50

2012 UNC Asheville Volleyball Media Guide

Embed Size (px)

DESCRIPTION

2012 UNC Asheville Volleyball Media Guide

Citation preview

Page 1: 2012 UNC Asheville Volleyball Media Guide
Page 2: 2012 UNC Asheville Volleyball Media Guide
Page 3: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

1/// F E A R T H E D O G ///

General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3

Season PreviewOutlook ................................................................................................................................. 4-5

PlayersMeredith Foster ........................................................................................................................6Holly Shelton .............................................................................................................................7Anna Moore ..............................................................................................................................8Jaimie Dorfman .........................................................................................................................9Rachel Wells ............................................................................................................................10Lisa Riggsbee ...........................................................................................................................11Alex Stewart ...........................................................................................................................12Chelsie Kenley ........................................................................................................................13Newcomers ......................................................................................................................14-16

Coaching Staff Head Coach Frederico Santos ............................................................................................17Assistant Coach Lydee Benoit ............................................................................................18

Records Section2011 Season Stats .................................................................................................................202011 Big South Final Standings ..........................................................................................21 Big South Tournament History ..........................................................................................22Season Records ......................................................................................................................23Career Records ................................................................................................................24-25Year-by-Year Results ........................................................................................................26-28All-Time Results .....................................................................................................................29UNC Asheville Hall of Fame ................................................................................................30All-Time Letterwinners ........................................................................................................31The Big South Conference .............................................................................................32-33

UNC AshevilleThe University of North Carolina Asheville .............................................................34-37Dr. Anne Ponder, Chancellor ...............................................................................................38Janet R. ConeDirector of Athletics/Senior Administrator for University Enterprises .............39-40Support Staff ....................................................................................................................41-42Head Coaches .......................................................................................................................43Rocky .......................................................................................................................................44NCAA .....................................................................................................................................45The Bulldog Athletics Association .....................................................................................46

Bulldog Coaching Staff Head Coach..................................................... Frederico Santos

.................................................................. (UNC Asheville, 2007)

Overall/years .................................................61-45/Three years

at Asheville ......................................................... 15-14/One year

Assistant Coach ..................................................... Lydee Benoit

................................................................................. (Eckerd, 2011)

2011 Team Information2011 Record .........................................................................15-14

2011 Big South Record/Finish ....................................... 7-7/4th

Starters Returning/Lost ........................................................ 5/2

Letterwinners Returning/Lost ...............................................8/2

Volleyball Support Staff Athletic Trainer ................................................ Eric Linnell, ATC

Athletics Communication ..................................Matt Pellegrin

Justice CenterCapacity ................................................................................. 1,100

Press Box Phone ............................................... (828) 513-6203

Message To MediaThis edition of the 2012 UNC Asheville Volleyball media

guide has been prepared for you as you cover the Bulldogs

during the season. For additional information, photographs,

interviews with players and coaches, please contact Matt

Pellegrin or Mike Gore in the Athletics Communication

Offi ce.

CreditsDesigner:

Matt Pellegrin

Editor

Mike Gore

Photographers:

Brett Whitsell, Blake Madden, Todd Drexler

UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.

UNC ASHEVILLE MISSION STATEMENT

Page 4: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

2 /// F E A R T H E D O G ///

Athletics Media Communications

Mike Gore Associate Athletics Director for

External AffairsOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387

Email: [email protected]

Matt PellegrinDirector of Athletics Media

Communication / Volleyball ContactOffi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: [email protected]

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.

Broadcasts: There are no phone lines at the Greenwood Field for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.

Photographers: Photo passes are limited to working press photographers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.

Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home soccer match. After the match, each media member will receive a box score of the match.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the women’s soccer coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Video Streaming: UNC Asheville will once again video stream all of its home soccer matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or more information video of matches please contact Matt Pellegrin

MEDIA INFORMATION

Page 5: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

3/// F E A R T H E D O G ///

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Greenwood Field (300)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

Page 6: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

4 /// F E A R T H E D O G ///

Despite only nine healthy players and a new head coach hired six weeks before practice started, the UNC Asheville volleyball team enjoyed another winning season in 2011.

The Bulldogs fi nished with a 15-14 overall record and in fourth place in the Big South Conference. Asheville advanced to the semi-fi nals of the league tournament for the sixth time in the last seven years. The Bulldogs under the direction of fi rst-year coach Frederico Santos, accomplished a great deal in 2011 but want to do more in 2012.

“I really thought we had a successful year last season,” declared Santos. “It is never easy when a new coach comes into the program but overall we achieved a great deal.

“Now, our goals are to achieve even more in the future start-ing with this season,” added Santos. “You always want to accomplish more than you did the previous season.”

Asheville returns much of its line-up from last season and only graduated two seniors. However, both seniors were starters and a key to much of what the Bulldogs accomplished last season. Setter Hallie Morse led the Asheville offense and fi nished with 1000 assists. Outside hitter Cindi Miller was a fi rst- team All-Conference selec-tion and one of the best ever to wear the Blue & White.

The Bulldogs had just 10 players last season so Santos has brought in six new players to the Asheville program. The newcomers are talented and could make an impact right away. The second-year coach is preaching patience.

“We are a much deeper team this year than last season,” admit-ted Santos. “However, we’re a much more inexperienced team than we were a year ago.

“The big key for us this season is our chemistry,” Santos also said. “How will our new players mesh with our returnees? I feel really good about the recruiting class, and I like the newcomers we have coming back, as well. But it’s a process putting our returnees together with our new players. How well we do that this year will determine how far we go.”

Asheville returns two seniors in Chelsie Kenley and Holly Shel-ton. Kenley is one of the Bulldogs’ tallest players at 6-2 and has steadily improved her game during her career. She plays the right side for Asheville.

“We were pleased with the job Chelsie did on the right side a year ago,” commented Santos. “She gained valuable experience and will be one of our leaders this season.”

Shelton moved from the middle to an outside hitter position in 2011 and did a great job. She was third on the club in kills (2.42) and blocks (0.42).

“Holly had to move to the outside last season and really played well there,” explained Santos. “She enjoyed a fabulous spring and looks like she’s ready to have a big senior year.”

Heading up the junior class is middle blocker Meredith Foster. The Hendersonville native came on strong at the end of last season and earned a spot on the Big South’s All-Tournament team for her play. She led Asheville in hitting percentage (.314) and was second in blocks (0.70).

“Meredith found her game at the end of last year and really grew as a player,” admitted Santos. “She is a dominant performer in the middle and there’s no limit to her potential.”

Junior Anna Moore transferred to UNC Asheville last year from N.C. State. She began the year on the right side before being moved to the middle. Things worked out pretty well for Moore as she was named Big South Player of the Week late in the season and was a second- team All-Conference selection. Moore fi nished the year as the Bulldogs’ second leading hitter with 2.57 kills.

“Anna’s game began to take off when she moved to the middle,” commented Santos. “I’m looking for continued growth from her this season. She still needs some more playing experience but has the potential to be an All-Conference player for our program.”

Alex Stewart has been Asheville’s starting libero the past two seasons and been among the Big South’s dig leaders during that time. She topped the Bulldogs in that category (4.35) in 2011.

“We like the job Alex did last season as our libero,” said Santos. “We expect her to be even better this year. Alex learned a different philosophy of defense last season but handled it well.”

Year Two Of The Santos Era

Chelsie Kenley

Page 7: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

5/// F E A R T H E D O G ///

Junior Rachel Wells was the Bulldogs’ most versatile player in 2011. She played in the back row and was a defensive specialist. Wells sparked Asheville with her defense and serving. With injuries to the Bulldogs, she jumped in and played on the outside and right side.

“Rachel did a good job in all the positions she played last sea-son,” stated Santos. “She was ready for any challenge. Rachel is a hard worker who just fi nds a way to be on the court.”

