12000 rpm for 10 min at 40C.

5. Removed the supernatant, washed RNA pellet with 75% ethanol mixed by

vertexing and centrifuged at 7500 rpm for 5min at 40C.

6. Air dried RNA pellet for 5-10 min.

7. Then RNA pellet was dissolved in nuclease free water by heating the sample

520C-65

0C for 10-15 min.

RNA quality and concentration were examined by electrophoresis in 1.5%

ethidium bromide stained agarose gel in 1X TAE buffer.



7.1.3 cDNA synthesis

A clean nuclease free micro centrifuge tube was taken and added the components

as shown in the Table 22.

Table 22: First step of cDNA synthesis

Contents Quantity

10mM dNTPs 1 µl

1-5 mM primer 1 µl

RNA(50ng) 1 µl

Nuclease free water 7 µl

Total 10 µl

After adding the components, tubes were incubated at 700C for 10 min tubes in

water bath. After the incubation tubes were removed and placed on ice then remaining

components were added to the tube as shown in Table 23.

Table 23: Second step of cDNA synthesis

Contents Quantity

10X Reverse Transcriptase buffer 2 µl

Reverse Transcriptase 1 µl

40U/µl RNAase inhibitor 0.5 µl

Nuclease free water 6.5 µl

Total 20 µl

After adding the components (Table 23), cDNA strand was produced by incubate

the tubes at 370C for 50 min in a water bath. Reverse transcriptase enzymes, is denatured

by heating the reaction tube at between 800C- 94

0C for 10 min.



cDNA quality and concentration were examined by electrophoresis in ethidium

bromide stained 1.5% agarose gel in 1X TAE buffer.

7.1.4 Designing of primers for PCR

7.1.4.1 Retrieval of DGAT gene specific primer

To design a gene specific primer, DGAT gene sequences were retrieved from

Nucleotide database from NCBI viz Brasicca napus, Arabidopsis thaliana and Nicotiana

tabaccum plants. The retrieved sequences were stored in notepad in FASTA format. The

stored sequences from notepad were loaded in the clustal X software. Then complete

alignment was carried out, to identify conserved region. And primers were designed for

this conserved region using OLIGO 4.0 and Primer 3 software as follow:

7.1.4.2 Primer designing using OLIGO 4.0 and Primer 3 software’s

OLIGO 4.0 and Primer 3 is the multifunctional program, suited to search for PCR

and/or sequencing primers in a given sequence. Computer searches are based on three

essential criteria, namely, specificity, the absence of dimer or hairpin structures, and the

formation of stable duplexes. So, the basis of the OLIGO program is similar to other

primer design programs, but it contains extended functions. The OLIGO advanced

applications include selecting primers compatible with preselected primers, conducting

inverse PCR searches, and designing probes for ligase chain reaction (LCR). It can

determine parameters when working for RNA, although they are not as accurate as for

DNA. It provides hybridization conditions for specific probes as well.

The sequences were loaded in OLIGO 4.0 or Primer 3 software.

Select change option to change the oligo nucleotide length, should be selected

between 15-30 bp.



Select go to position and select the position of upper and lower primers.

Select the analyze menu to analyze the primers for primer dimer, hair loop

formation, self complementary. All these parameters should be negligible. Tm

difference should be less than 10C, GC content should be 40-80%, and maximum

product length was selected.

The desired forward and reversed primers obtained were used for the

amplification of DGAT.

The primers were custom synthesized from Eurofins Pvt Ltd, Bengaluru. The

sequence of forward and reverse primer is shown in Table 24.

Table 24: Primer sequence for DGAT gene

Primer Oligonucleotides

1 5‟AACGGACTCCTCTCTCCGATACTT 3‟(F)

5‟AGGCAGAATCACACCTCAGTG 3‟(R)

2 5‟ATGGCGATTTTGGATTCT 3‟(F)

5‟ACCAATCTTTGTAGAATTC 3‟(R)

3 5‟ATGGCGATTTTGGATTCT 3‟ (F)

5‟ AGGCAGCCAAAGGAAAGATT 3‟ (R)

7.1.5 Polymerase Chain Reaction

The reaction mixture was standardized after several trials and final reaction

mixture contains the following component as shown in Table 25. The contents of the tube

were mixed thoroughly. The Palm cycler (Corrbett life science) was programmed for 40

cycles. Each cycle involved the following steps shown in Table 26, the steps 2-4 were

repeated 40 times.



