COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the track & fi eld coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Athletes will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Athletics Media Communications

Mike Gore Associate Athletics Director for

External Affairs / Track & Field ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387

Email: mgore@unca.edu

Matt PellegrinDirector of Athletics

Media CommunicationOffi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: mpellegr@unca.edu

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

MEDIA INFORMATION

• IT’S UNC ASHEVILLE When referring to our school, please call us

UNC Asheville in the fi rst reference. The sec-

ond reference can be just Asheville. There is

no hyphen in our name, and we have never

used North Carolina-Asheville. We do not use

UNCA anymore. Please go with UNC Asheville

or just Asheville. When abbreviating for video

or web streaming please use ASHVL or AVL,

depending on how much room you have. The

UNC Asheville Athletics Communications Of-

fi ce is thankful for your help.

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteChancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director forExternal Affairs: Mike GoreAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneDirector of Development and Alumni Relations: Pat Bryant Athletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

2012 ROSTERMEN

Sam Barbeau Throws Fr. Charlotte, NCJohn Bellard Jumps So. Charlotte, N.C. (Providence HS)Ryan Blackmon Distance Jr. Gloversville, N.Y. (Vermont) (Gloversville, HS)Eliud Chirchir Distance Sr. Eldoret, Kenya, (Wyoming ) (Kalyet)Courtney Henry Jumps So. Jonesboro, GA (Ola High)Kurt Hibert Throws So. Vista, CA (Rancho Buena Vista HS )Cameron Howard Jumps Jr. Houston, TexasBen Lockhart Distance Fr. Chapel Hill, N.C. (Chapel Hill HS)Carlos Lopez Distance Sr. Scottsdale, , Ariz. (Scottsdale JC)Delano Loritts Jumps So. Claremont, N.C. (Bunker Hill HS)Sam Maynard Distance Sr. Medina, Ohio (Medina HS)Chris Murray Distance Jr. Jamestown, NC (Ragsdale HS)Elliott Pahel-Short Distance Fr. Chapel Hill, N.C. (Carrboro HS)Sebastian Paniagua Mid. Distance So. Haymarket, Va (Battlefi eld HS)Kevin Paradise Distance Fr. Medina, Ohio (Medina HS)Milan Ristic Sprints Jr. Belgrade, Serbia (Serbia-Nikola Tesla )Adam Schnapp Distance Sr. Silver Spring, Md. (Blake HS)

WOMEN

Lauren Baker Jumps Fr. Charlotte, N.C. (Providence HS)Jennifer Black Distance Jr. Charlotte, N.C. (Providence HS)Kasey Briggs Distance Fr. Raleigh, N.C. (Athens Drive HS)Emma Bussard Distance Sr. Carrolton, Ga. (Carrolton HS)Rachel Carson Distance So. Winchester, VA (James Wood HS)Ashlei Clodfelter Jumps Jr. Whitsett, N.C. (North Davidson HS)Colby Crawford Sprints Fr. Candler, N.C. (Enka HS)Adrian Etheridge Distance Fr. Oak Ridge, Tenn. (Oak Ridge HS)Meredith Foster Jumps So. Hendersonville, N.C. (West Henderson HS)Sarah Gentry Sprints Jr. Plano, Texas (Canyon Creek Christian Academy)Molly Harkavy Sprints So. Hillsborough, N.C. (Bowdoin College) (Cedar Ridge HS)Avery Hill Distance Fr. Greensboro, N.C. (Grimsley HS)Alyska Kalmeijer Mid. Distance Jr. Marietta, Ga. (Alan C. Pope HS)Melanie Kulesz Distance Jr. Oak Ridge, Tenn. (Oak Ridge HS)Corey McClintock Throws Jr. Black Mountain, N.C. (NC School for Science & Math)Emily Pineda Sprints Sr. Boone, N.C. (Watauga HS)Clair Powell Distance Jr. Mooresville, N.C. (Mooresville HS)Erin Putnam Distance Sr. Jacksonville, N.C. (Jacksonville HS)Martha Turpin Throws Fr. Sylva, N.C. (Smoky Mountain HS)

Jesse NormanAlma Mater: .............................Western Carolina, 2003Year: .............................................................................Sixth Jesse Norman just fi nished up his fi fth year as head coach of the UNC Asheville Cross Country and Track and Field programs. The Bull-dogs cross country and track and fi eld program have shown tremendous improvements across the board during his tenure.

In the 2011-12 seasons, the Bulldogs men’s track team had Milan Ris-tic qualify for the NCAA Preliminary Outdoor meet in the 110 hurdles. It marked the fi rst time a Bulldog hurdler had advanced to a NCAA championship meet. Ristic won the Big South Conference championship in the 110 hurdles at the outdoor meet and won the 60 hurdles at the league’s indoor meet in February. On the women’s side, Sarah Gentry captured the 800 meters at the outdoor BSC championships for her fi rst ever championship.

The 2010-11 seasons saw new heights for the program. The wom-en’s cross country squad improved their team fi nish at the Big South Championships with Melanie Kulesz again earning all-conference honors. The indoor season had the women’s team fi nishing in third place; the highest fi nish in school history. Norman was named Big South Indoor Track and Field Women’s Coach of the Year after Asheville’s impressive performance.

During the outdoor season Natalie Pearson (100m & 200m) and Si-mon Haake (Javelin) qualifi ed for the NCAA Eastern Regional with Pear-son advancing on to the NCAA National Championships in Des Moines, Iowa. The outdoor season also had Ristic qualify for the European U-23 Championships in the 110m hurdles. He also guided Ashlei Clodfelter to a school record in the triple jump (38-9).

During the 2009-10 seasons, both Bulldog cross country squads improved their showing from the previous season with freshman Mela-nie Kulesz earning all-conference honors. In the track and fi eld ranks, Asheville had both Simon Haake and Natalie Pearson qualify for the East-ern Regional under tougher standards. Pearson became the fi rst Bulldog

student-athlete to qualify for the National Championships in the 200 me-ters. Pearson was ranked fi rst nationally in the 200 during the season. Kulesz qualifi ed for the USATF Junior Nationals in the 5,000m placing 11th at the championships.

Norman worked for two years at Western Carolina with the Catamounts men and women’s distance teams before coming to UNC Asheville in the summer of 2007. He helped guide WCU cross country runner Dan Fassinger to an all-conference fi nish in cross country and Deanna Kulesz to an all-conference fi nish in the 1500 and 3000 meters. Norman was part of a Catamount coaching staff that helped WCU win two straight Southern Conference Outdoor Track and Field champion-ships.

Norman enjoyed a great career at Western Carolina from 1999-2003. He won the Southern Conference individual championship in cross country in 2001, the only Catamount ever to accomplish such a feat and earned all-conference honors in the 10,000 meters during the 2000 out-door season. Norman had a sensational prep career at Fuquay-Varina HS where he was a fi ve-time state champion in cross country, 1600 meters and 3200 meters.

Norman earned a degree in physical education from Western Caro-lina in 2003 and then picked up his master’s in physical education in May of 2007.

Norman (left) was name the 2011 Women’s Indoor Track & Field Coach of the Year for the Big South Conference

THE COACHES

THE COACHESJoel Williams

Alma Mater: ............................. Appalachian State, 2004Year: ..............................................................................Fifth Joel Williams enters the fall of 2011 as a fi fth year assistant track and fi eld coach with the UNC Asheville men’s and women’s programs. He was hired during the fall of 2007. He is in charge of coaching the throws, sprints, and hurdle events.

The 2010-2011 school year proved to be the most successful track season during the current staff ’s four years. Williams coached Simon Haake to again break-ing his own school record in the javelin with a throw of 68.15m. This qualifi ed him for the second consecutive year to the NCAA Division I East preliminary round. Haake also achieved a top two performance in school history in the hammer throw and top three in the shot put. Indoors, Haake hit top three marks in both the shot put and the weight throw. Also in 2010-2011, Williams guided freshman Milan Ristic to setting school records in the 110m hurdles (14.32) as well as 100m and 200m. The hurdles time qualifi ed him for the European Athletics under 23 Champion-ships while representing his native Serbia in July of 2011. Ristic also set two school records indoors at 55m and 200m and ran the second fastest 60m hurdle time in school history. One other top fi ve mark was garnered during the school year by another Williams coached athlete-Kurt Hibert in the discus throw.

On the women’s side in 2010-2011, Williams helped sophomore Sarah Gentry, in her fi rst year running the 800m set a school record while placing second at the indoor conference meet en route to the team’s third place fi nish. Outdoors, Gentry moved to number two in school history with a time of 2:12.14 at 800m and besting her own all time top two mark at 400m. Two other top fi ve marks were attained by athletes Williams coached; Meredith Foster in the high jump and Ashlei Clodfelter in the javelin throw.

During the 09/10 school year Williams coached Simon Haake to setting a new school record in the javelin throw with an effort of 64.57m at the conference cham-pionships which qualifi ed him for the NCAA Division I East region prelims. Ashlei Clodfelter moved to number two all time on the school’s top fi ve list with a throw of 38.62m also in the javelin. He had 6 other female athletes break into the school’s all time top fi ve in sprints and hurdle events as well as a school record. On the men’s side, 8 top fi ve marks outdoors were recorded along with 4 school records, two of which were indoors and ranging from the high jump, pole vault, throws, sprints and hurdles.

During the 08/09 year, junior hammer thrower Keith Scruggs made to number two all time in school history in that event. Scruggs had previously been a baseball player prior to joining the track team at UNC Asheville. Additionally, sophomore javelin thrower Simon Haake improved his best from the 2008 season by almost 11 meters while also garnering the number two position on the school’s top fi ve list with an effort of 55.56 meters and a 7th place fi nish at the Big South conference meet. During his fi rst year (2007-2008) at UNC Asheville, all of his throwers made it onto the school’s all-time top ten list. Erik Nabi improved his javelin throw in one year from 49.45 meters to 55.48 meters while earning All-Big South honors. With that performance, Nabi captured a second place all time in the school history. Daniel Corriher improved by over a meter in both the shot put and the indoor weight. Corriher got in the school’s all time top fi ve in both the shot put and ham-mer throw. In his fi rst season as a thrower, Simon Haake, who did not compete in high school sports, showed very good potential in the javelin where he got into the school top 10 all-time list with a throw of 44.66m. Haake also made the fi nals at the Outdoor Conference Championships.

Williams worked at Watauga high school in Boone, NC from 1994-2005 as the head coach of the indoor track and fi eld team and was an assistant coach for the outdoor track team. During his tenure as head coach of the indoor team, he coached 10 different student-athletes to North Carolina state championships and led the school to its fi rst ever state championship for girl’s indoor track in 1997. During his time at Watauga as an asst. coach during the outdoor track, Williams de-veloped 12 state champions. He helped the Pioneer girls program to three consecu-tive NC state 4A outdoor championships in 1995, 1996 and 1997. The boy’s team had their best fi nishes in 2000 when they were runners-up and in 1997 when they tied for third place. At the conference level, both the boy’s and girl’s teams won 8 consecutive conference championships during his twelve seasons there. He planned complete training programs for all sprinters up to and including 800m runners, hur-dlers, and jumpers. Later, he also designed the strength programs for several school record-setting throwers. Williams served as the high school coach to

Brenda Taylor who later won the 2001 NCAA 400m hurdles champion while at Harvard and in 2004 was a U.S. Olympian in Athens, Greece fi nishing 7th in that event. Her second place time of 53.36 at the U.S. Olympic Trials ended the year as the number fi ve time in the world for 2004. She was also a bronze medalist in the 4 x 400 relay at the 2003 World Indoor Track and Field championships.Wil-liams coached Taylor to nine NC state individual and relay state track champion-ships while at Watauga High School. Though less frequently, he continued to work with Taylor while at Harvard as well as post-collegiately. He helped to design her strength training program for her 2004 Olympic season.

He was a high school coach for Brenda’s twin sister, Lindsay, who, in addition to being a top high hurdler in North Carolina, was a 5’11½” high jumper while at Watauga. As a result of her best marks, a top 2 fi nish at the USATF junior nation-als and a fourth place fi nish at the Pan Am junior championships in Cuba, she was voted top three in the high jump nationally by Track and Field News for the 1997 outdoor high school season. Taylor won numerous conference championships while a student at Brown University, qualifi ed for two NCAA championships in the Hep-tathlon, and later became an elite pole vaulter fi nishing top three at the 2003 USATF indoor national championships. Williams also worked with Lindsay, at times, while in college and after graduation as well.

During his time at Watauga, Williams was the high school coach to Abraham Morlu from his freshmen year in high school on to a spot with the Liberian national 400m relay team, for the 2000 Sydney Olympic Games while a college freshman and the 2001 World Championships while a sophomore. Williams also worked with Morlu while in college, on occasion. Morlu then made his national team for the 2003 World Championships.Williams’ most successful high school 800m runner was Donna Bealer. She ran 2:16.78 in 1998 to win a state championship as a junior in high school. Bealer teamed up with both Taylors and Garrie Storie to win both in-door and outdoor state championships in the 4 x 400m relay running a best time of 3:53.01 in 1997. During the 2000 outdoor track season, two of his athletes, Patrick Murphy and Nathan Giles were one half of Watauga’s then NC state high school record-setting 4 x 800m team of 7:49.00. In August of 2009, Daniel Duckworth, one of Williams’ former athletes at Watauga who was a Southern Conference champion in the weight throw while competing for Appalachian State, was invited to try out for one of the two-man bobsled teams for the U.S. Williams is a 2004 graduate of Appalachian State University with a Bachelor’s of Science in Health Promotion with minors in Exercise Science and Sociology. He is a USATF level II certifi ed coach in both Sprints/Hurdles/Relays and the Throws. He also holds a USAW (US Weightlift-ing Federation) Club Coach certifi cation for teaching/coaching the Olympic lifts.