Jamie Dorfman was a pleasant surprise for Asheville in 2011. She earned a spot in the back row and became one of the Big South’s best servers. Dorfman led the Bulldogs and was third in the Big South in service aces at 0.36. However, she could have a new role in 2012.

“Jamie was great as a server last year and got us a lot of points with her serving,” explained Santos. “Her role this season may be a little different as we’ll want her to focus on being a setter. She has the skills to be our setter.

Sophomore Lisa Riggsbee didn’t play much as a freshman. She’ll provide depth as a setter and in the back row.

“Lisa made progress in the spring and works hard,” stated San-tos. “She’ll potentially see some playing time this year in the back row and as a serving specialist.”

The Bulldogs have added six freshmen to the roster and all have the potential to play right away for the Blue & White.

Start with versatile rookie Katie Davis, who can play both as an outside hitter and a setter.

“Katie understands the game quite well and is a phenomenal player for us to have in our program,” admitted Santos. “She is very good at both hitting and setting and she’ll do both for us this sea-son.”

Bryn Pfeiffer is a libero from Raleigh who should battle for play-ing time right away.

“Bryn is an excellent defensive player who will challenge for playing time on the court,” said Santos. “She’s a hard worker who we’re looking forward to watching play this season.”

Santos has brought in two freshmen from Florida who could make an impact as rookies. They are 6-2 right side Catherine Fischer and 5-11 outside hitter Christine Lakatos. Fischer is from Miami, while Lakatos hails from Lauderhill.

“When I was coaching at Barry (Miami), I fi rst saw Catherine Fischer play and was very impressed,” declared Santos. “She’s a lefty who plays on the right side. We believe Catherine has a tremendous amount of potential. She’s also played as a setter and could possibly do that this year in our program.

“Christine provides us with a lot of depth on the outside,” ex-plained Santos. “She is a solid all-around player who can pass, hit, play defense and block. Christine will work hard to be o the fl oor this year.”

Santos has two local players as a part of Asheville’s freshman class. They are 6-1 right side Emily Bare and 5-11 outside hitter Jenny Sims. Bare played at Roberson HS, while Sims excelled at Carolina Day.

“Emily gives us depth on the right side,” stated Santos. “She’s a versatile player who is physically very gifted.

“Jenny gives us depth in the middle and is also a good all-around player,” added Santos. “She’s a hard worker and is always ready to play.”

Santos believes his 2012 team has potential, but there are some questions that need to be answered.

“First and foremost, we have to establish who our setter will be,” said Santos. “We have some options and could even go with a 6-2 attack if we need to, but we have to fi gure out what to do there.

“We also need to fi gure who are outsides are going to be,” added Santos.

“As I said earlier, we’ve got to have good chemistry and fi nd our best combination to win on the fl oor. That may take a few matches, but I think once we get there we have the potential to have a good team.”

Holly Shelton

Page 8: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

6 /// F E A R T H E D O G ///

MEREDITH FOSTERMB • 6-0 • JR • HENDERSONVILLE, N.C.

Overview: Junior blocker from Hendersonville who came on strong at the end of last season and should push for All-Conference and All-Region honors in 2012...named to Big South All-Tournament team...two-sport athlete at UNC Asheville as she is a high jumper on the Bulldogs’ track and fi eld team. 2011: Enjoyed an excellent season and led Bulldogs in hit-ting percentage (.314)...fourth on team in kills (2.24 per set)...second in blocks at (0.70)...only player on UNC Asheville to have more than 20 kills in one match when she recorded 24 and hit. 460 in late-season match vs. Liberty (11-12)...registered 15 kills and hit .650 during Big South Tournament match vs. Campbell (11-17)...fi nished the sea-son vs. Liberty in semifi nals of tournament with 11 kills and hit .429 (11-18)...earned spot on Comfort Suites Invita-tional All-Tournament team at Chattanooga as she posted 14 kills vs. Chattanooga, plus nine kills and six blocks vs. Tennessee Tech (9-9-10)...had 12 kills with three blocks vs. Winthrop (10-8) and knocked down 14 kills later in the season against the Eagles (11-4)...had nine kills with no er-rors vs. Western Carolina (10-4)...registered six blocks dur-ing home victory over Presbyterian College (10-7)...posted 16 kills with three blocks vs. Gardner-Webb (9-3). 2010: Second on team in blocks with 0.88 per game aver-age...led Bulldogs in total blocks with 79...fourth on club in kills (1.24) and attack percentage (.229)...posted career-best 10 blocks with eight kills in road victory at Radford (10-1)...registered 11 kills in 21 swings in home victory over eventual Big South champion High Point (10-29)...had seven blocks in road win at Western Carolina (9-18)...gar-nered three service aces at Mercer (9-28).

Before UNC Asheville: Helped lead West Henderson program to 106-4 overall record during her career...led team in blocks all four of her years playing...earned all-conference honors as sophomore, junior and senior...made the All-Region team her fi nal three years at West...played for legendary coach Jan Stanley...helped Falcons win state championship as a junior and advance to state title game as a freshman and senior...helped lead club team to third-place fi nish in AAU tournament at Orlando...was the state high jump champion her junior year...was the regional champion in the long jump as a sophomore and junior.

1

Page 9: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

7/// F E A R T H E D O G ///

HOLLY SHELTONMB • 6-0 • SR • BREVARD, N.C.

Overview: Senior middle blocker who should be ready to have a great fi nal season...excellent skills for a front row player...one of two seniors on roster.

2011: Third on team in kills (2.42 per set) and in blocks (0.81)...had a career-high 17 kills in two different matches, fi rst in opening-night victory over Troy (8-26) and second in near upset over Liberty (11-12) late in the season...had 15 kills and career-high 12 digs vs. Winthrop (10-8)...knocked down 13 kills in home win over Campbell (10-28)...posted 10 kills, hit .300 and had three blocks vs. Gardner-Webb (9-3)...14 kills at Western Carolina (9-13)...season-high fi ve blocks during home win over Presbyterian College (10-7)...had 12 kills in early-season win over then unbeaten Elon (9-2).

2010: Led Bulldogs in blocks with 0.90 per set average...third on team in kills (1.29)...posted career-high of 11 kills in road victory at Charleston Southern (10-8)...had 10 kills vs. Liberty (10-16) and Winthrop (11-5)...registered nine kills and three blocks in key road win at South Alabama (9-3)...had seven blocks during home win over Charleston Southern (11-6) and at Winthrop (10-9)...helped lead Bull-dogs to come-from-behind win over Radford (10-30) with eight kills and fi ve blocks.

2009: Averaged close to one kill per set (0.99)...second on team in blocks with 60 and 0.57 per set average...top hitting match came in her collegiate debut against UNC Wilmington (8-28) when she had a season-high 10 kills and hit .571 for the match...posted nine kills in come-from-behind triumph over The Citadel (8-29)...named registered seven kills in back-to-back league wins at Radford (9-25) and Charleston Southern (10-2)...had eight blocks in home win over Gardner-Webb (9-22)...had four blocks in fi ve dif-ferent matches...was named Big South Rookie of the Week after fi rst four matches of the season.

Before UNC Asheville: Earned all-conference honors for three consecutive years at Brevard HS...made the Hen-dersonville Times-News All-Region team following senior year...averaged 14 kills and 12 digs per match for Blue Dev-il program...fi nished senior season with 337 kills and 73 blocks...led Brevard to 17-7 overall record and berth in the 2-A state playoffs...played for Biltmore Volleyball Academy.

3

Page 10: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

8 /// F E A R T H E D O G ///

ANNA MOOREMB • 6-1 • JR • RALEIGH, N.C.