Table 25: PCR reaction mixture

Constituents Working Concentration Quantity

Template DNA 50ng 1 µl

10X Taq Assay Buffer 1X 2 µl

dNTP‟s 200µM each dNTP‟s 1 µl

Primer Forward 10 picmol/µl 0.05 µl

Primer Reverse 10 picmol/µl 0.05 µl

Taq DNA Polymerase 3Unit 0.3 µl

Nuclease free water - 15.6 µl

Total reaction Volume - 20 µl

Table 26: PCR amplification conditions

Steps Process Temperature(0C) Time Cycle

1 Initial denaturation 94 5min 1

2 Denaturation 94 1min

40 3 Annealing 51 1:30 min

4 Extension 72 2min

5 Final extension 72 10min 1

6 Storage 4 4h

The amplified product was electrophoresed on 2% agarose gel with 1000 bp DNA

marker and an electrophoretic profile was documented using photo gel documentation

system (Vilber Lourmat, France).



7.1.5.1 Purification of PCR product

The amplified PCR product was purified by HipurA PCR product purification

spin kit. 500 µl of PCR binding solution was added to 100 µl of PCR sample and mixed

well. This mixture was then applied to Hi Elute Miniprep spin column and centrifuged

for 1 minute at 10,000 x 13,000 rpm. The flow was discarded and the column was

replaced in same collection tube. 700 µl of wash solution was added to the column and

centrifuged for 1 min at 10,000 x 13,000 rpm. The flow through was discarded and

column was replaced in a clean collection tube. Now, 50 µl of Elution buffer was added

to the center of Hi Elute Miniprep spin column and centrifuged for 1 min at 10,000 x

13,000 rpm. The presence of PCR amplification product in elute was confirmed by

Agarose Gel electrophoresis. The PCR product was immediately used as the template for

the amplification of the coding region of the DGAT gene.



7.2 RESULTS AND DISCUSSION

7.2.1 Results

7.2.1.1 DNA isolation

Genomic DNA was isolated by the CTAB method and purified by using RNAase

and Proteinase K treatment. Purified genomic DNA was analyzed with 0.8% Agarose gel

and thick clear band was observed under UV transilluminator after staining with ethidium

bromide (Fig. 16) and its size is approximately 26 Kb on comparison with 30 Kb ladder.

7.2.1.2 RNA isolation

Total RNA was isolated from the developing neem seeds by trizol reagent method

and isolated total RNA was electrophoresed on 1.5 % of agarose gel intense bands of 28s

and 18S was observed under UV transilluminator (Fig. 48).

7.2.1.3 cDNA Synthesis

Isolated RNA (5 µg/ml) was used to synthesis the cDNA using reverse

transcriptase, dNTP‟s as a substrate, oligoDT primer with a different temperature (720C,

370C and 94

0C) conditions the first strand was synthesized. cDNA is a DNA copy

synthesized from mRNA. The enzyme used is reverse transcriptase a DNA dependent

RNA polymerase. As with other polymerases a short double- stranded sequence is needed

at the 3‟ end of the mRNA which acts as a starting point for the polymerase activity. This

is provided by poly (A) tail found at the 3‟end of most mRNA to which a short

complementary synthetic oligo-DT primer is hybridized. Together with all 4 dNTPs at

neutral pH, reverse transcriptase synthesized a complementary DNA on mRNA template.



7.2.1.4 PCR amplification

The cDNA was used as template for partial amplification of the DGAT gene in

neem using DGAT gene specific primers (Forward: - 5‟ATGGCGATTTTGGATTCT 3‟

and Reverse: - 5‟ AGGCAGCCAAAGGAAAGATT 3‟). The primer were annealed at

540C and PCR amplified product were obtained after 40 cycles was run on 1% agarose

gel and observed under UV transilluminator. The PCR amplified product is

approximately 1200 bp in length as shown in Fig. 49.

Fig 47: RNA from neem seeds



7.2.2 DISCUSSION

Increasing seed oil production is a major goal for global agriculture to meet the

strong demand for oil consumption by humans and for biodiesel production. Oil from the

non food crops (biofuel) has shown potential to substitute fossil fuels. Neem

(Azadirachta indica A. Juss) is an excellent tree and naturalized across the globe. It is one

such promising tree species which yield oilseeds containing 40-45 % of non-edible oil. It

contains a high percentage of monounsaturated fatty acids (C16:1, C18:1), a low

proportion of polyunsaturated acids (C18:2, C18:3) and a controlled amount of saturated

fatty acids (C16:0, C18:0) (Wang et al., 2011) make it to be a useful renewable source for

biodiesel production.