THE COACHESAdam Puett

Alma Mater: .............................Western Carolina, 2006Year: ..............................................................................First

Adam Puett is in his second year as the assistant coach with the UNC Asheville cross country and track and fi eld programs. Adam works primarily with the middle and long distance runners. During his fi rst year at UNCA, Adam helped coach the UNCA women to their highest fi nish in school history at the Big South Indoor Conference Championships by placing third. Adam also helped his athletes achieve 21 personal bests, while coaching 4 Big South All-Conference Performers.

Puett enjoyed an outstanding career for Western Carolina Uni-versity. He was the 2005 Western Carolina Male Athlete of the Year and 2006 Southern Conference Outdoor Performer of the Year. Adam earned All Conference honors three times in cross country and 10 times in indoor and outdoor track. He was a fi ve-time So-Con champion in indoor and outdoor track plus a four-time NCAA outdoor regional qualifi er in the 1500. The Alabama native won the Southern Conference 1500 meters for three consecutive years.

Before coming to UNC Asheville, Puett served as an assistant coach at WCU for three years. He coached events ranging from the 800 meters to the 10,000 meters. The Alabama native coached 13

All-Conference performers and six Southern Conference champions during his tenure. He helped lead the Catamount programs to fi ve different league championships.

Puett graduated from Western Carolina in 2006 and then earned his Masters in Physical Education from WCU in 2009.

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Director of Administration & FinanceNancy Perkins

Assistant Director of MarketingTBA

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing Assistant InternCaitlin Munchel

Public Relations Assistant InternBrittany Hill

Administrative Assistant InternTBA

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Volleyball Offi cialsDaniel Leake

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Softball UmpiresBetsy Kidd

Full-Time Member Institutions (11): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University.

Associate Members: Stony Brook University (football), Bucknell University (women’s golf), College of the Holy Cross (women’s golf).

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (3) – Liberty University, Radford University, Virginia Military Institute.

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball, Women’s Lacrosse (2012-13)

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; John V. Griffi th, Presbyterian College, Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop.

BIG SOUTH QUICK FACTS

MEN’S RECORDSUNC Asheville Men’s Top Five Outdoor Times

100 Meters1. Milan Ristic 10.92 2011 2. Enita Okodiko 10.93 2006 3. Brandon Hamilton 11.03 2007 Courtney Henry 11.03 2011 4. Eric Fitzgerald 11.07 1998 5. Jordan Yarbrough 11.09 2010 Wind Aided Eric Fitzgerald 10.80 1998

200 Meters1. Milan Ristic 21.62 2012 2. Enita Okodiko 22.00 2006 3. Eric Fitzgerald 22.38 1998 4. Courtney Henry 22.47 2011 5. Raymond Urrutia 22.54 2010 Wind Aided Raymond Urrutia 22.13 2010

400 Meters1. Dane Corriher 49.97 2007 2. Jeremy Twiggs 49.99 2001 3. Nelson Delgado 50.14 1994 4. Andrew Burnette 50.77 2008 5. Giovanni Freeman 51.42 1994

800 Meters1. Nelson Delgado 1:50.94 1994 2. Sam Maynard 1:51.08 2010 3. Jim Phillips 1:52.57 1998 4. Eliud Chirchir 1:53.32 2010 5. Brandon Trollip 1:54.33 1997

1500 Meters1. Brandon Trollip 3:51.14 1998 2. Taylor Little 3:53.08 2007 3. Ed Matthews 3:54.58 1997 4. Sam Maynard 3:56.14 2010 5. Eliud Chirchir 3:56.65 2010

3,000 Meters1. Phil Latter 8:33.96 2004 2. Brendan McGrane 8:34.21 1999 3. Taylor Little 8:34.46 2006 4. Brandon Trollip 8:44.69 1999 5. James Rogers 8:46.00 1998

5,000 Meters1. Taylor Little 14:19.16 2007 2. Chad Pearson 14:36.57 2000 3. James Rogers 14:36.80 1998 4. Phil Latter 14:47.64 2004 5. Martin Morales 14:52.55 1994

10,000 Meters1. Jon Harmon 31:08.20 2006 2. Root Kirbach 31:08.79 2007 3. Pat Spencer 31:43.90 1996 4. Kevin Paradise 31:53.54 2012 5. Martin Morales 32:28.10 1994

110 Meter Hurdles1. Milan Ristic 13.88 2012 2. Kris Fant 14.41 2004 3. Joel Collier 15.36 2004 4. Derek Larsen 15.76 2010 5. Andy Gainor 15.80 1997 Wind Aided

Milan Ristic 13.91 2012

400 Meter Hurdles1. Andy Guzy 53.25 2001 2. Joel Collier 54.29 2003 3. Brandon Hamilton 55.60 2007 4. Michael Eitelberg 57.77 2001

3,000 Meter Steeplechase1. Dave Bell 9:06.08 2006 2. Brendan McGrane 9:09.96 1999 3. Eddie Legair 9:30.26 1998 4. Sam MacGibbon 9:32.90 1994 5. Tim Gautreau 9:37.52 1999

4 x 100 Meter Relay1. Scott, Roseboro, Fant, Young

42.70 2005 2. Larsen, Yarbrough, Urruitia, Haake 43.30 2010 3. Creel, Northington, Gainor, Fitzgerald

43.38 1998 4. Hamilton, Corriher, Ahmad, Bandoly

43.65 2008 5. Corriher, Ahmad, Young, Hamilton

43.67 2007

Current Athletes in BOLD

OUTDOORUNC Asheville Men’s Top Five Outdoor Times

4 x 400 Meter Relay1. Guzy, Roberts, Collier, Twiggs

3:20.97 2002 2. Phillips, Twiggs, Collier, Guzy

3:22.91 2001 3. Urruitia, Chirchir, Maynard, Lopez 3:24.57 2010 4. Corriher, Maynard, Burnette, Matthews 3:25.55 2009 5. Corriher, Burnette, Stepp, Holman

3:25.86 2008

High Jump1. Chad Wynens 1.98m 6-6.00 1996 2. Justin Bellamy 1.93m 6-4.00 2002 3. Nick Mozzone 1.90m 6-2.75 2010 4. Cameron Howard 1.86m 6-1.25 2012 5. Tom Barber 1.83m 6-0.00 2001 Long Jump1. Jordan Yarbrough 6.83m 22-5.00 2010 2. Milan Ristic 6.73m 22-1.00 2011 3. Vince Kreiger 6.63m 21-9.00 1997 4. Omar Ahmad 6.61m 21-8.25 2006 5. Courtney Henry 6.55m 21-6.00 2011

Wind Aided Milan Ristic 7.03m 23-0.75 2011

Triple Jump1. Will Beasley 13.78m 45-2.50 2009 2. Omar Ahmad 13.59m 44-7.00 2006 3. Delano Loritts 13.32m 43-8.50 2012 4. Giovonni Freeman 13.21m 43-4.25 1994 5. Dane Horne 11.76m 38-7.50 1999

Wind Aided Omar Ahmad 13.85m 45-5.25 2006

Pole Vault1. Ian Boyd 3.96m 12-11.75 2010 2. K.C. Radford 3.85m 12-7.50 2007 3. Kelvin Howard 3.81m 12-6.00 2000 Michael Eitelberg 3.81m 12-6.00 2001 4. Simon Haake 3.21m 10-6.25 2010 5. Dane Horne 3.05m 10-0.00 1999

Shot Put1. Nathan Hedgpeth 17.00m 55-9.25 2005 2. Brian MacPhee 16.02m 52-6.75 2001 3. Simon Haake 14.25m 46-9.00 2011 4. Daniel Corriher 13.94m 45-9.00 2007 5. Adam Chacon 13.77m 45-2.25 2002

Discus1. Nathan Hedgpeth 53.83m 176-7 2005 2. Clint Barden 50.52m 165-9 2004 3. Brian MacPhee 48.86m 160-4 2001 4. Kurt Hibert 45.61m 149-8 2012 5. Troy Young 45.36m 148-10 2005

Hammer Throw1. Kurt Hibert 54.47m 178-8 2012 2. Clint Barden 51.93m 170-4 2002 3. Simon Haake 49.94m 163-10 2011 4. Keith Scruggs 48.37m 158-8 2009 5. Adam Chacon 47.70m 156-6 2002

Javelin1. Simon Haake 68.15m 223-7 2011 2. Troy Young 56.71m 186-0 2006 3. Erik Nabi 55.48m 182-0 2008 4. John Bellard 54.83m 179-11 2012 5. Brian MacPhee 53.62m 175-11 2001

Decathalon1. Troy Young 5689 2006 2. Michael Eitleberg 5667 2002 3. Simon Haake 5510 2010

Current Athletes in BOLD

MILAN RISTIC

MILAN RISTIC (HURDLES)NCAA Qualifying Meet (2012)

Big South Champion Outdoor – 110 High Hurdles (2012)Big South Champion Indoor – 60 High Hurdles (2012)

Senior National Champion of Serbia 110 Hurdles (2011)

INDOORUNC Asheville Men’s Top Five Indoor Times

55 Meters 1. Brandon Hamilton 6.49 2006 Milan Ristic 6.49 2010 2. Dante Roseboro 6.54 2004 3. Courtney Henry 6.57 2011 4. Eric Fitzgerald 6.58 1998 Jordan Yarbrough 6.58 2010 5. Troy Young 6.71 2004 60 Meters 1. Raymond Urruitia 7.04 2010 Milan Ristic 7.04 2012 2. David Pickett 7.08 2010 3. Enita Okodiko 7.09 2006 Milan Ristic 7.09 2011 4. Dante Roseboro 7.10 2005 5. Jordan Yarbrough 7.13 2010 200 Meters 1. Milan Ristic 21.68 2012 2. Enita Okodiko 22.38 2006 3. Ivan Scott 22.54 2005 4. Raymond Urruitia 22.64 2010 5. Dane Corriher 22.71 2005 400 Meters 1. Dane Corriher 49.98 2009 2. Andy Guzy 50.55 2000 3. Jeremy Twiggs 50.67 2003 4. Ivan Scott 50.81 2005 5. Enita Okodiko 50.93 2005 800 Meters 1. Eliud Chirchir 1:54.62 2010 2. Jim Phillips 1:55.09 1998 3. Nelson Delgado 1:55.36 1995 4. Sam Maynard 1:55.39 2010 5. Eddie Legair 1:56.27 1998 Mile 1. James Rogers 4:16.84 1996 2. Taylor Little 4:17.26 2006 3. Travis Rudnick 4:17.31 1996 4. Brendan McGrane 4:17.44 1998 5. Brandon Trollip 4:17.56 1997 3,000 Meters 1. Taylor Little 8:22.48 2007 2. Jon Harmon 8:29.68 2008 3. Phil Latter 8:32.62 2003 4. James Rogers 8:41.11 1998 5. Brendan McGrane 8:41.35 1998 5,000 Meters 1. Jon Harmon 14:55.76 2008 2. Phil Latter 14:58.64 2003 3. James Rogers 15:07.01 1998 4. Chad Pearson 15:17.21 2000 5. Root Kirbach 15:17.63 2005

55 Meter Hurdles 1. Milan Ristic 7.47 2011 2. Kris Fant 7.49 2005 3. Derek Larsen 8.10 2010 4. Joel Collier 8.14 2004 5. Andy Gainor 8.40 1998 60 Meter Hurdles 1. Milan Ristic 7.83 2012 2. Kris Fant 8.13 2005 3. Joel Collier 8.78 2004 4. Derek Larsen 8.81 2010 4 x 400 Meter Relay 1. Freeman, Twiggs, Roberts, Collier

3:26.31 2002 2. Corriher, Stepp, Maynard, Burnette 3:26.68 2009 3. Corriher, Goodrum, Burnette, Okodiko 3:27.83 2006 4. Phillips, Eitelberg, Twiggs, Guzy 3:28.03 2001 5. Urruitia, Larsen, Chirchir, Maynard 3:28.47 2010 Distance Medley Relay 1. Phillips, Trollip, Legair, McGrane

10:17.82 1998 2. Maynard, Urruitia, Chirchir, Lopez 10:21.37 2010 3. Gautreau, Guzy, Roberts, Trollip

10:27.10 1999 4. Bell, Goodrum, Jackson, Mazzotta

10:31.84 2004 High Jump 1. Chad Wynens 1.93m 6-4 1996 2. Nick Mozzone 1.90m 6-2.75 2010 3. Cameron Howard 1.85m 6-0.75 2012 4. Andrew Heath 1.83m 6-0 2000 5. Marcus Bethea 1.78m 5-10 1999 Long Jump 1. Dante Roseboro 6.85m 22-5.75 2004 2. Courtney Henry 6.81m 22-4.25 2011 3. Omar Ahmad 6.58m 21-7.25 2008 4. Jordan Yarbrough 6.53m 21-5.25 2010 5. Troy Young 6.31m 20-8.50 2005 Triple Jump 1. Omar Ahmad 13.62m 44-8.25 2008 2. John Bellard 13.12m 43-0.50 2012 3. Courtney Henry 12.80m 42-0.00 2010 4. Delano Loritts 12.61m 41-4.50 2012 5. Will Beasley 12.56m 41-2.50 2009

Current Athletes in BOLD

UNC Asheville Men’s Top Five Indoor Times Shot Put 1. Brian MacPhee 16.17m 53-0.75 2001 2. Nathan Hedgepeth 16.03m 52-7 2004 3. Simon Haake 14.21m 46-7.50 2011 4. Daniel Corriher 14.01m 45-11.75 2008 5. Adam Chacon 14.00m 45-11.25 1999 Weight Throw 1. Clint Barden 16.22m 53-2 2002 2. Brian MacPhee 15.92m 52-2.75 2001 3. Kurt Hibert 15.50m 50-10.25 2012 4. Simon Haake 15.45m 50-8.25 2011 5. Adam Chacon 14.55m 47-9 2002 Pole Vault 1. Ian Boyd 4.10m 13-5.25 2010 2. Kelvin Howard 3.66m 12-0 2000 3. Michael Eitelberg 3.65m 11-11.75 2001 4. K.C. Radford 3.51m 11-6 2007 5. Dane Horne 3.05m 10-0 1999