Overview: Transfer from N.C. State who made an imme-diate impact for the Bulldogs last season...earned second team Big South All-Conference honors...should be one of the top returning players in the Big South this season. 2011: Second on team in kills (2.57 per set) and in hitting percentage (.236)...led Asheville in blocks (86) with 0.81 per set average and that was 10th in the Big South...named Big South Player of the Week on Oct 24 as she posted 26 kills in road victories at Coastal Carolina (10-21) and Charles-ton Southern (10-22)...registered career-high 18 kills and four blocks at Winthrop (11-4)...had 15 kills vs. Troy (8-26) and Radford (11-11)...season-high 11 blocks during home victory over Presbyterian College (10-7)...season high of 14 digs came vs. Troy (8-26)...second double-double came vs. Winthrop (10-8) with 11 kills and 10 digs...had 13 kills and hit .370 in Big South Tournament victory vs. Campbell (11-17)...posted 14 kills and hit .429 in key road win at Rad-ford (10-1)...season-best three service aces came in home win vs. High Point (10-29). N.C. State: Played in 17 matches and 60 sets...recorded 104 kills and 30 blocks during the year. Enloe HS: Played at Enloe High School under coach Bran-den Green ... recorded 236 kills senior year and earned 23 service aces during her senior campaign ... helped lead Enloe to a NCHSAA 4A playoff third round appearence for the fi rst time in program history in 2009... received fi rst-team all-district honors in 2009 ... won conference championship in 2007 and 2008 ... earned all-conference honors all four years ... named 2008 Cap 7 Player of the Year ... honored as team captain for two years ... Academic all-conference all four years ... also lettered two years in basketball.

4

Page 11: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

9/// F E A R T H E D O G ///

JAIMIE DORFMANS • 5-8 • JR • DURHAM, N.C.

Overview: Did a nice job for the Bulldogs in the back and was one of the top servers in the Big South last season.

2011: Led Asheville with 36 service aces and her 0.36 per set average was second in the Big South Conference...sec-ond on team in assists with 61...fi fth on club in digs with 1.51 mark...career-high fi ve service aces came vs. Gardner-Webb (9-3) and helped Bulldogs win fi ve-set match...posted four aces at Presbyterian College (11-5)...had three in two different matches...career-high of 14 digs in fi ve-set match vs. Liberty (11-12)...career-best 11 assists at North Caro-lina Central (9-20)...posted nine digs vs. Winthrop (10-8).

2010: Played in seven matches and eight sets...earned two assists in victory over Southeastern La. (9-3)...had three digs in win over Alabama State (9-4).

Before UNC Asheville: All-Conference setter at C.E. Jor-dan both as a junior and senior...named team MVP following her senior campaign...named to Carolina Region 17 Plati-num All-Tournament team...was selected to the Carolina Region High Performance team.

8

Page 12: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

10 /// F E A R T H E D O G ///

RACHEL WELLSDS • 5-7 • JR • STATESVILLE, N.C.

Overview: Versatile athlete who played just about every-where on the court last season due to injuries and did a great job...excellent defensive player who plays well in the back row.

2011: Third on team in digs with 265 (2.50 per set)...sec-ond on club in service aces with 28...played outside hit-ter due to injuries vs. Winthrop (10-8) and delivered solid performance with six kills...had career-best six service aces with 19 digs in home win over Presbyterian College (10-7)...career-best 20 digs came vs. Liberty (11-12)...posted 18 digs and four aces in road win at Coastal Carolina (10-21)...had 13 digs and three aces in fi rst match of the year vs. Troy (8-26)...registered at least 10 kills in 12 different matches.

2010: Second on team in service aces with 26 and 0.23 per set average...fourth on club in digs with a 2.56 mark...posted double-fi gure digs in 13 different matches...career-best 21 digs came in home victory over Big South cham-pion High Point (10-29)...had 20 digs at Winthrop (10-9)...had season-high three services aces in home win against Coastal Carolina (9-24)...had 15 digs during home victory vs. Winthrop.

Before UNC Asheville: Part of a great program at North Iredell...led school to unbeaten season and 3-A state cham-pionship as a junior...senior season was honored as the County Player of the Year, Conference Player of the Year and Piedmont Player of the Year...also named team MVP...named fi rst team All-Conference and All-County following junior year...played club for IC Stars.

9

Page 13: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

11/// F E A R T H E D O G ///

LISA RIGGSBEES • 5-8 • SO • CLEMMONS, N.C.

Overview: Reserve setter who works hard and provide depth in the back for the Bulldogs...enjoyed an excellent high school career at West Forsyth in Winston-Salem.

2011: Played in one match against Presbyterian College (10-7).

Before UNC Asheville: Was named the West Forsyth Ath-lete of the Year as a senior...earned All-Conference honors as a junior and senior...named to All-County team following senior season...served as team captain senior year and was also selected as team MVP...excellent athlete who also let-tered in basketball, softball and track and fi eld.

10

Page 14: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

12 /// F E A R T H E D O G ///

ALEX STEWARTL • 5-6 • JR • HENDERSONVILLE, N.C.

Overview: Junior libero who has enjoyed two great years for the Bulldogs...was one of two signees from prep pow-er West Henderson HS in nearby Hendersonville as she’s joined by former Falcon teammate Meredith Foster...en-joyed a fantastic prep career at West Henderson and club career at Biltmore Academy. 2011: Third in the Big South and led team in digs with 413 (4.35 per set)...fi fth on team in service aces with 14...missed three matches in middle of season with injury...was in double fi gures in digs in 22 of 26 matches played...had season-high 32 digs during victory at Chattanooga (9-10)...posted six matches with at least 20 digs...registered 26 digs at Western Carolina (9-13)...accumulated 25 digs in open-ing night victory over Troy (8-26)...had career-best three service aces at Presbyterian College (11-5)...posted at least 13 digs in 14 of the last 15 matches of the season...named Big South Defensive Player of the Week on Sept. 12. 2010: Led Bulldogs in digs with 4.33 average...was in dou-ble fi gures in digs in 28 matches...posted a career-high 40 digs during home victory vs. Radford (10-30)...had 26 digs in three different matches...was named Defensive Player of the Week on Nov. 1...had at least 20 digs in eight different contests...selected to Big South All-Freshman team. Before UNC Asheville: Four-year starter for legendary coach Jan Stanley at West Henderson...earned all-confer-ence honors as a freshman, junior and senior...Falcon pro-gram went 106-4 during her career...named to All-Region team as a junior and senior...helped lead school to state title as a junior and runner-up in freshman and senior sea-sons.

13

Page 15: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

13/// F E A R T H E D O G ///

CHELSIE KENLEY RS • 6-2 • SR • CHRISTIANSBURG, VA

Overview: Senior middle blocker from Virginia who will be tallest player on this year’s team...could play in the mid-dle or on the right side...very good student who made Big South Presidential Honor Roll three times and six times earned a spot on Athletic Director’s 3.0 & Above Club.

2011: Tied for third on team in blocks (0.40 per set)...post-ed 52 kills (0.52) and hit .095...career-best 39 digs...had six blocks in home win over Presbyterian College (10-7)...col-lected fi ve kills in key road victory at Radford (10-10) and then had season-best six vs. Winthrop (10-8)...posted fi ve blocks at PC (11-5) and vs. Radford (11-11)...had four kills in seven attempts in early-season win vs. Elon (9-2).

2010: Appeared in 11 matches and averaged 1.26 kills per set...season high of nine kills came in home victory over Mercer (10-26)...also hit .571 in Mercer match...had seven kills and hit .333 during win over Alabama State (9-4)...posted three kills in win over North Carolina A&T (9-18). 2009: Played in 16 matches and 50 sets...gave the Bulldogs a lift off the bench with her play...posted a career-best 12 kills in comeback win over The Citadel (9-29)...helped Asheville beat Big East foe Providence (9-19) with eight kills and two block solos...contributed eight kills and two more blocks in key early-season road win at Radford (9-25)...contributed nine kills in victory over Winston-Salem State (9-18)...fi n-ished the season with 78 kills (1.56) and 15 blocks (0.30).