It has long been understood that DGAT enzymes play important roles in TAG

biosynthesis. DGAT is the only enzyme in the pathway that is thought to be exclusively

committed to TAG synthesis, and thus it is considered a key enzyme in this reaction

(Chen et al., 2011). Azadirachta indica (Neem) is one of the most economically

important oil producing tree, and DGAT gene have been isolated and amplified from the

seeds. Saha et al. (2006) identified a soluble DGAT3 (AhDGAT3-1) from immature

peanut cotyledons and expressed its full length in Escherichia coli, where the

recombinant protein had high levels of DGAT activity but no wax ester synthase activity.

Peng et al., (2013) identified two isozymes of DGAT2 in peanut and expressed both of

them as full-length recombinant proteins in E. coli. DGAT sequence vary among

different plant species, Clustal W alignment for DGAT gene revealed that divergence

between DGATs was concentrated in the N-terminal while many conserved regions were

present in the middle and towards the C-terminal region. Although the regulatory role of



DGAT in oil synthesis has been suggested (Hobbs et al., 1999), complete understanding

of the regulation of the Kennedy pathway which is vital for the national engineering

transgenic oil crops is still lacking. Molecular studies on Diacylglycerol acyl transferase

(DGAT), has been done in many plants (Zou et al.,1999) reported that Arabidopsis

thaliana with reduced DGAT activity showed the fatty acid composition rich in short

chain unsaturated fatty acid and pour in long chain unsaturated fatty acid. A better

understanding of DGAT modulators may provide new opportunities to enhance TAG

accumulation in seed plants. DGAT transcripts were reported earlier from microspore

derived cell suspension culture of Brassica napus (Nykifornk et al., 1999a) and in olive

drupe tissues (Giannoulia et al., 2000). Over-expression of the DGAT enzymes increases

TAG content in plants (Durrett et al., 2010; Andrianov et al., 2010).

The more easy way of expression of DGAT gene through a range of tissue types

is by isolation of RNA and mRNA was present in large extinct in developing seeds and

was detected at much lower concentrations in leaf and stem which normally contain 1-2%

of total cell lipid as TAG. The recent studies have amplified the DGAT gene using cDNA

synthesized from the neem seeds and its molecular size of 1.2 Kb when compared with

standard molecular marker on agarose gel. Identification and cloning of DGAT gene will

significantly help to determine the role and importance of DGAT in controlling the yield

of oil storage in seeds, this will also reveal the aspects of plant life by understanding the

role of plant TAG. Cloning and overexpression of DGAT enzyme increases the seed oil

content which directly increases the biodiesel production. The attempt to utilize genomic

techniques for characterizing and screening highy yielding varities from HK area using

DGAT gene cloning will help in future for crop improvement.



8. SUMMARY AND CONCLUSION

India as well as other oil-importing countries needs alternative fuels to replace

petroleum-based fossil fuels for several reasons. The ever increasing energy demand in

the automobile sector, alarming oil import bills, and stringent emission norms are

considered to be the main reasons behind this. Biodiesel from neem oil can fulfill the

energy demand because of its wide distribution and tree population in India. Neem

(Azadirachta indica) is a tree in the mahogany family Meliaceae which is abundantly

grown in varied parts of India. The Neem grows on almost all types of soils including

clayey, saline and alkaline conditions. Neem seed obtained from this tree are collected,

de-pulped, sun dried and crushed for oil extraction. The seeds have 45% oil, which has

high potential for the production of biodiesel. During present investigation, an

investigation was conducted to study the variations among the neem ecotypes growing in

semi arid climatic region of Bidar, Gulbarga, Raichur and Zaheerbad.

The oil yield of neem per hectare of land is 2670 Kg/ha, highest among the

prospective non-edible oil seeds. Although neem has higher potential, it is found to be

very attractive in the sense that it can grow in adverse agro-climatic conditions

throughout India. Form the above-mentioned reasons, neem has been identified as one of

the most acceptable another potential biodiesel-producing feedstock in India.