MEN’S RECORDS

0.75 20017 2004-7.50 201111.75 2008 11.25 1999

2 20022.75 200110.25 20128.25 20119 2002

-5.25 20100 2000 11.75 20016 20070 1999

WOMEN’S RECORDSUNC Asheville Women’s Top Five Outdoor Times

100 Meters 1. Natalie Pearson 11.60 2010 2. Tanya Harris 12.81 2006 3. Eureka Jones 12.84 2010 4. Jazmyn Williams 12.88 2004 Wind Aided Natalie Pearson 11.59 2011 Tanya Harris 12.53 2005 Jennifer Harrison 12.76 2001 200 Meters 1. Natalie Pearson 23.47 2010 2. Tanya Harris 24.77 2006 3. Tia Hill 25.50 1999 4. Eureka Jones 26.09 2010 5. Sarah Gentry 26.17 2012 Wind Aided Natalie Pearson 23.25 2010 400 Meters 1. Tanya Harris 54.95 2006 2. Sarah Gentry 57.65 2012 3. Tia Hill 59.33 1999 4. Erika Walker 59.66 2007 5. Eureka Jones 59.68 2010 800 Meters 1. Zola Davis 2:10.69 2001 2. Sarah Gentry 2:10.87 2012 3. Devon Nemire-Pepe 2:16.73 2003 4. Alyska Kalmeijer 2:17.66 2010 5. Melanie Kulesz 2 :17.81 2011 1500 Meters 1. Loring Watkins 4:33.89 2003 2. Mandy Becker 4:34.22 1999 3. Micki Logue 4:38.18 2004 4. Zola Davis 4:39.05 2001 5. Melanie Kulesz 4:39.09 2011 3,000 Meters 1. Micki Logue 9:52.08 2004 2. Mandy Becker 9:56.55 1999 3. Emily Olinger 10:11.50 1997 4. Macy Little 10:17.24 2003 5. Becky Vonderhaar 10:20.29 1997

5,000 Meters 1. Emily Olinger 17:10.86 1997 2. Mandy Becker 17:20.10 1999 3. Micki Logue 17:20.46 2004 4. Loring Watkins 17:30.11 2004 5. Becky Vonderhaar 17:35.90 1998 10,000 Meters 1. Becky Vonderhaar 35:44.00 1998 2. Macy Little 36:38.98 2004 3. Melanie Kulesz 36:56.61 2012 4. Adrian Etheridge 37:42.70 2012 5. Jenn Grooms 38:14.40 1999 100 Meter Hurdles 1. Anna Walker 15.16 2004 2. Laura Lewandowski 15.16 2003 3. Marlene Silva 15.22 1996 4. Molly Harkavy 15.26 2012 5. Rhi Dundee 15.60 1996 400 Hurdles 1. Marlene Silva 1:03.71 1996 2. Molly Harkavy 1:04.50 2012 3. Diana Manee 1:04.54 2003 4. Marlene Gardner 1:05.06 1994 5. Whitney Stafford 1:06.27 2010 3000 Steeplechase 1. Emma Bussard 10:53.29 2011 2. Micki Logue 11:46.54 2001 3. Joyce Cacka 12:27.90 1996 4. Rachael Ambrosia 12:37.67 2009 4x100 Relay 1. Clodfelter, Pearson, Gentry, Jones

48.39 2010 2. Knight, Thompson, Walker, Harrison

49.78 2001 3. Harris, Lewandowski, Thompson, Manee

49.79 2003 4. Rodevick, Hill, Thompson, Harrison

50.20 2000

Current Athletes in BOLD

WOMEN’S RECORDSUNC Asheville Women’s Top Five Outdoor Times

4 x 400 Meter Relay 1. Lewandowski, Harris, Thompson, Manee

3:58.16 2003 2. Harris, Scheifer, Walker, Allstaedt

4:00.65 2006 3. Gentry, Jones, Stafford, Kalmeijer

4:00.78 2010 4. Gentry, Harkavy, Pineda, Kalmeijer 4:00.93 2012 5. Harris, Allstaedt, Carberry, Mase

4:01.16 2005

High Jump 1. Meredith Foster 1.65m 5-5 2012 2. Corrie Trotter 1.60m 5-3 2007 3. Rhi Dundee 1.59m 5-2.50 1996 4. Crystal Goure 1.57m 5-1.75 2001 5. Lauren Baker 1.55m 5-1.00 2012 Long Jump 1. Lisa Roberts 5.43m 17-9.75 1994 2. Brooke Thompson 5.39m 17-8.25 2003 3. Rhi Dundee 5.21m 17-1.25 1996 4. Jenny Bain 5.11m 16-9.25 1999 5. Laura Lewandowski 5.07m 16-7.75 2003 Triple Jump 1. Lisa Roberts 12.08m 39-7.75 1994 2. Jenny Bain 10.85m 35-7.25 1999 3. Ashlei Clodfelter 10.80m 35-5.25 2010 4. Brooke Thompson 10.64m 34-11 2000 5. Ahunna Onwuzurki 10.57m 34-8.25 2002 Pole Vault 1. Crystal Goure 3.05m 10-0 2001 2. Jenny Bain 2.44m 8-0 1999 3. Shanley Ressler 2.13m 6-11.75 2000 Shot Put 1. Crystal Durham 12.90m 42-4 1993 2. Garette Hunter 12.85m 42-2 2002 3. Laura Lewandowski 12.45m 40-10.25 2002 4. Tish Franklin 12.33m 40-5.50 2000 5. Crystal Goure 11.24m 36-10.50 2001

Discus 1. Crystal Goure 44.84m 147-1 2001 2. Garette Hunter 41.89m 137-5 2004 3. Ashley Southern 40.86m 134-1 2000 4. Molly deMattos 39.36m 129-1 2001 5. Emily Pineda 38.48m 126-3 2012 Hammer Throw 1. Crystal Goure 47.07m 154-5 2004 2. Corey McClintock 45.99m 150-11 2012 3. Michelle Ray 45.39m 148-11 2000 4. Tish Franklin 41.78m 137-1 2002 5. Natalie Williams 40.00m 131-3 2006 Javelin 1. Crystal Goure 48.98m 160-8 2004 2. Ashlei Clodfelter 39.80m 130-7 2011 3. Heather Polgar 35.02m 114-11 1998 4. Kristi Cummings 33.33m 109-4 1995 5. Amy Pearson 31.17m 102-3 2000 Heptathlon 1. Laura Lewandowski 4426 2002 2. Brooke Thompson 4169 2002 3. Crystal Goure 3945 2001 4. Morgan Weeks 3700 2007 Odd Events 4 x 800 Relay 1. Allstaedt, Mase, Duncan, Scheifer

9:46.82 2006 2. Nemire-Pepe, Watkins, Carberry, Scheifer?

9:57.10 2003 Distance Medley Relay 1. ?,?,?,? 12:30.34 1998 2. ?,?,?,? 12:45.82 1997 4 x 1500 Relay 1. ?,?,?,? 20:00.29 1997 2. ?,?,?,? 20:02.25 2005

INDOORUNC Asheville Women’s Top Five Indoor Times

55 Meters 1. Natalie Pearson 7.08 2007 2. Tanya Harris 7.40 2006 3. Jazmyn Williams 7.51 2004 4. Donetta Floyd 7.55 2002 5. Eureka Jones 7.60 2010 60 Meters 1. Natalie Pearson 7.54 2007 2. Tanya Harris 7.99 2006 3. Jazmyn Williams 8.17 2004 4. Jennifer Harrison 8.28 2001 5. Eureka Jones 8.29 2010 200 Meters 1. Natalie Pearson 24.79 2009 2. Tanya Harris 25.21 2006 3. Diana Manee 26.42 2004 4. Jazmyn Williams 26.64 2004 5. Brooke Thompson 26.66 2003 400 Meters 1. Tanya Harris 56.14 2006 2. Natalie Pearson 57.76 2008 3. Katharina Riesenberg 58.71 2006 4. Sarah Gentry 59.85 2010 5. Carleigh Knight 1:00.75 2002 800 Meters 1. Sarah Gentry 2:11.40 2012 2. Zola Davis 2:17.18 2001 3. Tiffany Carberry 2:18.00 2004 4. Siobhan Keenan 2:19.65 1997 5. Marlene Silva 2:20.71 1995 Mile 1. Micki Logue 4:59.82 2004 2. Zola Davis 5:04.18 2001 3. Loring Watkins 5:04.37 2003 4. Mandy Becker 5:04.71 1999 5. Melanie Kulesz 5:04.78 2011 3,000 Meters 1. Micki Logue 10:05.18 2004 2. Loring Watkins 10:07.94 2003 3. Melanie Kulesz 10:10.38 2011 4. Mandy Becker 10:12.81 2000 5. Emma Bussard 10:14.05 2012 5,000 Meters 1. Becky Vonderhaar 17:36.60 1998 2. Macy Little 17:52.62 2003 3. Melanie Kulesz 17:56.59 2011 4. Emma Bussard 17:59.49 2012 5. Mandy Becker 18:04.36 2000

55 Meter Hurdles 1. Laura Lewandowski 8.50 2004 2. Molly Harkavy 8.65 2011 3. Anna Walker 8.73 2004 4. Rhi Dundee 8.98 1996 5. Brooke Thompson 9.03 2002 60 Meter Hurdles 1. Anna Walker 9.19 2004 2. Molly Harkavy 9.32 2012 3. Laura Lewandowski 9.37 2003 4. Rhi Dundee 9.43 1996 5. Ashlei Clodfelter 9.49 2011 4 x 400 Meter Relay 1. Gentry, Harkavy, Pineda, Kalmeijer 4:00.51 2012 2. Manee, Thompson, Lewandowski, Harris

4:00.81 2003 3. Gentry,Pearson,Pineda,Kalmeijer 4:02.03 2011 4. Harris, I. Allstaedt, Carberry, Mase

4:02.63 2005 5. Walker, Allstaedt, Riesenberg, Weeks

4:05.13 2007 Distance Medley Relay 1. Logue, Hill , Davis, Wicke

12:21.60 2001 2. Powell, Harkavy, Gentry, Etheridge 12:25.92 2012 3. Powell,Gentry,Kalmeijer,Smith

12:27.99 2011 4. Bussard, Harkavy, Gentry, Kulesz 12:31.18 2012 5. Stanford, Rassler, Mooney, Becker

12:32.01 1999 High Jump 1. Crystal Goure 1.68m 5-6.00 2001 2. Meredith Foster 1.65m 5-5.00 2012 3. Rhi Dundee 1.63m 5-4.25 1996 4. Lauren Baker 1.60m 5-3.00 2012 5. Brooke Thompson 1.58m 5-2.25 2002 Long Jump 1. Brooke Thompson 5.21m 17-1 2002 2. Jenny Bain 5.15m 16-10 1999 3. Ashlei Clodfelter 5.04m 16-6.50 2012 4. Laura Lewandowski 5.00m 16-5 2002 5. Morgan Weeks 4.82m 15-9.75 2008

Current Athletes in BOLD

UNC Asheville Women’s Top Five Indoor Times Triple Jump 1. Ashlei Clodfelter 11.81m 38-9 2011 2. Jenny Bain 10.85m 35-7 1999 3. Brooke Thompson 10.61m 34-9 2000 4. Ahunna Onwuzurki 10.08m 33-1 2002 5. Samia Fercha 9.60m 31-6 1998 Shot Put 1. Garrett Hunter 12.67m 41-7 2003 2. Tish Franklin 12.12m 39-9 2002 3. Tia Hill 11.99m 39-4 2001 4. Laura Lewandowski 11.80m 38-8 2002 5. Jessica Keys 11.35m 37-3 1999 Weight Throw 1. Crystal Goure 14.86m 48-9 2003 2. Michelle Ray 13.88m 45-6 2000 3. Tish Franklin 13.71m 44-11.75 2002 4. Corey McClintock 13.50m 44-3.50 2012 5. Molly deMattos 13.31m 43-11 2001 Pole Vault 1. Crystal Goure 3.05m 10-0 2001 2. Laura Lewandowski 2.30m 7-6 2001 3. Jenny Bain 2.16m 7-1 1999 4. Shanley Ressler 2.15m 7-0.50 2000 Pentathlon 1. Morgan Weeks 2623 2008

WOMEN’S RECORDS

20111999 20002002 1998

2003 2002 200120021999

20032000

.75 200250 2012

2001

200120011999 2000

2008

Melanie Kulesz fi nished second at the 2011 Indoor Big South Conference Cham-pionship in the 3,000 meters

NCAA QUALIFIERSNATALIE PEARSON - SPRINTER

Honorable Mention All-American – 200 Meters(2010, 2011)NCAA Qualifi er – 200 Meters(2010, 2011)East Regional Qualifi er – 100 & 200 meters(2009, 2010, 2011) Big South Conference Track And Field Athlete of the Year (2010, 2011)Big South Conference Most Outstanding Female Track for Outdoor (2010)Top Female Collegiate Athlete in Western North Carolina (2010)Outdoor Big South Conference Champion – 200 me-ters (2010, 2011)Big South All Conference Indoor – 60 meters (2009, 2011)Big South All-Conference Indoor – 200 meters (2009, 2001)Big South All Conference Outdoor- 100 meters (2010)Indoor Big South Conference Champion – 60 meters (2007)Big South Indoor Freshman of the Year (2006)

SIMON HAAKE - JAVELIN

East Regional Qualifi er (2010, 2011)

Big South All Conference (2011)

Ranked nationally (2010, 2011)

Big South All Academic Team Indoor Track (2010, 2011)

Big South All Academic Team Outdoor Track (2010, 2011)

UNC Asheville Ranked 8th Among Nation’s Top Public Liberal Arts Colleges by U.S. News & World ReportUNC Asheville Ranked 8th Among Nation’s Top Public Liberal Arts Colleges by U.S. News & World Report

UNC Asheville received high marks in the 2012 edition of U.S. News & World Report’s “America’s Best Colleges,” released September 13. The new survey ranks UNC UNC Asheville received high marks in the 2012 edition of U.S. News & World Report’s “America’s Best Colleges,” released September 13. The new survey ranks UNC Asheville as the eighth best public liberal arts college in the nation.Asheville as the eighth best public liberal arts college in the nation.