Before UNC Asheville: Enjoyed a standout prep career at Auburn HS in Riner, Va....senior year posted 126 block solos...four-year starter...helped lead Auburn to a district and regional championship as a senior...helped school set a school record with 24 wins and a berth in the semifi -nals of the state playoffs...was named as District Player of the Year and fi rst team all-state...also earned Virginia High School League Group A State Female Athlete of the Year...

named an Auburn HS Scholar Athlete...holds school record for most kills in a match with 31...set eight different school records at Auburn, including the all-time leader in career blocks with 237...second in career kills with 1,069...lettered in basketball and was a second-team all-region performer as a sophomore and junior...was a fi rst team all-region per-former as a senior...all-district for three straight years...be-came second basketball player in Auburn history to score 1,000 career points.

14

Page 16: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

14 /// F E A R T H E D O G ///

JENNY SIMSOH • 5-11 • FR • ASHEVILLE, N.C.

Overview: Local product from Carolina Day who also played for Biltmore Volleyball Academy.

Before UNC Asheville: All-Conference at Carolina Day as a junior and senior...earned NCISAA All-State honors senior season...helped lead team to berth in state playoff senior year and 12-6 overall record.

2

KATIE DAVISS • 6-0 • FR • MYRTLE BEACH, S.C.

Overview: Freshman outside hitter from Myrtle Beach who should make a push for playing time in 2012...father Jody Davis used to coach women’s tennis at Coastal Caro-lina.

Before UNC Asheville: Enjoyed an excellent prep career at Carolina Forest HS...led school to Class 4A Region 6 Championships in 2009, 2010 and 2011...fi nished her ca-reer as the school’s all-time leader in assists (1,080) and second in total kills (558)...named to All-State team in 2009, 2010, 2011...selected to All-Region squad 2008, 2009, 2010, 2011....played club volleyball for Grand Strand Juniors and was picked as a USVA High Performance selection of A-3 program...named Toast of the Coast in 2009 and 2010...earned Best of the Beach All-Tournament team in 2009, 2010, 2011 and Palmetto Regional All Tournament squad in 2010 and 2011.

5

Page 17: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

15/// F E A R T H E D O G ///

BRYN PFEIFFERL • 5-7 • FR • RALEIGH, N.C.

Overview: Freshman libero from Raleigh who played at Wakefi eld HS...should battle for playing time as a rookie.

Before UNC Asheville: Helped lead Wakefi eld to 24-2 re-cord as a senior and was named Honorable Mention All-Conference...led team in digs as a junior and senior...played club volleyball for N.C. Elite 18 Black.

6

EMILY BARERS • 6-1 • FR • ASHEVILLE, N.C.

Overview: One of six freshmen on this year’s roster...will provide depth on the right side...local product from Rob-erson.

Before UNC Asheville: All-Conference at Roberson se-nior year...also played for Biltmore Volleyball Academy.

7

Page 18: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

16 /// F E A R T H E D O G ///

CHRISTINE LAKATOSOH • 5-11 • FR • LAUDERHILL, FL

Overview: Freshman outside hitter from Florida who will compete for playing time in her rookie season.

Before UNC Asheville: Attended Calvary Christian Acad-emy in Lauderhill, Fla....three-year letter-winner...named team MVP as a junior and senior...named to All-County ju-nior and senior seasons and was Honorable Mention as a sophomore...captain of team junior and senior seasons...helped lead CCA to conference championship as a senior...played club for Tribe Volleyball.

11

CATHERINE FISCHERRS • 6-2 • FR • MIAMI, FL

Overview: Talented right side hitter from Miami who would provide an immediate impact for the Bulldogs as a freshman.

Before UNC Asheville: Attended Miami Palmetto HS and played club for South Florida Volleyball...three-year letter-winner at Palmetto where she earned fi rst team All Dade County honors as a junior and senior...named Player of the Week by the Miami Herald twice in her senior season and once as a junior...helped lead team to Final Four in the state as a senior, three conference championships and four district titles...was captain of club teams for four straight years.

15

Page 19: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

17/// F E A R T H E D O G ///

FREDERICO SANTOSHEAD COACH • SECOND SEASON • UNC ASHEVILLE, 2007

Frederico Santos begins his second year as head coach of the UNC Asheville volleyball program. The former Bulldog assistant came back home last June after serving as head coach at Barry University in Miami for three seasons.

Santos quickly showed that the winning tradition of UNC Asheville volleyball would continue under his guidance.

In 2011, despite only having 10 players and being picked to fi nish in seventh place in the Big South Preseason poll, the Bulldogs fi nished 15-14 overall and fourth place in the league. Asheville advanced to the semifi nals of the conference tournament and fi nished runner-up in two in-season tournaments.

“We are delighted to welcome Frederico Santos back to UNC Asheville as our next Head Women’s Volleyball Coach,” stated UNC Asheville Director of Athletics Janet Cone upon his hiring. “As our former assistant then associate head coach, he was a vital member of our staff and contributed signifi cantly to our success on the court, in the classroom, and in the community. While at Barry University, he has proven himself as a head coach. He gained valuable experience and is ready to be our program’s next leader.”

“I am absolutely thrilled with the opportunity to lead the UNC Asheville volleyball program,” stated Santos. “What an honor it is for me to be able to work at my Alma Mater. My wife Nathalie, my son Gabriel, my daughter Tatiana, and I are very excited to come back to the mountains of North Carolina, where we call home.

“I look forward to the challenge of Big South Conference Vol-leyball and hope to continue UNC Asheville’s tradition of excellence on the court and in the classroom,” Santos added.

“Finally, a personal thanks to my wife Nathalie for her love and support as well as to my father, Frederico Marcondes dos Santos, for his mentoring, encouragement, love and teaching,” declared Santos.

In three seasons as head coach at Barry, Santos led the Buc-caneers to a 46-31 overall record and an appearance in the NCAA Division II South Regional Tournament in 2010.

In 2010, Santos led Barry to a solid year as the Buccaneers posted a 16-7 overall record and an 11-5 mark in Sunshine State Conference. The Bucs picked up important wins over #22 Saint Leo and #25 Rol-lins in the regular season. Propelled by their conference play, the Bucs returned to the NCAA South Regional Tournament for the fi rst time since 2006. Julia Teixeira earned Sunshine State Conference player of

the Year, Daktronics South Region Player of the Year and First-Team All-America recognition by Daktronics and the AVCA. In 2009, the Bucs posted a 15-12 overall mark and went 6-10 in conference. In 2008, Santos’ fi rst season, the Bucs went 15-12, an improvement over 2007. The Bucs improved their conference record as well, going 5-11 for the season.

A native of Brazil, Santos has more than 20 years of international playing and coaching experience at all levels of the sport. He spent eight seasons at UNC Asheville, including the last three as associate head coach under former head coach Julie Torbett. Santos assisted in all phases of the Bulldog program including recruiting, on-court coaching, travel and pre-game setup. While at Asheville, Santos helped the Bulldogs to a 135-124 overall record. The Bulldogs reached the Big South Conference Championship match three times during his tenure and won the regular- season championship in 2002. The 2002 team was the most improved team in the country that season as Asheville fi nished with a 26-8 record.

Santos coached the Biltmore Juniors for more than fi ve years, leading the club to national fi nishes in each of the past fi ve years, including championships at the Asheville Hi Neighbor tournament in 2003 and 2004.