The chapter I and Chapter II emphasize on the general introduction and review of

literature about the energy demand and about the earlier and recent research work on

diversity, biophysicochemical evaluation, tissue culture, DGAT gene amplification and

biodiesel production studies. These chapters depict that phenomenal research work is



being carried out on non-conventional and non-edible oils over edible oils as a potential

feedstock for biodiesel production.

The Chapter III provides the information on the methods for obtaining quality

neem seeds through efficient post harvest technology for better yield of oil and biodiesel

production by post-harvesting practices that include: cleaning, washing, selection,

grading, disinfection, drying, packing and storage and training to benefeceiries.

The chapter IV was aimed to investigate the molecular diversity among 20 neem

ecotypes from the four different regions viz, Bidar, Gulbarga, Raichur and Zaheerabad.

Seed protein profiling and RAPD analysis was performed by using SDS PAGE and 5

RAPD primers respectively. In SDS-PAGE protein profiling, the total number of banding

pattern varies from 8 to 15 in neem ecotypes. In 5 RAPD primers, 3 primers produced

clear, distinct polymorphic bands. The phylogenetic tree was constructed using PAST

and PhyElp 1.4 software tool program and analysis of molecular variance was carried

out.

In Chapter V, evaluation was carried on neem as a potential raw material for the

biodiesel production. Thirty different neem ecotypes collected from the different parts of

Bidar, Gulbarga, Raichur and Zaheerabad districts were screened on the basis of physical

appearance and oil-mass solidification. Physico-chemical properties of neem seed oil

were studied for biodiesel production. Biodiesel is successfully produced by acid-alkali-

catalyzed transesterification with methanol in the presence of NaOH as a catalyst.

Biodiesel quality was studied and compared with BIS and diesel standards. It indicates

that the produced biodiesel is comparable with petrodiesel.



In Chapter VI, it was aimed to produce a large quantity of quality planting

material, which will be needed to meet the energy demand in future. The

micropropagation approach is considered to be the most appropriate viable alternative in

tree improvement programs. The present study was conducted to standardize the protocol

for in vitro multiplication of neem. The use of plant regulatory hormones like 2, 4-D,

BAP, Kn, GA3, NAA, IAA, IBA, etc were helpful in developing techniques for in vitro

multiplication of elite neem. The establishment of protocols will be important for

mass propagation and cultivation of elite neem clones. This will also help in genetic

transformation studies in neem tree.

Chapter VII, emphasizes on genetic improvement of neem using Diacylglycerol

acyltranferase (DGAT) enzyme which is exclusively committed to convert a

diacylglycerol acyltransferase to triacylglycerol in fatty acid synthesis namely Kennedy

pathway. Emphasis was also to synthesis cDNA using RNA isolated from developing

seeds of neem and partially amplify DGAT gene. Further studies on cloning and over

expression of DGAT gene in neem seeds with improved TAG biosynthesis in seeds by

genetic engineering means are needed to create the improved germplasm.

The major conclusions arrived at me as follows:

The Post harvest management methods have been standardized and developed for

obtaining quality neem seeds through efficient post harvest practices for better yield

of oil and biodiesel by scientific methods of collection, depulping, drying and storage.

The research output was used for brining awareness regarding neem as a biodiesel

tree and training to beneficiaries on the relevant technologies. Duing the study 3034



beneficiaries were trained in the post harvest management of seed and biodiesel

production.

SDS-PAGE protein profiling: the total number of banding pattern varies from 8 to 15

in neem ecotypes. More number of bands were observed in the plants from Gulbarga

region while there is no clear banding patteren observed in Bidar comprising one

accession and two each accession in Raichur and Zaheerabad respectively. The

phylogentic analysis from Jaccard similarity coefficient and un-weighted pair group

algorithm, generated by PAST software showed two major clusters at linkage

distance 1.2 and further bifurcated to seven clusters at 0.8 linkage distance. Jaccard

coefficient dissimilarity ranged between 0.00 and 1.00. The highest similarity

distance was between Bidar and Raichur region. 5 RAPD primers were screened in

order to obtain the polymorphism among the neem ecotypes. Among the 5 RAPD

primers, 3 primers showed considerable polymorphism. These primers produced total

number of bands scored 23 with an average of band 3.59 per primer and percentage of

polymorphism was 78.94%. Among the three series of RAPD primers used for the

present study; OPA-5 and OPQ-17 produced more polymorphic bands than of OPA-

03. The highest proportion of polymorphism was observed in OPQ-17 primer of

87.5%. The present work is first to report that the use of PhyElp 1.4 and PAST

windows software tool for the phylogentic tree analysis and distance similarity

indices respectively for the neem plants. For all the RAPD primers, the phylogenetic

analysis generated two major clusters which are further bifurcated to two clusters.