U.S. News & World Report ranked 252 liberal arts colleges, 225 private and 27 public, in this year’s survey. The annual college rankings look at a range of measures, U.S. News & World Report ranked 252 liberal arts colleges, 225 private and 27 public, in this year’s survey. The annual college rankings look at a range of measures, including academic reputation, commitment to instruction, student abilities and admissions selectivity, college fi nancial resources, graduation and retention rates, and including academic reputation, commitment to instruction, student abilities and admissions selectivity, college fi nancial resources, graduation and retention rates, and alumni fi nancial support.alumni fi nancial support.

Said UNC Asheville Chancellor Anne Ponder, “It is always gratifying to be recognized for the great work our faculty and staff undertake every day as we challenge and Said UNC Asheville Chancellor Anne Ponder, “It is always gratifying to be recognized for the great work our faculty and staff undertake every day as we challenge and inspire our students to great scholarship, research and service. It is especially rewarding, in this economic climate, to be able to assure access to a stellar educational inspire our students to great scholarship, research and service. It is especially rewarding, in this economic climate, to be able to assure access to a stellar educational experience for all students, regardless of their fi nancial situation. These rankings affi rm our continued success in both endeavors.”experience for all students, regardless of their fi nancial situation. These rankings affi rm our continued success in both endeavors.”

UNC Asheville was also again recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 22nd among 252 private and UNC Asheville was also again recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 22nd among 252 private and public national liberal arts colleges for least debt among students graduating in 2010.public national liberal arts colleges for least debt among students graduating in 2010.

The U.S. News & World Report rankings are among several accolades UNC Asheville has recently received. In August 2011, Forbes magazine ranked UNC Asheville 26th The U.S. News & World Report rankings are among several accolades UNC Asheville has recently received. In August 2011, Forbes magazine ranked UNC Asheville 26th in the nation on its “Top 100 Best Buy Colleges” roster. Also in August, UNC Asheville was included in the Princeton Review’s new edition of “The Best 376 Colleges” in the nation on its “Top 100 Best Buy Colleges” roster. Also in August, UNC Asheville was included in the Princeton Review’s new edition of “The Best 376 Colleges” and as ranked as one of 20 institutions that have “Great College Towns.”and as ranked as one of 20 institutions that have “Great College Towns.”

In July 2011, the “Fiske Guide to Colleges” ranked UNC Asheville among the nation’s top colleges, and for the eighth consecutive year, UNC Asheville’s Environmental In July 2011, the “Fiske Guide to Colleges” ranked UNC Asheville among the nation’s top colleges, and for the eighth consecutive year, UNC Asheville’s Environmental Studies Program was among 29 in the nation that showed unusual strength in preparing students for careers.Studies Program was among 29 in the nation that showed unusual strength in preparing students for careers.

In June 2011, UNC Asheville was named one of America’s “10 Best Colleges for the Money” by Bankrate.com, a leading online source of fi nancial information. UNC In June 2011, UNC Asheville was named one of America’s “10 Best Colleges for the Money” by Bankrate.com, a leading online source of fi nancial information. UNC Asheville was the only college in North Carolina to earn a place on this list.Asheville was the only college in North Carolina to earn a place on this list.

In January 2011, Kiplinger’s Personal Finance again ranked UNC Asheville among the nation’s top 100 public colleges for its combination of outstanding education with In January 2011, Kiplinger’s Personal Finance again ranked UNC Asheville among the nation’s top 100 public colleges for its combination of outstanding education with economic value.economic value.

UNC Asheville Featured in Princeton Review’s “The Best 376 Colleges”

UNC Asheville is featured in the Princeton Review’s “The Best 376 Colleges – 2012 Edition,” and also included on several “best of” lists within the annual guidebook released today. The Princeton Review ranked the top 15 percent of colleges and universities, based on a survey of 122,000 students who provide candid assessments of their institutions.

The Princeton Review praised UNC Asheville as offering a “top-notch academic experience,” citing the liberal arts curriculum, challenging course material, and professors who are devoted and passionate about their fi elds of study. “The professors’ enthusiasm for each course is contagious,” said a student quoted in the guide. An environmental studies major added, “The classes are small enough that the professors know you by name and seem to care if you do well … tutoring sessions are free and plentiful.”

UNC Asheville also received a high “quality of life” ranking of 92 (scale maximum is 99). Students told the Princeton Review that they love living and eating in Asheville and the guide lists UNC Asheville as #16 on its national “best of” lists for the categories “Town-Gown Relations are Great,” and “Great College Towns.” Residence life, outdoor recreation, athletics and opportunities for relaxing in downtown Asheville were among the features commended for rounding out the college experience at UNC Asheville.

Earlier this year, the Princeton Review ranked UNC Asheville as one of the nation’s 50 “Best Value” public colleges, and “A Best in the Southeast.” This assessment is echoed by other prominent college rankings. In July, the “Fiske Guide to Colleges” called UNC Asheville “one of the best education bargains in the country.” UNC Asheville was also named one of America’s “10 Best Colleges for the Money” by bankrate.com, and praised for quality and value by Kiplinger’s Personal Finance, and in the most recent edition of U.S. News & World Report’s “America’s Best Colleges.”

Fiske Guide Gives High Marks to UNC Asheville and its Environmental Studies Program

UNC Asheville is once again ranked among the nation’s top colleges in the 2012 edition of the “Fiske Guide to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the country.”

“This public liberal arts university offers all the perks that are generally associated with pricier private institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville provides all this for a fraction of the cost of a private college. “I have been astounded by the quality of the teaching,” said a senior quoted in the guide. “There are no teaching assistants, only professors, and a large majority of them have the highest degree in their fi eld.”

In addition, for the eighth consecutive year, UNC Asheville’s Environmental Studies Program was named to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department stresses on-the-job internships in organizations involved with environmental issues.

Earlier this year, UNC Asheville was named one of America’s “10 Best Colleges for the Money” by bankrate.com. The university was ranked among the nation’s 50 “2011 Best Value Colleges” by the Princeton Review, and listed among the top 100 public colleges by Kiplinger Personal Finance. The most recent edition of U.S. News & World Report’s “America’s Best Colleges” praised UNC Asheville’s faculty for its “unusually strong commitment to undergraduate teaching,” and ranked UNC Asheville 5th in the nation on the “Up-and-Comers” list of liberal arts colleges.

WHAT OTHERS ARE SAYINGWHAT OTHERS ARE SAYING

WWWWWWiWWWiWWiWWWiWiWiWiWWW hhhhthththth a a aaaabobobobobobbbobbobobobobooboboboututututuuu 333,77,700000 sstututudededeeeennntntntntttts ssssss frfrfrfrf omomomomm 4 4 444 44422 22 2 ststststatatatata esesese aaa aaandndndndndndndndndndndndndndndndndndndnndnddnnndnn 11 9 cococococoooooocoocoooooooooooocouuuuununuuuuuunnnuntttrtrttrtrt iieieies,s, UUU UUUUUNCNCNCNCNCNCCCCCCCNCCNCCCNCCCCCCNNCCCCCCCCCCCCCCCCCC AA AAAAAA A AAAAAAA AAAA AAAAAAAAAAAAAAAAAshshshhshshshshsshshshhheveveveveeveveeveeeeeevililillilillili leeleee is ononoonne off tthhhehe nnnnnatatiioo ’n’n’’n’n’nnn sssssssssstototototototototottottototttotoooopp pppppppp p p ppp p p p ppp pp pupupupupupupppuppupupupuupppppppppp blblblb icicicicc l l libibibibbbbbibbbbbbbererererererererererereerererralalaaaaaaaa a artrttsss s ununununuunivivvivererererrsisisisisisitititititit esesee a aandndnddnd o oooneneneee o o o offfff f fffffffff thththththththe eeee 17717177 ii insnnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnssnsn ttitiittttttttitututt titions in tttttttttttttttttttttttttthehehehehehehehehehehehehehehheeheheheehheeeeheehehee U U UUUUUU U UUUUUUUUU UUUUUUUUUninininininnnnininininininininnnninniivevevvevevevvevevevevevvevvvvvvvvvevv rsrsrsrsrsrsrsrsrsrssssssssitititittitttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NNNNNNNNNNNNNorrrthhhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaasyssysysysyssssyyystttttttttttttstssstemeemmmmmmm. . UNUNUNUNUUNUUNUNUNUNUNUNUNUNUNUUNUNUNUUUUUUUUUUUUUUUUUU C C C C CCCCCCCCCCCCC AsAsAshehehehevivviviviviviviviviivviviillllllllllllllllllllllllll eeeeeee ofofofofffefefefeersrsrsrrs mmmmororororre e ththhhhhanananan 333 3333 333333000000000000 00000 mmmmmmmammm joojoojojorsrsrsrsrsrsrss l l lll lllllleaeaeaeeae diddididididididiiddiiididiiidiiinnnnnnngnggnnnnnnnnnnnnggnnnnnnnngggg t to o ththe babababababababababababbababbbbbbachchchchcchchelelelelelelelelellelelelllllelororoorororororororororororooroorrrororrororrrorr ooooo oooo ooooooooooofffff f ff ffffff ffffff ffff f ff fff araararararaarararararararrrarrarararrrararrartststststtststststststtsstsssssss, , , , , , ,,, ,,, bababababaabababababbbababaabababbbabbabbaachchchchchchchchhchchhcchchchchchchchchchchhchhchchccchhchhhcchchhhcc eleeeeeeeeeee or ooooooooooof ffffffffffffffffffffffffffffffff scssscscsscscscscscieieeiiiiencn eeeaaanananna d d d d mamamamaaasttststststststereeeeeereeeeeeeeeeeeee oooo oof ffff fffffffffffff lillilililililililliliiiiiiiiiiiibebebebbebebbbebebebbeeeeebbbbbbbbbbb rararararrrrrr l l lllll ararartstststtststssts dd ddd egegegeggrereeesesss......

HHeHeHeHHeH rererere a aa arerere a a a f f fewewewe m m morororee e eeeee ee fafafactctctsssssss ssssss anaaananaaaaaana d dd fi fi gugureeeeeereresss.s.s.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClClCCCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiiSizezezezeeeezee:::::::: 20202020202022

MoMoMoststst P Popoppuulululaaarararaaaa M M MMaaaaajaaaaajajorororss ss sss bbbybybybybbbb E E EEEEEEEEEEEEEEnrnrrrrrrrrrololo lmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssyyyyyyyyyyysyychchhhhhhhhoooololoololoolooololololooolololoooo ogogogooogogoggogoogggoggyyyy,y,y,y,y,yy L L L LLititititittereererereere atatatturrrureeee,e,ee,e, EEEEEEEEEEEEnvnvnvnvvvnvvvvvnvvvvvnvvvviririrrrrrrononononnnnnonononnnnnnonnnnnnnnnnnnmmmemememeeeeeeemememmeeeeem ntntntntnntntntnnnnnnnnnnntnntn alalallalalalalalalalalallllalalalallalalaaaaaa SSSSS SSSSSSSSSSSSSSS SSSS SStututututututututtuuttutuutututututututtututututututtuuutuudidididididididdidddididdididdididididdddddidid esesesesesesesesesesesssseseesessssessesessseeseesssssesess, , , , , ,,,,,,, HeHeHeHeHeeH althth &&& &&&& WW WWWWWWWWWWWWWWWelee lnnesese sssPrPrromomomotottotioioioi nn,n, aaandndnd A A AAAAAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrtrrtrttrtrrtrtrtrtrtrtrrt

FuFuFuF llbllblbblbbbbbbbllbblllblblblbl ririr gghgghghghghhhhghghhhhhgggghgghgghgg t t AAAAAwwwwwwAwAwAAAAA arararardsdsdsssssssssssdssss: ::: ::: :::: 343434343434344443434434343434444433434334444344343 s s s sttututututt dddeeeeedeeeeeeeeed ntntntnttntntntnn s s hhavev reeeeceecececcee eieiiiiieieieiieivevvvevev d dddddd dddd ddd ththththhhhhhhhhhe e prprprprprprrprprprrppprprprrrrp eseseseseseseseseseseseseeeesttititittttttttt gigigigiouououous s s s awawawaawaawawawawawawawawwawawawawawaawwawaararaarrrrararararraarraraararddd