Santos has been playing volleyball all his life beginning with club teams in Rio de Janeiro. He moved to Reno, Nev. in 1990 and starred for the University of Nevada-Reno club team from 1992-1996 where he was a setter. His club team was ranked fi fth nationally by USA To-day. In 1998, Santos played for the Reno Volleyball Club team as both a setter and outside hitter, leading the club to the USAV Nationals in Tucson, Ariz.

His coaching experience includes stops in Brazil, Iceland, Poland, Switzerland and Reno. Santos coached the Stjarnan Club team in Reykjavik, Iceland. He led the club to a 7-3 record in 2000 and a fi rst place fi nish in the fall tournament. The team also fi nished runner-up in the Icelandic Cup and Icelandic Championships.

Santos has also worked with the men’s and women’s Brazilian national teams, which are among the best in the world. He earned his degree in the spring of 2007 from UNC Asheville.

Santos is married to the former Nathalie Steffen. Nathalie played volleyball for the Bulldogs from 1993 through 1996 and is a 1997 graduate of UNC Asheville. Nathalie’s sister Elissa also played for the Bulldogs and is a member of the school’s Hall of Fame.

Page 20: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

18 /// F E A R T H E D O G ///

LYDEE BENOITFIRST SEASON • ECKERD, 2011

Former Eckerd All-American Lydee Benoit is in her fi rst year as an assistant coach with the UNC Asheville vol-leyball program. She was hired by head coach Frederico Santos in the spring.

Benoit comes to Asheville after serving as an assistant coach at Valdosta State last season. She enjoyed a tremen-dous career at Eckerd College in St. Petersburg, Fla.

“We are delighted to bring Lydee into our program,” declared Santos. “She will bring a lot of enthusiasm and en-ergy to our team this season. Lydee was a great player who I got a chance to watch fi rst-hand when I was at Barry University and coached against her. She was a tremendous player who always made her team better.”

Benoit did an outstanding job in her fi rst coaching stop at Valdosta. She helped lead the Blazers to the best season in Head Coach Sia Poyer’s tenure with a 21-11 record and 7-3 record in the All-Gulf South Conference. Four players earned All-Conference honors as VSU went 9-2 on the road and 4-1 in fi ve-set matches.

While at Eckerd, Benoit starred for the Triton volleyball team, earning a number of awards in four seasons at EC. She was an All-American, a team captain and a three-time team most valuable player. From the outside hitter position, Benoit set the record for career kills at Eckerd.

As a player, she made an immediate impact in the Sun-shine State Conference when she was named Sunshine State Conference Freshman of the Year. Benoit continued her success throughout her collegiate career, earning all-conference honors all four seasons.

During her playing days, Benoit not only made time for class (four-time athletic director’s honor roll honoree), but also coaching. As a student, she served as a camp counselor for multiple volleyball camps as well as a student assistant on the Eckerd coaching staff. Benoit also worked as the head coach for the St. Pete Hurricanes, a club team for 15 year-olds. Benoit attended Suncoast High School in Riviera Beach, Fla. where she lettered in varsity volleyball for four seasons. She helped lead the school to the 2006 Class 4A State Championship. Benoit was named Player of the Year, fi rst team All-State, All-Country and All-Conference following her senior campaign. In addition, Benoit also served on the staff of Boston College’s Summer Volleyball Camp during the summer of 2011. Learning new philosophies under BC Head Coach Chris Campbell and Assistant Coach Edgard Da Gama E Silva, Benoit worked with a reputable staff from a com-bination of Division I and Division II programs across the country. The camp welcomed players throughout the Unit-ed States as well as across the globe, including Africa and Germany.

Page 21: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

19/// F E A R T H E D O G ///

Page 22: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

20 /// F E A R T H E D O G ///

ATTACK SET SERVE DIG BLOCKING ## PLAYER SUMMARY SP K K/S E TA Pct A A/S SA SE SA/S RE DIG Dig/S BS BA Total Blk/S BE BHE Points 2 MILLER, Cindi 102 363 3.56 165 1148 .172 23 0.23 21 19 0.21 51 298 2.92 6 28 34 0.33 3 0 404.0 4 MOORE, Anna 106 272 2.57 108 695 .236 10 0.09 12 20 0.11 4 88 0.83 14 72 86 0.81 10 1 334.0 3 SHELTON, Holly 106 256 2.42 122 743 .180 5 0.05 2 9 0.02 16 67 0.63 2 40 42 0.40 5 0 280.0 1 FOSTER, Meredith 105 235 2.24 61 554 .314 9 0.09 11 18 0.10 8 48 0.46 15 58 73 0.70 9 0 290.0 7 MORSE, Hallie 106 67 0.63 32 242 .145 1000 9.43 22 37 0.21 1 248 2.34 6 30 36 0.34 4 18 110.0 14 KENLEY, Chelsie 100 52 0.52 31 220 .095 21 0.21 0 1 0.00 6 39 0.39 2 38 40 0.40 4 1 73.0 9 WELLS, Rachel 106 27 0.25 26 148 .007 26 0.25 28 30 0.26 18 265 2.50 1 3 4 0.04 2 1 57.5 13 STEWART, Alex 95 3 0.03 1 28 .071 28 0.29 14 6 0.15 25 413 4.35 0 0 0 0.00 0 0 17.0 8 DORFMAN, Jaimie 100 2 0.02 2 25 .000 61 0.61 36 40 0.36 1 151 1.51 0 0 0 0.00 0 3 38.0 10 RIGGSBEE, Lisa 4 1 0.25 1 2 .000 0 0.00 0 1 0.00 0 2 0.50 0 0 0 0.00 0 0 1.0 TEAM 18 UNC ASHEVILLE 106 1278 12.06 549 3805 .192 1183 11.16 146 181 1.38 148 1619 15.27 46 269 180.5 1.70 37 24 1604.5 Opponents 106 1418 13.38 606 3879 .209 1318 12.43 148 226 1.40 146 1751 16.52 58 333 224.5 2.12 65 40 1790.5

2011 UNC ASHEVILLE STATISTICSRECORD: OVERALL HOME AWAY NEUTRALALL MATCHES 15-14 5-3 5-7 5-4CONFERENCE 7-7 4-3 3-4 0-0NON-CONFERENCE 8-7 1-0 2-3 5-4

TEAM STATISTICS AVL OPPATTACK Kills 1278 1418 Errors 549 606 Total Attacks 3805 3879 Attack Pct .192 .209 Kills/Set 12.1 13.4SET Assists 1183 1318 Assists/Set 11.2 12.4SERVE Aces 146 148 Errors 181 226 Aces/Set 1.4 1.4SERVE RECEPTIONS Errors 148 146 Errors/Set 1.4 1.4DEFENSE Digs 1619 1751 Digs/Set 15.3 16.5BLOCKING Block Solo 46 58 Block Assist 269 333 Total Blocks 180.5 224.5 Blocks/Set 1.7 2.1 Block Errors 37 65Ball handling errors 24 40ATTENDANCE Total 2931 4108 Dates/Avg Per Date 8/366 12/342 Neutral site #/Avg 9/131 Current win streak 0 - Home win streak 0 -