These results showed that the RAPD primers can also be used to differentiate the

neem ecotypes on the basis of their agronomic characters. The Principal component



analysis revealed that there is overall average 37% of total variation among the

ecotypes.

The production of biodiesel protocol has been investigated. The results of the

experiments analyzed and compared by employing analysis of physico-chemical

parameters. Based on the experimental results obtained, it is found that all the process

variables exhibited significant interaction effect on the yield of fatty acid methyl

ester. Physico-chemical properties determined for the biodiesel produced meet the

BIS and diesel standard specification. It can be concluded that, neem seeds from

Gulbarga district were of better quality with respect to level of oil content, FFA

content, and viscosity. Neem esters have been found superior in terms of higher flash

and fire points and suitable for running diesel engines.

Protocol was standardized for invitro mcropropagation of neem. The callus

proliferation was observed when leaf and seed explants were inoculated on MS media

with 3.0% sucrose and fifteen different concentrations of plant growth regulators. The

highest callusing response from leaf explants (22.3±0.92) was observed in MS

medium 13 in combination with 0.3 mg/L 2, 4-D; 0.3 mg/l Kn and 0.3 mg/l NAA,

while the highest callus proliferation response from seed explants(42.50.97%) was

observed in MS medium 10 supplemented with 0.5mg/L of each 2,4-D and BAP. The

explants responded to callus formation in less than a week and proliferation of shoots

and multiple shoots from callus were studied and the highest shoot regenerating

capacity (94%) was recorded in 1.0 (BAP) + 0.5 (NAA) mg/l combination. The

minimum (32%) shoot regeneration was observed in 1.0(BAP) +1.0 (NAA) mg/L

combination. The maximum rooting efficiency of 95% was observed in half strength



MS media supplemented with 3mg/L NAA and the highest number of average roots

per micro shoot and average length of root were 15 and 4.9 cm. The neem microshoot

culture was also studied for the response on different concentration of sucrose and pH

level. Well rooted plantlets were washed and transplanted into hycotrays containing

sterilized soil for acclimatization in the greenhouse. The plants were gradually

exposed to low humidity conditions and finally transferred for field trails. Thus,

transplantation survival of micropropagated plants was 87.5%.

Genetic improvement of enzymes regulating the biosynthesis of triacylglycerol

(TAG) in seeds is one of the important objectives in biodiesel research.

Diacylglycerol acyltranferase (DGAT) is the only enzyme exclusively committed to

convert a diacylglycerol to triacylglycerol in fatty acid synthesis in Kennedy pathway.

During the present work, cDNA synthesis was achieved by isolating total RNA and

partial amplification of DGAT gene of neem was successfully attempted by

standardzing the protocol. The gene specific primers were constructed using known

nucleotide sequence of plant by NCBI and Primer 3 software tool. The amplified

product was found to be approximately 1.2 Kbp.

This study is intended to consider aspects related to the feasibility of the

production of biodiesel from neem oil in the ecotypes of Hyderabad Karnataka area. The

seed sources in most of the cases were significantly different in oil yield and quality

parameters, showing a considerable amount of variability within and thus indicating a

good scope of genetic improvement. The present study also confirmed that considerable

genetic variability exists in neem with respect to oil content and oil quality parameters,

which offers scope to the breeder for selection and breeding of elite plus trees. Our



regeneration protocol could be useful in stabilizing the nursery industry to raise „clean

stock‟, i.e. rapid clonal propagation of selected plants. Further research is essential to

enhance the knowledge base for genetic improvement in neem for quality oil production

by cloning and overexpression of DGAT gene in neem seeds, which could be used in

biodiesel related crop improvement for making neem as a potential tree species in energy

sector.

Documents

7. MOLECULAR CHARACTERIZATION AND ...shodhganga.inflibnet.ac.in/bitstream/10603/96409/12/13...Molecular studies on Azadirachta indica Department of Biotechnology, Gulbarga University,