UnUnUnUnUUnnnnUnnnUUnnnddddedededddddddd rgrgrggggggrgrgrgrgrgrgrgrggrggggraraaaaaaaaaaaddduduuuddd atatatatatatataaate eeee e ReReReReReeR seseseseseearararchchchhc :: :::::: MoMoooorere tt thahahan hhhahahahahaahhhh lfffflfflffff o ooof f ffffff stststtttuuudududududdeeeeneneneeeenenee tststststss cc c c ccccccc cccccccccccccccomomoomplpplplp eetetetetetetttetettettteeeeeeeee e eeeeeeeeeeee orooorororrrrorrororororrroooo igiggggininininiininininininiini aaaaaaaalalaaalaaaa r rrrrrrrrrrrrrrrrreeeseeesesesssseseessseesse eeeeaeaeaeaeaeaeaeaae rcrrcrrcrccrcrcrcrcrchhhhhhhh h hh hhhhhhhhhhhhhhh iininiinninninnininiiinnnininnniiinnninnninnnn tttttttttttt ttttttt ttttttttttthhhhhhhhheehehhhehheheiririrrirr fi fi fi fififififi e e ee e eeeeeldldlddd o oooof f ffffffff stststststttudududududududduddyyyyyyyyyythththrorougugh hh thththhthhhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUnnivivivivivivivviviviiverererererererereeersisisis tytytyyyyyyyyyy’s’s’s’s nnnnnnnnnnnaaaatatataa ioioionananalllllly y y rrrrerererrr cocoooococoooognngngnnngnngngnggggg izziziziiizizzizzi edededdedededededddeddedddd U U UUUUUUU UUUUU UUUUUUUUUUUUUndndndndndndndndnndndnddnndndnddndndndddndnddddddereeeeeeerererereeeeerereeereeeereeeeeee grgrgrgrrgrgrgggggg ddddadadaddadduauauuuuauauauuuuauaaaauaaaateteteteteteeeeteteteeteeteetetttttttttteee R R Reeeseseseesesesesesesesseeseseeseeseseeseesseeseeseseseesseeeeeeeaeaaaeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhhhhh hhhhhhhhhhhhhhhhh hhhh hhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogoogogogogogogogoooggogooogoogogggoogogogogooggoo rrrarararaaarararraraaarrararaaraarraraaararraaaar mm.mm.m.mmm.mmmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCNCCC AAAA A AAAAshshshshhhhhevevevvvililililillleleleleleleleeffofoooooooof unundeeeeeeeeed d thtththhthhhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatiitititititionononononononoo allllllalala CCCCCCCCCCCCCCCCConononnooonoo fefefefeferrerer ncnce e e onono U UUUUUUUnddndndnndndnddnnnn ererrrrerrrrggrgrgggg aadadaadaddadaddaa uauauuuauauaaauauuaauaaaauaaauaau ttttteteteteetttetttttttt R RR RR RRRRRRRRReseseeeesesesesesesesssesesesesesseeeeeee eaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhh h hhhhhh momoorere tthahan n 22222222525252555525522222225255525552222 yy yyyeaeeeeaeaeaeaeaeeaeeeeeeeeaeeeeaeaeaeaeeaeaarsrrsrsrsssrssrsrssrrrsrrrsrsrsrrssrsrsrrrsrssrsssss aaaaaaa aaaaaaaaaaaaaaaa goggggggogogogogoggggogogogogogoggoggoggggggggggg .

StStStStStStSStStS udddudududududdduddududdyyyy yyyyy yyyyyy y yyy AbAbAAA roorooooooooooaaaaaddddaa a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndnndnndddnddnnd S SS SSSSSSSSSSSSSSSSttuttuututututututututttt dddydydydyddyddddydydyddydy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeneenneneee t t tt oofofffooooooo sssss sssssstutututuuuuuuuuddddddddddededddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnnnn sssss ssssssss tatatatattaaaaataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaaaa a aaaaddddddddvdvvvdvvddvvdvvvanananannanannannnanananananannnanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegegegeee o o o oo oooo o o o ooooff ff ff ffff ffffff lelllleleleleellleeeleeeleeleleeeleleleeeeaararararararararaaaara ninininininininnininininnnnininn ngngnngnggngnnnnngngngnngngngnnnnngnngnnnnnngnnngnnggnnggngg ooooooo ooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp ororoooooooooooooooo tututtutuutttuuututuuuttttuuuttttuuuuuuuuunininininininn ttititttt esessss i iinnnnnnnotototottototoototootheheheheheeheheeheeh rr rrrrr ststststststtststtstatatatatatttatatatttteseseseseseeseseeeeee aaaanndndndddddddddddddddddddd ccccc cccccccccccccccccccooououooooo ntnnnntnttntnttntttrrrriririrrrirrirrirriiiesesess w whihihilele e enrnrnrololollllllllelelelellleeeleel ddd ddddddddddddd atataatatatatt UU UUUUUUU UU UNCNCNNCNCNCNCCCCNCNCNCNCNNCNCCC A A AAAAAAAAAAAAA A AAAAAAAAAAA Ashshshshshhshshhhhhhshshhhhhshshhhhshhshhevevevevevevevevevvevvevevvevevvveveveeveve ilililililllliillillilliiililleleleleleleleleleleleelelee... .

StStS ududenenenenenentttttt tt AAAAtAtAtA hlhlhlhlhlhllh eteeeteetttee e ee GGGrGrrGrGGradadadadadaaduauuauauauaaaaaaatitititititiititittitiononononoo RRRRRRRR Ratatatattttttatatttattttattteeeeee:e:eeeee:ee:ee UUUUU U UNCNNCNNCNNCCNCNCNCNC AAAA AA Ashhshshshshshevevevevevevevililililiililli lelllelelleee ss sssss sttutudeddentnnnnnnnntntnnnnnnnnnn -aaaththtthhththththhhthhthhthhlelelleleeeelelelelleelel teetetetetetetetetetetettteeeeeeeeeessssssssssssssssss s sss hahahahahahahahahahahhahaahahahahhhahahahhhhahahaahhh vvvevevevevvevvevvevevevee o oo ooooonenennn o of f ththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrarrrarraateteteteess sss iiniiininininni t ttttthhehhehehehe NNNNN NNNCACACACACACACACAA.A.A.AA.AAA O OOOOOurururururr ssssss stutututututut dedededededentntntntntntnn a-a-a-athththtttthleleleteteetes ssss ononononon a a a aththleleetitiitititicc c scscscscscscscchohohoohohoohohoooolalalalllallalalalalalarrrsrsrsrsrsrshihhihihhhhihihhhihih pspsps whoho p plalay yy alalaaa ll fofooooourururrurururrrurururrurur yyyyyy yy yyeaeaee rsrs aaattt UNUNCCCAAAsAsAshehhehevivivilllllle e hahahahavevevve a aaa 9 9 999 9 pepepepepeercrcrcrcrcrcenenenentt ttt grgrrradadadaadaduauaauatiititiioonon rrratatate.e.

FaFaFaFaFaFaFaaFFFFFFFaFaccucucucuucuc ltlltltltlty:y:y:yy:yyyyyyy 222222 211111111111111 fffff ffululululluullll-l-l-l--l-l-ll titititititit memememememememeeee f fffffffffaaaacacaa ulullululullultytytytytytytytyyyyyy mm m m m mmmmmmmememememememememeeeee bbbbebebbebebersrsrsrrsrsrsssr , , , ,, 87878778787878787878787%%%%%% % % wiwiwiwithththtthhhh tt tttttereeerererererrrmimimimimmmimimm nananaal l l dedeededeeeegrggrgrggrgrrggg eeeeeeeeeeeeees

COC PLAC: UNUNC C AsAshehevivillllee isiis thehe hhheaeadqdquauau rtrterers s fofor the e CoCCounncic l of PPububblilicc c Liberal Artsts C Coolleges, aa2525-mmemembeber r orgagaaninizazazattition of f state-supppporteed libebeberall arts collegegeges that rrrececogogninizeze t ttheee immpmportancncnceee ofoff liberal ara tsts a andnd s sccicieneenceccess ededucatiion for succesee s ss innn a comom lplexx g gloloobabab l soocicieeety.

CCCCaCaCaCaCaCCCCCCCaCaCCaC mpmpmpmpmpmpmpmpmpmpmpmpmpmpppus LifeRRReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeee Haalllls:s: Abob utu oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleeleeeeeeeeeeleleleeeee a a aaa a aaaaaaaaaaaaaanononnonononnononnooonoonnnnnnnoononnonnonnnnnn ththththththththththththththththtthththththhthhththththererererererererererererererererererereerererrerrerr tt t t ttt ttt tttttt tttttttttt ttthihihihihihihihihihihihihihihihhhihhhhihhihhhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrddrdrdrddddrr ll ll l ll llll l ll ll l iviviviviiviiviviviivivivivivivive withthini aa one-mileraraararaadidididddididdd usususususus o o oooffff ff fff ccacacacacaaaaaaaacaaaacccc mpmpmmmmmmmmmm usus.

AtAtAtAAAAAthlhlhlhlhletetettee iciciciccs:s:s:ss:s:: 1 114 4 4 44 NCNNNCNCNCNCNCNCNCCCCCCCCCCCNCCCAAAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetttettettttteteeet amamamamammamamamamamamamamamamaaaaaaaaaaa s s

StStStStStStStStStStStStudududdudududududududenenenneneneneneenennene ttttttttttt t GrGrGrGrGrGGrGrGrGrGrGrouoouououououououououpspspsps:: :: MoMoMoMoMooMoMoMoMoMoooM rerrerrererereereerrerreerrerereererr t t ttt tttthahahahahahahahahaahahahahahaaahhaan n n nnnnnnnn 6060606060060600600000 c cccccccccccccccccccclululululululululululululuuululuulullubsbbsbsbsbssbsssssbssbsbsbsbsbsssbsbb aa aa a a aaaaaaaaaaaandddndndndndndddndnddddndndndndnd ooo o ooo ooo o ooooooooooooooorgrgrgrgrgrgrgrgrgrgrgrgrgrgrgrgrggggananizzata ioionss, raaaaaaangngngngngngngngngngngngngngnngngngnnngnginininininininininninininininininniiininiinng g g ggggg ggggg ggg ggg ggggg gggggggggggggg gg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrrfrrrrromomomomomoomomomomomomomomomomomomomoommommmomomomomooo h hhh hh h hhhononononononnororororor s s s s ssococococococo ieieieieietititititieseseesss t ttttttttto o o oo o iniininnini trtrtttrtrrtrrrrrtrttrrtrrrrrrrrraaamamamamamamamaaamaaaamaaa urururururururrurururuurrrurruruurrururralaalaalalalallalalalalalalalalaaaaspspspspspspspsporororororroortstststst

Innnnnntttteteeercrcululuuuulltututututututtuuturaraaaraararral CeCeCeCeCeCCeCCeeCCeentntnttnttttttttttererererererererererererererereer & & &&&&&&&&&&&&&&&&& O OO OOOOOOOOOOOOOffiffiffiffififfiffiffiffiffififfiffiffiffif cccccc cc c e eeee ofoooffoffo MMMMM MMMMulululluuuluultititttitittticucuucucucucuucultlttltlttltturururururururururrurralalalalalalalalal SS S S S SS SS S SStututututututututuuudededededededededededeeededentntntntntntntntntntnnntnttnt P PPPPPPPPPP P Prorororoorororororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrramamamamamamamamaamama s:s Thee Inttttererererererererccucucucuuuucucuultlltltltuuururrurrrrrurrralalalalalalalalalalaal C C CC C C enenenennteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohohh uuususuususuususususususususssususuuuseseesesesseseseseseseseseseseseseseessssssseesssseessssesessscococooocoococococococococc ffmfmfmfmffmffmmfmmfmfmfm orrrororororororororo tttttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaccccaaa eseesesesesessssessessses f ff fff f ffffffffffffforororoorororororororororororr mmmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetititititititititittittingngngngngngnggggggngngngngngn s,s,s,s,s,s,s,ss,s,s,s,ss,s s ss s ssssooco ial eveveveneneneentstststt a aaaaa anndndndndddnd p p p p ppp pppppprogrgrgrgrrrrramamamamamss ssss ininininvovovovooooovovvoovov lvlvll ininnininingggg gg sususususususususuusussusuuuuchchchchchchchchchcchcchcccc d dd d dd d ddddivivivvvvvvvi erererererererssssesesssssssee groupppppss ssss asasasasasasasasasass AA A AA A AA AAAA Alllllliaiaaaaai nnnncncncncncccccccncnncncnccncncncnncnccccnnn e,e,e,e,e,e,e,ee,e,e,e,e,ee,e,e,e,e,,e,eeeeeeeeeeeeee,,,ee,,, BBBBlllBBBBBlaacacacaacacacaaaaa kk k kk SSStttttStSttttttttudududududuududeneneneneenenennnentstststststssssss A AA A AAAAAA Asssssssssssssssssococococooococococococococococo iaiaiaiaiaiaiaiaiaiaiaiaiaiaiaattititititititititititititititttitioononononononononnononononono , ,, , , ,,, ,, ,, InInIInInInInInInInInInInnInIntetetetetetetettetetettteternrnrnrnrnnrnrnnrnnrnaatata iooi naananaaaalll llll StStStStStStSStSttudududududdududdddudeneeneennnenne t t t t tt AsAsAsAsAsAAsAsAsAsAsAAssssosoosososos ciciciciciciciciciccc atatatatataatattatatatatttioioioiooioiooiiionn,n,nn AAAAAAAAAAAAAAssiisisisisisisisiannnanananananaananananannaannaan S Stuuuuudededeedededededeedededennnnntnntnttnnntn ss inininin AA Ashhhhhhhhhheveeeveeee illeeee, , , HeHeHeHeHHHHHH rmrmmmmrmaaaannnnnnnanannnnnnnnanasasaasaasasasasassassasasasasasasasaasasasasasssassssasssasassaaOOrOrOOrrrOOrOOrOrOO gugugugugugullllllll ooooooosososososososososos e ee eeee e eeen n n n n n LLaLaLaLLaaaaLLaLL s s s AmAmAmAmAmAmAmAAmAmAmAmAmAAAmAmAmererererereererererererereericiciciciciicicicccicicicicicci aasasasasasasasasasaaaasasa ( ( ( (( ( ((( (( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOHOHOHOHOHOHOLLALLALALALLLALAAAAAAALAAL )))))) aanannanannannnd dddddddddddd HiHiHiHiHiHiHHiHiHiHHHiHiHilllllllllllllllllllllllllllll lllleleleleleleleee . . ....