DATE OPPONENT W/L SCORE SCORE-BY-SET ATTAug 26 vs Troy W 3-2 26-24,23-25,19-25,27-25,18-16 106Aug 26 at Samford L 0-3 11-25,15-25,18-25 212Aug 27 vs UAB L 0-3 18-25,24-26,21-25 139Sept 2 vs Elon W 3-0 25-22,27-25,28-26 102Sept 2 vs Davidson L 0-3 15-25,22-25,20-25 118Sept 3 vs Gardner-Webb W 3-2 18-25,25-19,18-25,25-18,15-12 143Sept 3 at South Carolina L 0-3 16-25,14-25,10-25 407Sep 09 vs East Tennessee St. L 0-3 22-25,22-25,23-25 55Sep 09 vs Tennessee Tech W 3-0 25-17,25-18,25-21 67Sep 10 at Chattanooga W 3-1 25-20,25-23,23-25,25-22 156Sep 13 at Western Carolina L 1-3 25-22,23-25,26-28,23-25 285Sep 20 at N.C. Central W 3-0 25-20,25-16,25-20 129*Sep 23 GARDNER-WEBB W 3-2 15-25,15-25,25-20,25-16,16-14 536*Sep 30 at Liberty L 0-3 17-25,23-25,18-25 1260*Oct 01 at Radford W 3-1 24-26,25-16,25-15,25-18 135Oct 04 WESTERN CAROLINA W 3-0 25-16,25-23,25-22 329*Oct 07 PRESBYTERIAN W 3-1 25-23,23-25,25-23,25-15 306*Oct 08 WINTHROP L 1-3 18-25,26-24,18-25,20-25 399*Oct 14 at Gardner-Webb L 0-3 19-25,23-25,23-25 350*Oct 21 at Coastal Carolina W 3-1 25-22,25-23,20-25,25-15 423*Oct 22 at Charleston Southern W 3-0 25-16,25-19,25-11 239*Oct 28 CAMPBELL W 3-1 25-17,19-25,25-20,25-20 321*Oct 29 HIGH POINT W 3-0 26-24,25-19,25-19 249*Nov 04 at Winthrop L 1-3 16-25,18-25,32-30,24-26 406*Nov 05 at Presbyterian College L 1-3 23-25,25-21,18-25,24-26 106*Nov 11 RADFORD L 2-3 25-20,22-25,25-23,21-25,10-15 354*Nov 12 LIBERTY L 2-3 22-25,25-21,22-25,25-20,13-15 437Nov 17 vs CAMPBELL W 3-0 25-14,25-15,25-18 157Nov 18 vs #1 Liberty L 0-3 17-25,16-25,14-25 291

* - Big South Conference Match

Page 23: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

21/// F E A R T H E D O G ///

BIG SOUTH OVERALLTeam W L Pct. W L Pct. Home Road Neu. L 10 Streakxy-Liberty 12 2 .857 20 13 .606 10-1 5-7 5-5 8-0 L1y-Winthrop 12 2 .857 20 8 .714 9-1 8-3 3-4 8-2 L1Radford 9 5 .643 17 15 .531 8-4 5-7 4-4 7-3 L1UNC Asheville 7 7 .500 15 14 .517 5-3 5-7 5-4 5-5 L1Presbyterian College 7 7 .500 13 17 .433 6-6 5-8 2-3 6-4 L1Campbell 6 8 .429 13 18 .419 4-4 4-8 5-6 4-6 L2High Point 6 8 .429 9 21 .300 6-8 1-10 2-3 3-7 L1Coastal Carolina 5 9 .357 13 20 .394 6-6 4-9 3-5 5-5 L1Gardner-Webb 5 9 .357 10 20 .333 6-3 2-10 2-7 4-6 L2Charleston Southern 1 13 .071 5 25 .167 1-7 2-11 2-7 1-9 L5x - Tournament Champions y - Co-Regular-Season Champions

2011 BIG SOUTH STANDINGS

First Team All-ConferenceBecca Toor, WinthropLoren Thomas, Liberty

Stephanie Palmer, WinthropCindi Miller, UNC Asheville

Lillie Happel, LibertyEmma Deininger, RadfordRachel Brummitt, Radford

Second Team All-ConferencePresley Mabrey, Presbyterian Courtney Johnk, High PointAnnie Kobeski, Campbell

Anna Moore, UNC AshevilleJade Craycraft, Liberty

Laura Wilcox, Gardner-WebbKelly Haseman, Liberty

All-Freshman TeamEmma Deininger, RadfordRachel Brummitt, Radford

Ashtin Frank, Presbyterian CollegeLian Bernett, Coastal Carolina

Heather Feldman, Gardner-WebbKristin Heldt, High Point

Rachel Weichecki, Radford

All-Academic TeamKelsey Campbell, Campbell

Maggie Murphy, Charleston So.Lauren Alejo, Coastal CarolinaEvan Moffi tt, Gardner-Webb

Molly Barlow, High PointKelly Haseman, Liberty

Andrea Barman, Presbyterian Leigh Myers, Radford

Hallie Morse, UNC AshevilleBecca Toor, Winthrop

Player of the YearBecca Toor, Winthrop

Freshman of the Year Emma Deininger, Radford

Coach of the YearMarci Jenkins, Radford

Scholar-Athlete of the YearEvan Moffi tt, Gardner-Webb

Big South Volleyball Championship

Nov. 17#1 Liberty 3 ............................................ #8 Gardner-Webb 1#4 UNC Asheville 3 ......................................... #5 Campbell 0#2 Winthrop 3 ..................................... #7 Coastal Carolina 1#3 Radford 3 ..................................................... #6 High Point 0

Nov. 18#1 Liberty 3 .................................................4 UNC Asheville 0#3 Radford 3 .......................................................... 2 Winthrop 2

Nov. 20#1 Liberty 3 ............................................#3 Radford 0(Liberty earns Automatic Bid to NCAA Championship)

All-Tournament TeamLoren Thomas, Liberty University (MVP)

Kelly Haseman, Liberty UniversityLillie Happel, Liberty University

Rachel Brummit, Radford UniversityRachel Wiechecki, Radford UniversityMeredith Foster, UNC Asheville

Stephanie Palmer, Winthrop University

Page 24: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

22 /// F E A R T H E D O G ///

BIG SOUTH CONFERENCE VOLLEYBALL RECORDSRegular Season Championships

1990, 1991, 1992, 2002, 2009

Tournament Championships1991, 1992

NIVC Tournament1991

Tournament Runners-Up2003, 2005, 2006

Year Opponent Round Score W/L Site1986 Winthrop Quarters 1-3 L Radford1988 Winthrop Semifi nals 0-3 L Asheville1990 Augusta Quarters 3-0 W Charleston1990 Radford Semifi nals 1-3 L Charleston1991 Winthrop Quarters 3-0 W Asheville1991 Radford Semifi nals 3-0 W Asheville1991 Davidson Finals 3-1 W Asheville1992 CSU Quarters 3-1 W Conway1992 UNC Greensboro Semifi nals 3-1 W Conway1992 Liberty Finals 3-2 W Conway1993 Radford Quarters 1-3 L Rock Hill1994 Towson State Quarters 0-3 L Greensboro1995 Winthrop Quarters 2-3 L Greensboro1996 Liberty Quarters 2-3 L Baltimore1997 Coastal Carolina Quarters 2-3 L Asheville1998 Winthrop Quarters 3-1 W Asheville1998 Liberty Semifi nals 0-3 L Asheville1999 Elon Quarters 3-1 W Charleston1999 Radford Semifi nals 0-3 L Charleston2000 Winthrop Quarters 0-3 L High Point2001 CSU Quarters 3-0 W Lynchburg2001 Radford Semifi nals 0-3 L Lynchburg

Year Opponent Round Score W/L Site2002 High Point Quarters 3-1 W Rock Hill2002 Liberty Semifi nals 0-3 L Rock Hill2003 BSC Quarters 3-1 W Birmingham2003 Liberty Semifi nals 3-2 W Birmingham2003 Winthrop Finals 2-3 L Birmingham2004 Liberty Quarters 0-3 L Asheville2005 Liberty Quarters 3-0 W Asheville2005 Coastal Carolina Semifi nals 3-0 W Conway2005 Winthrop Finals 0-3 L Conway2006 Radford Quarters 3-0 W Asheville2006 Coastal Carolina Semifi nals 3-2 W High Point2006 Winthrop Finals 3-0 L High Point2007 High Point Quarters 3-2 W Lynchburg2007 Winthrop Semifi nals 1-3 L Lynchburg2008 Winthrop Quarters 3-1 W Asheville2008 Liberty Semifi nals 0-3 L Asheville2009 Radford Quarters 3-0 W Radford2009 Coastal Carolina Semifi nals 0-3 L Radford2010 Charleston Southern Quarters 0-3 L Rock Hill2011 Campbell Quarters 3-0 W Charleston2011 Liberty Semifi nals 0-3 L Charleston