ThThTTThThThThhThTThTTTThTTTTTTThThThhe eeeeeeee SShShShShShShSShhShShShShererererererererererririiiririririririirilllllllllllllll C CCCCCC CCCCCCenenenenenenenenteteteteeteteeeeeter:r:r:r:r:r:r:rr::r:rr WiWiWiWWWiWiWiWiWiWiWiWiWiWiWiWWiWilllmllmlmlmlmlmlmlmllmmlmaaa aaaaaaaa M.MMM.MMMMM.M.MMMMMM S SSSSSSSSSSSSShhehehheheeeheheeehheheheherrrrrrrrrrrrrrrrrrrrilililiiililiilillllll CCCeCeC ntntnttereree i iis ththhthheeeeeeee e unuuuuunununuunununnniviviviiiiviiivivivivererererererrerrrer isisisisisisisiiisisiisisisisisis tyttytytytytytyytytytyttytytytyyttytytytytyttyty’s’s’s’s’s’s’s’s’s’s’’ss’sssssssss nn n n nnnnnn nnnnnnnn nneweewewewewewewewewweweweweweeewwwesesesesesesseseseseseeseeeesessessttttt tt ttttttt aanaaaaannnnd d d lalaargrgrgrgesesessssssssessssst t ttttttt fffafafafaaaaaaaafaf cccccciiicccccccccciliiiitytytyty, ,, ooffffoffffffffffffffefefffffeeeeeffffefefeeeriirr ngngngngngngngngngngngngnggngngngngngnggngggnngggggga a rarangngnggge e e ofoff aa acacacadededeeemimiimimimimic c c c cc ananananannnnddd d d d dd ououoouououtrtrtrtrtrtreaeaeaeaeaeaeachchchchchchcchhh p p prrorogrgramamss fofocucusesed d ononononnn hhhhh h hh heaeaeaeeaaaeeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy llll l l lllliviviviiviviviivvvvininininiiininng gg gg g ggg ananananananananananananand dddddd dd dd weweweweweeeeweewwwww lllllllllllllllllllllneneneneeneneneneneneneneessssssssssssssssssssssssssssssss pppppppp pp ppppp p p pprororrororororoororrrrororororroroooomomomomommmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeecececececeecececccc nnntntnterere iii iis s s hohohomemmmemee tt ttooooo o thththhhththhheeeee eee acaacacacacaca addadadaddadadememememmemiciciccicicic DDDDDDepeeppparararartmttmeeeneent t off HHHHHHHHHeaeaaeaealtltttthh hhhh ananaa d d WeWWeWWWWWWWWWeWWW lllllllllllllll nenenn sss, wwithhhhhhth c clalaassssrooroomomommomss,s, ddddddededededeeededdicicicccciicicatatattttttededddedededeeded sssssss ss spapapaapapapapapapapapacecececececcececececececececececcececececeececeffofofff r r unundedergrgr rar duate researchh, a hiighghghghghg -tech tttet acachingngngnngng/ddememmonoonstststs rararar titiononnn kkitittttchchchchchhhhchhhchhccheneeenenennnennnnnnen, , , , , ,, ,, ,,,,,, ananand d d rereeeseseseseeseeeararararararararaaaarraraaaarararraraaraa chchchchhhhhhhcch aaaaa aa aaaaanndndndndnnd lleaarnnininnngggggglalalalalal bsb .Theee S SSherrrrrriliiiiii l Ceeeeeeeenter includeeeeeeeeeeeeeeeeessss ssssssss ssss anann e eexpxpxpxxx ananansisisiveve fififi fifi tt tnenenessssss c ccenenenenennneennnttttetetetetetettetteeerrrr,rrrrrrrr,rrrrr,rrr aaa a aa b b bbioioioioiooiooioioooioi fffefeffeefefeffefffefeffeeeeededededededededdeddeededdde bbabababababababbababababbabaackckccckckckckckckkcckkckckckckcckckcck lll l lllababbababaababababbbbb aa a aaaa nnndndd mmmmmmmmmmmmmmedededdedededddddddddddddddititiittttiitittititttatatatatata ioioiooion n rrrrrrrorrrrrrrrrrrroomoomoomomomommomomomommomomooooomooo , , , anananaaa d tththththththhtththht eee eeeee WWWWWWeWeWeWWWWW lllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé

KKiKiKK mmmmmmmmmmmmmmelelelelelelele A AAAA A A AAAAArererereerrrenananananana::: : : ThThThThThThe eeee neneneneneeww ww KKiKKKK mmmmmmmmmmmmmmmmmmmmeleleleleleleeelee A AA AAAA AAArereerenanana, , wwwhich issis p pararara tttt t ofofofofofofofofofoffofof t t t ttttthhehehehehehhh SSS hheherrrrrrr iiililll CeCeCeCeCeCeCeentntntntntntnttnttntnterereerereererr, ,, , , caccccacacacacaccccann nnnn n seseseseseeeataatatatataaaaatttat uu u u uu uup p p pp pp tottoooooooooo 3 3 33,8,8,8,8,8888,8,88888, 000000000000000000000000peopopppppopopppleleelelleellelle f f f f f ffffffforororororororooo ccccccconononononncecececeecertrtrtrtrtr s,s,ss,s, c cccccomomomomomommmemmemmencncncncncncccnccceeemememememememeemememeneneenenennennnnnentstststs, , , cocoonnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttc ururururururuuru esesesese ,, , , , , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiig atatatatatatatatataaatta ee ee eee e e e memememmemmemeemem nn’n’n’n’nnnnn s s ss sss anananananannnnddd ddd d d wwowowowowowww memememeemeeem n’n’n’n’nnnnn s s ssss babbababababaaababbbbaabaassssss----s--ssketbbbbbbbbbalaalalallalallalaa l lll l llll gagagagagagagagagagggagamememmememeemmmes,s,ss,s,ss h h hh hheaeaeaeaeaealtltltltltlthh h h h h fafafafaffairirriririrs,s,sss,s aaa andndddddddd c ccc c c cc cc cccccomoomomomomomomomomomoo mmmumumummmmmmm nininityyytt eeeeventtts..s

KuKuKuKKKKuKKuKuKuKKuKuKuKuKKKuKKKKuKuKuKuKKKuKuKKuKuKuKudodododododododododododododdododdododdddoododdddododoodosssssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUUUNNUUNNUNNNNUU C C C CCCC CCCCCCCC AsAsAsAAAAAsAsAsAsAsAAssAsAAAsssAsheheheheheheheeheeeeeheeeeeeeevivivvivivivivivivivivivvivivvvvvvv llllllllllllllllllllll e eee e eeeeeeeee rararararrararararraanknknknknknknknknkkknknknknkkkkkkkkknkkkks ss sssss sss s ssss eieieieieeieieeiee ggghghghghghgghghghghghgghghghghghhghhg thtthththththththtttthththththhhhht i i ii n nn n nnnnnnnnn thththththhthththhhththtthththeeee e e e eeeee eeeeee nanananananananaaananaaannaatitititititiittittittiitttt onononononononononononononoo aa aa a aaaaaaaaaaaaaamomomoomoomomomomomomomomomommomomommmm ngngngngngngngngngngngngngng P PPP P P P PPPPPPP P PPPPuubububububububbububububuubuuubbbbub ilililililllilicc c cc cc cc LiLiLiLiLiLiiLiLiLiiLLLiiLLiLLLiLiiLLLL bebebebebebebebebeebebeebeeeeeeeeeerarararararararaarararararrar ll l l lll l l ll ArArArArArAArArArAArArArAArArAAAAAArAAAAAArArArArArAAA tststststststtststsss C CC C C CCCCC CCCCCCCCCCCCCColololololololoooooooo leleleeleeeeeleleleel gegegegegegegeggeegegegegegeeeggeesss s s ss ssssss ssss ---- --- - U.U.U.U.U.U.U.U.U.UU.UUUUU.S.S.S.S.S.S.S.SSSS.SS.S.SS...SS. NN NN N NN NN N NNN NNNNNNNNeewewewews s s & && & & WoWoWWoWoWoWoWWWoWWWWWWWWW rlrrlrrr d d d ReReReReReReReReeeeeeee---------poppopopopopopopopopoopooooopopopopoppop rtrtrtrtrtrtrtrtrrrrttrttrr ’s’s’s’ss’s’s’s’ss’s’s’s’sss “ “ ““ ““““ ““ ““ AmAmAmAmAmAmAmAmAmmAmAmAmAmAmAAmAmmAmAAAmAAAA erererererererrereereeeeee iciciciciciciciciiiiiciciciccccccca’a’a’a’aa’a’a’aa’aa’aaa’ss s s ssss s sss sss s ss BeBeBeBBeBBeBeBeBeBeBeBeBeBBeBeBeBeBeeeeBeeststststtttstsstssttsttstttt CC C CCCCCCC CC CCCCC CC CCCC CCCCCColololooloololooollollolleleleleleleleleleleleeleleleleeeeleeeegegggegegegegegegeggegegegegegeggggg ”””””””””””””s”s”ss””s ((((((((((((( ( (SeSeSSSSeSSSSSSeSeSeSeSSeptptemembbbbbbbbbebebbbbbbbb r r 20201111))

UNUNNUNUNUNUNNUNUNUNUNUNUNUNNNNUNUNNCCCCCCC C CCCCCCCCCCCCCAsAsAsAsAsAsAAsAsssAsheheheheheheheheeheeeeheehevivivivivivvivivviv llllllllllllllllllllllllllllee e ee eeeeeeeeeeeee isisisissssssssssissisisisisisssss t t ttt tttt t ttttttttttthehehehehehehehehehehhehehehehhhhheheeheehheheeheheeeh o oo o o oo o ooonlnlnlnlnnllllllllyyyyy y y y NNNNNNNNNNNNoNoNoNoNoNoNo ttttrtrtrtrtrthhhhhhhhhhhhhh CCCCCCCCCCCCCCaCCaCaCaaCCCC rorororoororoolililillillillliililillil nanananaaa iiiiiiii insnsnsnsns iitiititititititittititititttttutttututut tititiitititttitit ononononon llllllllll lliiiiiiiisiisissisisttttteteteteteeddddddddddddd d d d amamamamamamonononononggggg g NNNNNNNNNNaNaNaNaNa iiiitititiititititit onononon lllllllalalalal LLLLLLLLLL Libbbbiibbbibibibibibi erererer lllalalalala AAAAAAAAAAAAA A tttrtrtrtrtssss CCCCCCCCCoCoCoCoC lllllllllllllllllllegegegeegegegeseseses www whhhhhhhhhhohohohoh sesesessee sstsststststsstststudududududduddudddudu enenenenenenennnennntststststsssstssttsssss g g g ggg ggg ggg ggrararararaaraarararaarradududududududdddudududd ataaaaaatatatatatataataatatataaaaatttaatee e e e eee ee wiwwiwiwiwiiwiwwiiiwiiiwwwwiwiwithththththththttththh t ttttttttthe least aaamomomount t of ddddeebt.tt - U.S. NeNeNeewswswwsws & & & & WWorld Reppororo t’t s s “A“Amemm riricac ’s Best CoCol-l-lelelelelleeleeeegegegegegegegegegegggggggggg s”s””s””s”s”ss”s ( ( ((((( ((((((((((SeSeSeeeeSeeSSSSSSSSSeptptptptptpttptppttptptemememememmmemememmemmemmembebebebebebebebebebebebebebebebbberrrrr rrrr rrrrr 2222020220202020202222022 1111111111111111 )))))))))))

UNUNUNUNUNUNUNUNUNUUUU CCC C C CCCC CCC CC AsAsAsAsAsAsAsAAsAAsAsAAsAsAAsAAAAAAsheheheheeeeeeeheeevivviviiviviiiiiviviivvvvv lllllllllllllllllllllllllllleeeeeeeee eeeeeeee e ofofofofoffofofffffffffffeffefefefefffefeffef rsrsrsrsrsrsrsrs a aaaaaaaa aaa “ “ “ totototottoootootootoot p-p-p-p-p-p-p-p-p-p-p-p-p-p-p-nonononnonononononoonnnnnn tctctctctctttctctctctctctttttctt h h h hh h hh hh hhhhh acacacacacacacacacacacaca adadadaddadadadadadaddadadadadaddemeememememememememememememeeeme icicicciciciciciciciciccicicic ee e e e e ee eeeeeeeexpxpxxpxpxpxpxpxpxpxpxpxxpxpxpxpppppererererrrrrrrrrrrrrieieieieeieieeieieieiieeieeeencncncncnncnnnncnncnncnnccn e,e,e,e,e,e,e,eee,e,e,e,,ee” ” ” ananananananananaananannnand,d,d,d,d,d,d,d,d,d,d,d,ddddd,ddd b b b bbb bb b b bbbbbbbbbbasasassasasaasasaasasssasasaaa edededdddeddddedded o oo o o o o ooooooon n n n nn n nn stststsstststsstststtstudududududududuudududududu enenenennnennnnnnt tt tt t t t tt ttt susususususuuusuuuuusurvrvr eyeyy rrrrrrrrrrreseseseseseseseseseseseeeseeee popopopopopopopopopopopopop nnsnsn esese ,, AsAsAsAsAsAsAsAsssshhehehheheheheheheheheheeheheeeeeeeeeevivivvivivivvvvvivviviviii lllllllllllllllllllllllllle e e e e e eeeeeeeeeeeeeeeeeee e isisisisiiiiiiiisiiiiiiiisiss r r rrrrr rrrrrranananananannna kekekkekekkekekekkkekekkekekeekekekkekekeeeekekkeeekekkk ddddddd dddd ddd ddd d d d d dd d dd amamamamammamamamaamammaaaaamamammammmonoooononnnnnononnoonooonooono g g thththththththththththththththththththht e e ee eee eeeee ee e eToToToToToToToToToTooToToToTooop p p p p pp p p pp p p p ppp 202020020202020202020200020202022 “ “ “ “ ““ GrGrGrGrGrGGrGrGGrGrGrGGrGrrGrG eaeaeaeaeaeaeeeeaeaeaaeaeaae t t tt tt ttttt CoCoCooCoCoCoCoCoCCCoCCCCCoC lllllllll egegge eee ToToTTTTTToToTownwnwww s”””””s””” i iiiiin n ththhhhthhhhhe e nanananatitittttt onononononononnonoonon -- -TTTT TTTTTTTT TThehehehehehhehhehhhehhe P PPPPPPPPPP PPririririririririirrr ncncncncncncnccncnncnncetetetetetettettttttonononononononoononnonno R Revevvvvvvvvvvvvvviieieieieieieieieieieieeieeeeew’w’ww’wwww’wwwwwwws s s s s s s s ss ss “T“TTTTTTTTTTTTThehehehehehehehehehehehh BBeBBeBeBeBeBeBeBeBeBBeBBeBeBeBeBeBeBeBBeBBBBBeBeBBBeBBeeB stststststststststststtstsststsststtttt 3 333 33333 76767676767676767676767676666777776 C CCC C C CCC CCCCCC CCCColooollllololollololllolollelelleeleleleleeelelelelelllllelelll gegegegegegegegegegeegegegeegeeeeegegggeggg ss s s ss s sss ssss ssssssss - -- - 202020202020202020200202020220002001122212 EEEEEEEEEEEdididididdiddididddiditititititttititiononononononononononononnono ” ”” ” (A(A(A(AA(A(A(AAAAAAA(AAA(Augugugugugugugugggugugggusususuuuusuususuususttttt tt t 202020202020020202020202200111111111111111))))))))))))))