• All-Time Big South Tournament Results •

Big South Tournament Record By Round Win Loss PctQuarterfi nals 14 9 .609Semifi nals 5 10 .333Finals 2 3 .400

Tournament Record by Opponent Win Loss .PctAugusta 1 0 1.000Birmingham-Southern 1 0 1.000Campbell 1 0 1.000Charleston Southern 2 1 .667Coastal Carolina 2 2 .500Elon 1 0 1.000Davidson 1 0 1.000High Point 2 0 1.000Liberty 3 6 .333Radford 3 4 .429Towson State 0 1 .000UNC Greensboro 1 0 1.000Winthrop 3 8 .273Totals 20 21 .488

The 2009 Big South Conference Regular Season Champion Bulldogs

Page 25: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

23/// F E A R T H E D O G ///

Attempts1. Gina Golkiewicz 1,980 19922. Elissa Steffen 1,539 19923. Kelsey Benorden 1,452 20074. Kelsey Benorden 1,448 20085. Kim Osborne 1,413 19966. Elif Unlu 1,376 20067. Courtney Tucker 1,351 19968. Kim Osborne 1,325 19939. Kelsey Benorden 1,320 201010. Gina Golkiewicz 1,295 1991

Kills:1. Gina Golkiewicz 623 19922. Elissa Steffen 550 19923. Kim Osborne 538 19964. Elif Unlu 512 20065. Cally Geiger 510 19966. Kelsey Benorden 500 20077. Elissa Steffen 489 19948. Courtney Tucker 480 19969. Cally Geiger 476 1997 Elif Unlu 476 2005

Attack Percentage:1. Ilona Fekete .385 19912. Lauren Ficker .350 20093. Ilona Fekete .335 19904. Rose Butler 325 2005 Jennifer Hutchins .325 19936. Ilona Fekete .321 19927. Meredith Foster .314 20118. Amanda Wiles .309 20049. Jessica Jones .306 200010. Lauren Ficker .304 2008

Assists:1. Lorelee Smith 1,852 19962. Danielle Meyer 1,591 19923. Amanda Wiles 1,524 20024. Amanda Wiles 1,506 20045. Lorelee Smith 1,436 19956. Kaitlyn McDaniel 1,409 2006 7. Amanda Wiles 1,374 20058. Lorelee Smith 1,343 19979. Danielle Meyer 1,306 199110. Jessica Beal 1,295 1998

Service Aces:1. Raquel Miotto 65 20092. Frida Sigurdardottir 62 20023. Gina Golkiewicz 60 19914. Sandi Potter 58 19985. Courtney Tucker 58 19966. Gina Golkiewicz 55 19927. Cally Geiger 54 19968. Kim Osborne 53 19959. Missy Allen 52 198910. Courtney Tucker 51 1995

Block Solos:1. Ilona Fekete 198 19902. Ilona Fekete 196 19913. Ilona Fekete 127 19924. Jennifer Hutchins 76 19935. Beth Cole 70 19876. Jennifer Hutchins 68 19917. Tina Bell 64 19898. Beth Cole 63 19869. Jennifer Hutchins 57 199010. Jennifer Hutchins 41 1992

Block Assists:1. Ilona Fekete 133 19902. Beth Cole 127 19893. Ashley Wrightenberry 116 2005 Heather Burns 116 20085. Ilona Fekete 114 19926. Beth Cole 113 19867. Allison Lambert 105 20048. Allison Lambert 104 20059. Rose Butler 99 200410. Ashley Wrightenberry 97 2007

Total Blocks:1. Ilona Fekete 331 19902. Ilona Fekete 288 19913. Ilona Fekete 241 19924. Beth Cole 197 19875. Beth Cole 176 19866. Jennifer Hutchins 152 19907. Jennifer Hutchins 147 19938. Jennifer Hutchins 134 19919. Ashley Wrightenberry 132 200510. Heather Burns 121 2008

Digs:1. Leslie Whitfi eld 763 20022. Gina Golkiewicz 739 19923. Raquel Miotto 721 20064. Raquel Miotto 718 20095. Raquel Miotto 667 20086. Elissa Steffen 656 19927. Raquel Miotto 582 20078. Gina Golkiewicz 544 19919. Elissa Steffen 528 199410. Courtney Tucker 509 1996 Elissa Steffen 509 1993

UNC ASHEVILLE SEASON RECORDS

First TeamCindi Miller (2010, 2011)Kelsey Benorden (2008, 2009)Raquel Miotto (2006, 2008, 2009)Lauren Ficker (2009)Elif Unlu (2005, 2006)Amanda Wiles (2004)Frida Sigurdardottir (2002, 2003)Kelly Budnik (2002)Chandra Hicks (1999)Cally Geiger (1998)Lorelee Smith (1995, 1996, 1997)Kim Osborne (1995)Elissa Steffen (1994)Danielle Meyer (1993)Gina Golkiewicz (1991, 1992)Ilona Fekete (1990, 1991, 1992)Sandra Potter (1989)Holly Van Wagner (1987)

Big South Player of The YearIlona Fekete (1990)

Second TeamAnna Moore (2011)Raquel Miotto (2007)Kelsey Benorden (2007, 2010)Amanda Wiles (2005)Elif Unlu (2004)Amanda Wiles (2003)Leslie Whitfi eld (2002)Kelly Budnik (2000, 2001)Jennifer Baker (1999)Chandra Hicks (1998)Cally Geiger (1995, 1997)Elissa Steffen (1993)Kim Osborne (1993, 1994, 1996)

All-Tournament (Big South)Meredith Foster (2011)Kelsey Benorden (2007, 2008)Raquel Miotto (2006)Emily Palma (2006)Allison Lambert (2005)Elif Unlu (2003, 2005)Amanda Wiles (2002)Rose Butler (2002)Bonny Sneed (2001)Kelly Budnik (2001)Kristie Brinkley (2000)Jennifer Baker (1999)Chandra Hicks (1998)Kim Osborne (1993)

Big South Tournament MVPDanielle Meyer (1992)

Big South Scholar-Athlete of the YearLorelee Smith (1997)

Big South Rookie of the YearKelly Budnik (2000)Kim Osborne (1993)

Big South All-Rookie TeamAlex Stewart (2010)Kelsey Benorden (2007)Cindi Miller (2008)Raquel Miotto (2006)Elif Unlu (2003)Amanda Wiles (2002)Rose Butler (2002)Bonny Sneed (2001)Kelly Budnik (2000)Kim Osborne (1993)

Big South Coach of the YearJulie Torbett (2009)

BIG SOUTH CONFERENCE HONORS

Page 26: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

24 /// F E A R T H E D O G ///

UNC ASHEVILLE CAREER RECORDSAttempts1. Kelsey Benorden 5,263 2007-102. Elissa Steffen 4,993 1991-943. Kim Osborne 4,727 1993-964. Elif Unlu 4,546 2003-065. Gina Golkiewicz 4,408 1990-926. Cindi Miller 4,213 2008-117. Cally Geiger 4,204 1995-988. Kelly Budnik 3,755 2000-039. Rose Butler 3,630 2002-0510. Courtney Tucker 3,333 1994-96

Kills:1. Elissa Steffen 1,775 1991-942. Cally Geiger 1,761 1995-983. Kim Osborne 1,733 1993-964. Kelsey Benorden 1,731 2007-105. Elif Unlu 1,709 2003-066. Cindi Miller 1,436 2008-117. Gina Golkiewicz 1,511 1990-928. Kelly Budnik 1,317 2000-039. Rose Butler 1,270 2002-0510. Courtney Tucker 1,196 1994-96 Jennifer Baker 1,196 1996-99