UNUNUUUUUUUUUUUUUUUUUUUU C CC C AsAshehevvvvvvivivivivvvivvvvvvivilllllllllllleeeeeee e eeeeeeeeeee issssis ““ ““““““““““““““““““ “ononeeeee ee eee ofoofofoff t theheeee b b esest t edededdde ucucuu atataaa ioiooonanannn l l babargrgggaiaiaa nsnsnsnsnss ii in thththhhhe e cocoununtrtry.y.y” ” F Fororo e eigigghththt c ccononsesecucuutitiiiveveveveveveveveevvvev y yy yy yy y yyyyyyyeaeaeaeaeaeaeaeaeaaeeaeeaee rsrsrsrsrsrsrsrrsrsrsrsrsrss, , , ,,,, ,NUNNNNNNC CCCCAsAshehevvvvvivivvivvvviiviiivvvvv llllllllll eeeee’e’eees s EnEnviviroroooooooooooooooonnmnnmnmnmnmmnnnnmmmmnnmmnnnmmmenennenenneneneenttatatatatatal ll l SSStStStSS ududieies ss PrPrPrPP ogogogogogggggggggggrararrrr m m mmm hahas s bebeeeeeen nammmmmmeded t to o ththe e e lilistst o of f prprppp e-e-e prprp ofofesese sisis ononalall p prorogrgrgrgrgrgrramamamamamamammmaam

wiwithth uununususuaaaaalalalalaaalalallaaaaa s s s s ssttttttrtrtttttttttttt enengtgth h inin p pppprererrerererererrrer pappariiirinngngn s ssstutututututut deddddddeddd ntnttss s fofor rr cacacacarereerers.s. --TTTTTTTTT TTThhhhhhhhhehehhehehehehe FFFFFFFFFFFFFF Fissisisisississiisisisiskkkkkkekkekekekkekekekekk GGGGGGGGGGG GGG Guiuiuiuiuiiuuiuiuiuiiuiuidededededededdedeededededededde tttttttttttt t toooooooooooooo o o CoCoCoCoCoCoCoCoCoCoCoCoCoCoCooCoollllllllllllegegegegegegegegegegeggegeggeseeseessseseseeeseesessseses, , 20222222 12 Ediditition ( (JuJulyly 20202020201111))

UNUNC C AsAshehevivilllle e isisssssisisisssssi oooooooooo o o oooooonennnennneneenennenenenneneeenee oooooooooooooo oooooooofffffffffff ff AmAmAmAAmAmAmAmAmAmAmAAmAAAmAmAmAmAmAmAmereerereeerererrrererererrererereee iciciciciciciciciciciciciciiccca’a’a’a’a’’a’a’aaaaaaaaasssss sss “1“1“1“1“1“1111111100000000000000000 0 BeBeBeBBBeBeBeBeBBeBBBeBeBeBeBeBeeBeBeeBBeBeBeeB stststststststststststsststst CCCCCCCCCCCCCCCC CCCCCCCColololollololllolololoololllllelelelelelelelelelleleleeleleleleelegegegegegegegeggegegeggegegeeeegess s s ss sssssssss fofofofofofofofofofffor r r r rrrrr thththththththhtt e ee e e ee MoMoMoMoMoMoM neneneeneneney.y.y.y.y.y.y.y.y.y.y” ””””” ” ---- - - - -- BaBaBBBaBaBBBaBBaBaaaBaBaanknknknknknknknnknknkrararararatetetettete.ccccccomomomomomomommmmom, , , a aaaaaaa llllleleleleleel dddadadaddddadaddadaaaddadiininininininninnininingggggggg g g gg ggg ononononononononononooonoo lililllllilineneneee sosourcee o off fifi nananciaial ll ininfoformrmatatioion n (J(Junune e 202011111))

UNNC C AsAsheville e is among jjusust t 50 iinstitutions nationwiw dee nnoto ed as aa “B“Besst tVaV lulue”e” p pubublilicc cocollllegege.e -- - ThT e Princetoon ReReviviewe ’s “2020111 Best tValue Collegese ” ” (F(Febebrruary 20201111))

UUNC Asheevivillllee is one of ththe nationon’s 100 best valuess i n n pupublic colo lelegegess. - KKiplingngerer’s PPersoonal l Financn e e MMagazine (Jannuarry y 202 11))

TThe UNC AsAshehevivilllle e “ffacaculultyty hhasas aan n unussuau lly strong cccccommomomommimimimim tmtmennent tot undnderergrgrggg adaduauauuu tetettt t teaeachchining.g.” - U.S... NNews &&&&&&W WW W W WWorororororoo ldldldlddldd RR R R RR Repeepepepeppppppporrorororort’t’tttt ssss s “AAAAAAmememeririricacaca’s’ss B B Besesest tt t CoCoCoCollllllllegegegegeggggesesesesee ” (2(2(2(2(2((( 00011110100 0)0)))))0)0)0)))))

UUNUNC C C C CCC CC C CC AAsAsAsAsAsAsAsAAsAA heheheheehheheheh vviiilllllllll e ee eeee isisisisisisiii t ttthhehehehe ooooonlnlnlnlnlyyy yyy y puupppppp blblblbliciccicci ll l l libibiibberereralallala aaa a trtrtrtrttttsss cococococ llllllegegegegeegeee eeeeee nonononoteteteteteteteteteted d ddddd d dd aaaaaaaasaaas aaaa “““ TTTTToTT p UUUpUpUpUpUpUUpU -a-a-a-aaaaandndndddndnddndd-Coommmmmmmininnggg g gggg ScScScScScScScchohohohohohohhooloolo ” aammmmonong NaNaNaNaNaNNNaatititititiit onononononoonnononno alalalaalalalalalalaal L L L L L LLibibibibibbibii ererererereralalalalala A A AAAAAAAAAAAArtrtrttrts ssssssss sss oCooCoCooCoCCoCoCoolllllllegegegegegegegegegeggggeseseseseeeseee . . . . UNUNUNUNUNUNUUNUNCC C C CCC C C AsAsAsAsAsAsAsssAAshehehehehehehehhehehh viiiviivivilllllllllllllle eeee eee isisisisisisisi raaananaa kkkekkekeed d d d d fi fi fi fi fififififi ftftttftftftftftftf h hhhhhhhhh iniii ttthhhhhihhihh s s didididididididistsssssss iinnnninnininnngugugugugugugugug iisisisisisisi hhhhhehehehhheeeed dd dd ddd cccacacacacaacc tetetetetegggggogoogogogg ryryryryryryryy..... - - -- UUU.SSSSS. NNNeNN wsw && &&&&& && & &WoWoWoWoWoWoWoWWWWWWoW rlrlrlrrlrllr dd dd dd ReReReReReReReeR popopoooppoppooooortrtrtrtrtrtrtrttrtr ’s’s’s’s’s’ss “ “““““ AmAmAmAmAmAmAmAmAAAmAAAAAAmmmAmererererreeee icicccccciiccccca’a’aaa’a’a’a’a’a’a ss ss s s BeBeBeeBeeeeBeB sstststssttsstt C CCCCCCCColololololo lelelelelleeegegegegegegeggggggg s”s”””s”””””””s ( ( ( (( (20202020202020020202 100101010101010100)))))

UNUNUNUNUNUNUUNUNUNUUUNUNNCCCC CC CC C AsAsAsAsAsAsAsAsAsAAsAsAAAAAAshhhehhehehehehheheehehehehehhheeeviviviviviivvivivivivivivivvv lllllllllllllllllllll ’e’e’e’e’e’e s Undedergrgraradudududdududduduuatattatatatatatatatattteeeeeeeeee ee RReRRReReReReReReRRR seseara chch PProogrgrrrrrrrramamamamamammammaaaam hhhhhhhhasaasasasasaasasasasas bbbb bbb bbbbb beeeeeeeeeeee nnn rarararaaanknknknknnknnnnnnn edededededded aaaa a amomomomomooooomoongngnggngg ttt tthehehehheh bbb bbbeeseseseseeeeeeeee t tt t tt ininininin ttt ttheheheheheheeh nnn nnnnatatataatatatatattioioiooioioioioiooioiioonnnn nn n nn fofoofofofofofofofoorrrrrr rrrrrnninininenenennnnnnnnne c c c cononononononononononnononnnnonsesesesesesessesseseseeeeeecucucuccucucucucucuuccc iititititititititiveveveveveve y y y y yeaeaeaeaaeaaeaeearsrsrsrsrsrsrsrsrrr . - --- UUUUUUUUU.UUU.U.U.U.SSSSSSSS.S.SSS.S.S. NN N N N N NN NN Newewewewwsss ss &&&& & &&& & &&& &WWWWoWoWoWoWoWoWoWoWoWoWoWW lllrlrlrrlrlrlrrlrldddd d d dddd d dddd RRRReReReReReReReReReReeReReReeR popopopoopopopopopopoportrtrtrtrtrtttrtrtrrtrtrrrt’’’’’’sss’ss’ “““ ““““““AmAAAAAAAmAAmAAmAA ererereeriiciciccica’’’a’ss ssss s BBeBeBBeBBBeBeBeBeB tststststssss CCCCC CCC C C CCCCCCollolllolololoolololleleleleleeleleleleleleleeeeeegegegegegegeegegegeggg ”””s”s”s”s”s”s”ss ((( (((( ((( (((202020202020202022020220202 10101010100101000010000)))))))))

UNUNUNUNUNUNNNUUNUUNUNNNNUNUUUUNUNUNUNUU CCCCCCCCCCCCCCCCC C AsAsAAAsAsAsAsAsssAAsAsAsssheheheheheheheheheheheeeheheheevvivvvvviviviiivivvvvvviv llllllllllllllllllllleeeeeeeee iiiisissisisisss aaaa a amomoomomomomomomomomm ngngnngngngngnngnggggg jjjjjj jjjj j uusususuusuususususttttt t t t t t 2121212222121111112122212121212122 ssss sss s smamammamamamamm llllllllllllllll ssssss s sssstatttttatatataatatatatateteteeeteteeetetetetteeeee sssss s sss chchcchhhhhchchchhchhchccchoooooooooooooooooooooooooooooooooooooooooooooolslsslslsllsslslssss ooooooooo o ooo o oonn nn n nnnnn tththththththtttttt e eeee e ee “C“C“C“C“C“CCCCCCCCCCCColololololollolololooolooooloololoololleleleleleleleleleeleleleleeeleeeleleeegegegegeegegegegegegggegegegegeggggg AAAAAA AAAAAAAAA AAA-L-L-L-L-LLLLLLisisiisisiiiisisisi ”t”t”t”t”t”tttttt f ffff ffffffffffffforororrororororooroooroo ooo oo oooo ooooffffffffffffffffffffffffererererererereeereererininininininnninininininng ggggg g ggggggggggg aa a a a aaa “a“a“aaaaaa bbb bb b bigigigggigiggiggiggigggggggg-l-l-l-l-ll-l-l--l- eaeaeaeaeaeaeaeaaeaeaaeeeeeee guguguguguguguguuguguuguguuguguuggg eee eeeeee eeeeedededededdeddddeducucucucucucuuccccu ataaatatatatttattatatatttioioioioioioioioioooioioioioioionnnnnnnnn.nnn.n.nn.””””--- - PaPaPaPaPaPaPaPaPaPaPaPaaPPPPaPaaaararararararararaaadeddedeeddedededdededeedddededede m mmmmmmmm mmmmmmmmmmmagagagaggagagaggagagagagggggggaggggggazazazazazazaaazazazazaaaazaazaaaaazzazinininininnininnnnnnnnninnnee e eeeeee eee eeeee eeeeeeeeeeeeeeeeee (2(2((2(2(2(2(2(2(2(2(22(((((( 01010001010010101101001010010110110010 0)0)000)0)0)0)0000

UNUNUNUUNUNUUUNUNUUNUUNUNUNUNU CC CCCCCCCCCC CCCCCCC AsAsAsAsAsAAsAsAsAsAsAsAAA hehehhehehehehhhehhehheh vivivivivvivivivivviiv lllllllllleee eeeeeeeeee e isisiisisisisisisis o o ooo ooooooooooonnenenene oo oo ooooooooof ffffff f fffff ffffffffffff fff ththththhhhhheee eeeeeeeeee eee totttoototototototootootooooopppppp ppp ppppppppppppp grgrgrgrgreeeeeeeeeeeeeeeennnnnnnnnnnn nn n nnnn nn coccocococococococococococcocccococolllllllllllllllllllllllllegegegegeggeggegegegegeeeee esesessesesesessese iiiiii ii iiii iiiinnn n nnnnnnnn n nnnn ththththhhhhthhhhhhththththt eeeeeeeeee eeeee e e SoSoSoSSSooSoSoSoSoSoSoututtttuttututtutututuututututhheheeheheehehehehehehhhehheheeeeheeehehhheheaaasasasasaaasasasaaaaaaa tt.t.t.t.t..tt.t..t.t.t.t.t.t.t ----- -- -- B B BBBB BBBBBlulululululluluuuuuuuuuuuuulueeeeeee ee e ee RiRiRiRiRiRiRRiRRRRRRRRRRRRRRRRR dgdgdgdgdgdgdgdgdgdgdgdgdgddgdddgdgggggdggdgdddddgggeeee e ee eeee OuOuOuOuOuuOuuOuOuOOuOuuuuOuuuOuOuuOOuuOOutdtdtdtdtdtdtddtddtdtdtdtdtdtdttdttdtdtddtdttddddtdtddttdt ooooooooooooooooooooooooooooooooooooooooooooooo rsrsrssrsrsrsrsrssssssrs ( ((( ( ( (( (( (((( (( (( (((((( ((2020202020202020200020200202022202 101010101010010101000101010100010000000000)))))))))))))))

UNUNUNNNNUUNNNNNNUNNNNNNC C C CCCCCCCCCCCC AAAAsAsAsAsAsAsAsAsAAsAsheheeheehehehehehehevivivivivvivvv lllle ee e isisisisisssi lll l l lliisissssssssisssssteteteteteeeeeeeeeteeeedddddddddd dddddddddddddd dd aamamaamamamaaamamamamoononnnononng g ggggggg g gg g gg jujjjjjj stst 22222222222222222888886666868666686868686868686686686868686868686 UUUUUUUUUUUUUUU U UUUUUUUUUUU SSSSSSSSSSSSSS.S.S.S.. cocococococoocococoocococccoococococccocooooocccoocoococc lllllllllllllllleeeeegegegeggeesese aaaaaaaaaaaaaaaanndndnddddnnnnnn uuuuuuuuuuuuninniininninninnnnininin vevevevevveversrsrrsrrrsrssitiittttttttittttttttttiieieieieeieeeieeeeeeeeeieieiessssssss ththththththththththhththththththhhthhhhhhthataatatatataa h hh avavavvvvvvvvvvvvvvvvvvvvveeeeeeeeee e ee e eeeeeeeeeee dededededdededeededdedededededeedeedddemomomomommmmoomooomommomommmmommomommommmoommommmmoomommmmmmm nsnsnsnsnssnsnnsnstrtrtrtrtrtrrtrtrtrtratatatattatataatatatatedededededededededdede ““““ “““““ anananananananananananaan eeeeeeeee e exexexexxexexexexexexeexeeeeeeeemmmm-m-m-m-m-mmmmmmmmmmmmmmmmmmmmmplplplplplararararyy y y y coooocommmmmmmmmmmmmmmmmmmititiitmmememmm nttntnttn t t tttttttooooo oooo oooo susussuuuususssuuusuuusuusssusuststtsttstststststtstssststaiaaiaiaaiaiaiaiaiaiaiiaiaaaiaiainananananaanananaananananaanannnnnannaaaaaaabibbbibibibibbibbbbbbibbbbbbillilliliiiiliiililitttytytyytytyytyty.”.””.””.”.””””... -- “ “ “““ “ThThThThe e e PrPrPrPrPrininnininnnnnnnnncececeecececec tototototototottonnnn nn nn n ReReReReReReeeReReevvvvivvivivvivvvvvvvv ewew’s’s G Guiuiiiiiddededddededdedee tttttttttttt tttt ttttttoo oooooo oooooo 2828282828228882222222 666666 666 GGrGrGrGGrGrGGrGGGrGrGrGGrrGGGGGGGGGGGGGGGGGG eeeeeeeeeeeeeeeeeeee nnnnnnnnnnnnn nnnnnnn CCCoCCoCCoCCoCoColllll egegege eesssssssseessssss””””” ””””””””””””” (2((2((2((2(2((((2(2((((((((( 0101010000 00)00))0)))))0))))))

AAAAAAAAAAAAdAdAAAAdAdmimimimimimimimiimimimimiimm ssssssssssssssssssssssssssssssssssss ioioooooioioioioooioooooioionsnsnsnsnsnsnsnnnnMMiMMMMMiMMMMMMiMiMMMiMiMMMiMiiddddddddddddddddddd leleleleeeeeeeeeeeeeeee 5 5 5 50%0%0%%%%%%0%%%0%%%0 o o ooooo oooffffffff f iincncomominingg gg frfresssshmhmhmhmhmhmhmhmhmhmh eneneneneneee SSSSSSSSSSSSATATATATATAT s s sssssscococococococoocoococ rerrrereerrrrrrrreeeeeeeee::::::::: ::: 110011110010101000011010009090909090909090090909090909009990-1-1-11-1-1111-111111111252222525252525225000 0 (F(Falalaalallll l 202020200202020222011111111111111111111))))))))))))

AnAnAnnunununununuuualalalalalalal II I IIn-nn---nnnn StStStStStttStataatatattaatatatatataaatattteeeeeeee ee eeeeTuTTuTuTTTuTuTuTuTuTuTuTuTuTTTTTTuuititititttioioioioooioioioioioooiooonnnnnnnnnn nn ananaanananananannannnanandd d FeFeFeFeFeFFFeeeeeeeeeeesesese : $5$5$5$5$5$555555555555555555$5,3,3,,3,,,3,,,,, 939393333333333333939 (((( (( (( (( ((( ((((((((((202002020000202020202220222202222 11111111 1-111222)2)2)2)2)2)2)2)2))))))2)2))2)222)22222)222)

AnAnAnAAAAA nunun alalaa O OOOututututttttttttttttttttt-o--o-o--oof-f-f-f-f-StStStStStStStSttSttatatatatataata e e e eeeeTuTuTuTuTT ititititi ioioion n n aanananana d d ddd FeFeFeeeeesesesesesesseseseseeseesese : :::::::: : $1$1$1$11$1$11$1$$$$$1$$ 9,9,99,9,9,,99 0202025 5 5 (2(2(2(2(2(2(2(20101010101000 1-1-1-1-1-1-1-1-1-1-1-11---12121222222222) ) ) )))))))))

AvAAvAvAAAA ereragagggge eee ee AnAnAnAnAAAAAAAnAAA nnnuuuun alalalal HH HHHHHHououououououououooo sisisisisinngngngngnnn a aaa andnndnddndndddnndndd MMeaeal PlPlP an FFFFFFFFFFFFF Feeeeeeeeeeeeeeeeeeeeeeeees:s:ss:s:s:s:s:s:s:ss:s:s::s:s $$$$$$$$$$$$$$$$ $$ $$$$$$7,7,7,77777777,7777,77,777,7,77,7,7,,,,30303030303033030003333333 2 2 2 2222 (2(2(2(2010100111-1---121221212222222222) ) ) ) ) ))))) )))

FiFiFiFiFiFiFiFFFiFiFiFF nnanananaanananannnnannnnanancnnccccncnccccncccncnccciaiaiaiaiaaaaaaiaaii l l l l l l l ll AAiiAAiAAAAiAA d:dd:d:dd:d: MMMMMMMMMMorororororrorro e e e thtththhhhhhhhhanananannnnnananannnannan hhala f f of studentn s s rerececeivive e fi fifinaancciaal l aaaiiaaa dd,, w witth h h momommomooomomommm rereeree t tthahahahahhahahahahahahahaaaaaannnnnnn n nn n nn nnn 85858558585855858558585858585 ppp pp ppperercececececececececeeeeceeeentnnnntnnnntn o o offf f stststsstststtudududududududududududuuudeneneneneneneneene tststststststss’ ’’’’’fifififi fi fi finananananannnncnnnn iaaaall lllll llll neneneneneneneneeedededddeddd mmmm m m mmmmmeeetetetetetetee ...

Dr. Anne Ponder became the sixth Chancellor of the University of North Caro-lina Asheville in October 2005.

Chancellor Ponder is a native of Asheville and a lifelong educator. She earned her bachelor’s, master’s and doctoral degrees in English from the University of North Carolina-Chapel Hill. She began her academic career at Elon College (now Elon University) in North Carolina, where she was the fi rst woman and fi rst pre-tenure professor to receive the Daniels-Danieley Award for Excellence in Teaching. During her nine years at Elon, she taught English and communications, and founded the college’s Honors Program.

She later joined Guilford College in North Carolina, where she was an associate professor of English and interdisciplinary studies and served as associate academic dean. At Kenyon College in Ohio, she served as professor of English and drama, academic dean, adding ‘vice president for information technology’ to her portfolio.

In 1995, she was selected to become president at Colby-Sawyer College, a private liberal arts college in New London, N.H., where she would serve for ten years.

At UNC Asheville, Chancellor Ponder has led a campuswide collaboration resulting in a fi ve-year Strategic Plan and then imple-mented an administrative reorganization that focuses University resources on the Strategic Plan’s highest priorities. As part of that strategy, the UNC Asheville campus now serves as the new na-tional headquarters for the Council of Public Liberal Arts Col-leges.

Chancellor Ponder is a nationally known expert on institu-tional effectiveness, strategic planning, and fundraising and re-source development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education, and has writ-ten a chapter on strategic planning for the book “Leading Ameri-ca’s Branch Campuses,” edited by Samuel Schuman and published by the American Council on Education.

In addition to serving the University, Chancellor Ponder is a member of the Mission Hospitals Audit Committee and the Asheville Area Chamber of Commerce Board of Directors. She also serves as a member of the Asheville Community and Eco-nomic Development Alliance.

Chancellor Ponder is the daughter of the late Herschel and Eleanor Ponder, both of whom traced their Asheville family roots back to the 1780s. She is married to Christopher Brookhouse, an award-winning writer and publisher previously on the English faculty at UNC Chapel Hill.

Dr. Anne PonderChancellor

University of North Carolina Asheville

Janet R. ConeDirector of AthleticsSenior Administrator for University Enterprises

Janet R. Cone is in her eighth year as Director of Athletics at UNC Asheville. She also serves as the school as Senior Administrator for University Enterprises. Last year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Two years ago, Chancellor Anne Ponder appointed Cone to the newly-created position of Senior Administrator for University Enterprises. In this position, Cone oversees the Wilma Sherrill Center, manage specifi c community relationships and serve as a member of UNC Asheville’s fundraising team. She continues as a member of the Chancellor’s Senior Staff and assists Chancellor Ponder in more closely aligning the university with the North Carolina Center for Creative Retirement.

In 2009, Cone created the Asheville Sports Commission to help bring athletic events to the Asheville area. Her leadership helped land the Southern Conference

men’s and women’s basketball tournament to return to Asheville starting in 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club that recognizes all student-athletes who make a 3.0 or better grade point average each semester. More than 700 student-athletes have made the club during Cone’s six years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 600 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes have earned this impressive academic distinction. The Department of Athletics has also successfully hosted two Big South Conference Tournaments that produced revenue for the school.

Cone has overseen construction projects that has dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center for Health and Wellness/Kimmel Arena was fi nished last spring and is being used this semester. Funded partly through a $35 million state appropriation, Cone helped raise more than seven million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation on campus, attract major venue speakers and performances, and will secure a future home for men’s and women’s basketball teams.

The inaugural game in Kimmel Arena will be against UNC Chapel Hill on Nov. 13 and that game will be nationally televised by ESPNU. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that was completed n the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past two seasons and this spring will host the Big South Conference men’s and women’s tennis tournaments for the fi rst time in school history.

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends.

In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. UNC Asheville Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi ts from each and every day.”

In 2006-07, three different teams UNC Asheville teams won Big South Conference championships and advance to the NCAA Tournament. In May of 2006, the Bulldog baseball team completed an amazing run with their fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against top-seed UNC Chapel Hill in the College Cup. In March of 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics web-site, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the Budget, Compliance, Ad Hoc Committee on Publicity and Promotions and the Baseball, Men’s and Women’s Basketball and Men’s Soccer Committees. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. Starting in September, she will begin a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, South Carolina. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame last fall. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS OF EXTERNAL AFFAIRS

Mike Gore is in his 26th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

SUPPORT STAFF

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS / SENIOR WOMEN’S ADMINISTRATOR

Terri Brne begins her sixth year at UNC Asheville. She serves as Associate Athletics Director of Internal Affairs and is also the athletic department’s Director of Compliance and Sport Oversight. Brne came to UNC Asheville in the fall of 2006. She is responsible for the interpretation of rules by the NCAA and Big South Conference. Brne is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. In addition, Brne is the administrator for men’s and women’s soccer and baseball. She also serves as the Game Administrator for women’s basketball. The Illinois native was an assistant basketball coach at both South Dakota State and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance in NCAA Compliance. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her Master’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

Judith BohanBusiness Manager

Pat Bryant Director of

Development

Megan HammondsAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Mary CaseyAssistant Women’s

Soccer Coach

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

SUPPORT STAFF

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Sherrill

Center

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Nick McDevittAssistant Men’s

Basketball Coach

Donna PeekAdministrative

Assistant

Michele DemkoWomen’s Soccer

2nd year as head coach

Matt KernMen’s Soccer

2nd year as head coach

Tom SmithBaseball

3rd year as head coach

Jesse NormanCross Country/Track

5th year as head coach

Brenda Mock KirkpatrickWomen’s Basketball

1st year as head coach

Lise GregoryTennis

5th year as head coach

Eddie BiedenbachMen’s Basketball

16th Year as head coach

Frederico SantosVolleyball

1st year as head coach

HEAD COACHES

Elizabeth LykinsWomen’s Swimming

1st year as head coach

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

THE B.A.A.