Attack Percentage:1. Ilona Fekete .347 1990-922. Jennifer Hutchins .292 1990-933. Cally Geiger .266 1995-984. Frida Sigurdardottir .265 2000-035. Lorelee Smith .263 1994-97 6. Amanda Wiles .257 2002-057. Gina Golkiewicz .242 1990-928. Elissa Steffen .233 1991-949. Elif Unlu .231 2003-0610. Ashley Wrightenberry .229 2004-07

Assists:1. Lorelee Smith 5,904 1994-972. Amanda Wiles 5,613 2002-053. Danielle Meyer 5,187 1990-934. Rachel Guinane 3,466 2007-105. Jessica Beal 2,822 1998-006. Kaitlyn McDaniel 2,658 2006-097. Hallie Morse 1,406 2010-118. Bonnie Sneed 1,076 2001-029. Katie Meindl 1,014 1999-0010. Missy Allen 532 1989-90

Service Aces:1. Cally Geiger 198 1995-982. Raquel Miotto 164 2006-093. Gina Golkiewicz 150 1990-924. Kim Osborne 142 1993-96 Courtney Tucker 142 1994-966. Mellie Durham 134 1992-957. Khristine Ambrose 133 1997-008. Kelly Budnik 130 2000-039. Danielle Meyer 126 1990-9310. Elissa Steffen 121 1991-94

Block Solos:1. Ilona Fekete 521 1990-922. Jennifer Hutchins 242 1990-933. Beth Cole 133 1985-884. Cally Geiger 131 1995-985. Jenni Reynolds 101 1994-976. Jessica Jones 71 1999-027. Chandra Hicks 70 1996-998. Tina Bell 64 1989-909. Ursula Carswell 57 1994-95 Elizabeth Rodriguez 57 1998-01

Block Assists:1. Ashley Wrightenberry 351 2004-072. Ilona Fekete 339 1990-923. Cally Geiger 290 1995-98 Jennifer Hutchins 290 1990-935. Rose Butler 248 2002-056. Beth Cole 240 1985-887. Heather Burns 229 2005-088. Chandra Hicks 227 1996-999. Allison Lambert 209 2004-0510. Suzanne Aubel 208 1999-03

Total Blocks:1. Ilona Fekete 860 1990-922. Jennifer Hutchins 632 1990-933. Cally Geiger 421 1995-984. Ashley Wrightenberry 403 2004-075. Beth Cole 373 1985-886. Jenni Reynolds 307 1994-977. Rose Butler 289 2002-058. Chandra Hicks 287 1996-999. Jessica Jones 278 1999-0210. Suzanne Aubel 257 1999-03

Digs:1. Raquel Miotto 2,688 2006-092. Elissa Steffen 2,179 1991-943. Gina Golkiewicz 1,674 1990-924. Kelsey Benorden 1,535 2007-105. Mellie Durham 1,532 1992-956. Kelly Budnik 1,460 2000-037. Jennifer Baker 1,446 1996-998. Kim Osborne 1,396 1993-969. Leslie Whitfi eld 1,357 1999-0210. Krysti Havens 1,319 2002-05

Games Played:1. Danielle Meyer 515 1990-932. Lorelee Smith 514 1994-973. Kim Osborne 509 1993-964. Mellie Durham 505 1992-955. Amanda Wiles 504 2002-056. Amber Mendenhall 502 1988-927. Elissa Steffen 501 1991-948. Krysti Havens 498 2002-059. Jennifer Hutchins 497 1990-0310. Cally Geiger 496 1995-98

Big South Champions1991, 1992

Big South Regular Season Champions1990, 1991 (tie), 1992, 2002, 2009

Big South Tournament Runner-Up2003, 2005, 2006

National Invitational Volleyball Championship1991 (Dayton, Ohio)

NAIA District 26 Playoff1984

TEAM HONORS

Coach W L Pct. Suzanne Patterson (1984-87) 60 69 .465 Art Faura (1988) 13 18 .419 Lisa Rhodes (1989-93) 97 77 .557 Julie Torbett (1994-2010) 304 261 .538 Frederico Santos (2011-Pres) 15 14 .517

HEAD COACHES

Page 27: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

25/// F E A R T H E D O G ///

• Individual •

KillsMatch: 34, Kelsey Benorden vs. High Point, 11/15/07

Season: 623, Gina Golkiewicz, 1992Career: 1,775, Elissa Steffen, 1991-94

AttemptsMatch: 83, Kelsey Benorden vs. High Point, 11/15/07

Season: 1,980, Gina Golkiewicz, 1992Career: 4,993, Elissa Steffen, 1991-94

Attack Percentage (minimum 10 kills)Match: .688 (12-1-16), Lauren Ficker vs. Southern 11/15/07

Season: .385, Ilona Fekete, 1991Career: .347, Ilona Fekete, 1990-92

AssistsMatch: 83, Danielle Meyer, vs. Davidson, 1991

Season: 1,852, Lorelee Smith, 1996Career: 5,904, Lorelee Smith, 1994-97

Service AcesMatch: 7, Kelly Budnik vs. Elon, 10/20/01 and

Elif Unlu, vs. Montreat, 10/15/03Season: 65, Raquel Miotto, 2009

Career: 198, Cally Geiger, 1995-98

DigsMatch: 50, Leslie Whitfi eld vs. Western, 10/22/02

Season: 763, Leslie Whitfi eld, 2002Career: 2,688, Raquel Miotto, 2006-09

Block SolosMatch: 10, Ilona Fekete, vs. Davidson, 1991

Season: 198, Ilona Fekete, 1990Career: 521, Ilona Fekete, 1990-92

Block AssistsMatch: 9, Ilona Fekete, vs. Davidson, 1991 and

Heather Burns, vs. Liberty, 11/7/08Season: 133, Ilona Fekete, 1990Career: 339, Ilona Fekete, 1990

• Team •

Most WinsSeason: 32, 1992

Most MatchesSeason: 56, 1982 (29-27)

Consecutive WinsSeason: 17, 1992

Winning PercentageSeason: .846 (32-6 in 1992)

KillsMatch: 92 vs. Winthrop, Nov. 20, 1998

AttemptsMatch: 237, vs. Duquesne, Aug. 27, 2006

DigsMatch: 122, vs. Western Carolina, Oct. 22, 2005

Season: 2,370, 2002

UNC ASHEVILLE INDIVIDUAL/TEAM RECORDS

Raquel Miotto (2006-09) holds the Big South record for most career digs with 2,688

Page 28: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

26 /// F E A R T H E D O G ///

Overall Record: 12-23 Big South Record: 3-59/1 Tennessee-Martin W 3-09/2 UNC Wilmington L 1-39/3 Appalachian State L 0-39/3 UNC Charlotte L 2-39/6 at Tennessee Tech L 0-39/7 at Clemson L 0-39/13 at East Tennessee State L 0-39/15 Montana State W 3-29/16 vs. Howard W 3-09/16 at VCU L 0-39/17 vs. UNC Greensboro L 0-39/20 at Mars Hill W 3-19/23 Georgia Southern L 2-39/24 Georgia State L 0-39/24 Charleston L 0-39/26 at North Carolina A&T W 3-010/1 UMBC* L 2-310/4 at UNC Greensboro* L 0-310/8 at Winthrop W 3-010/8 vs. Bucknell L 1-310/8 vs. Howard W 3-010/12 North Carolina A&T W 3-010/15 at Liberty* L 1-310/16 at Radford* W 3-210/22 vs. Fla. International L 1-310/22 at Georgia State L 1-310/22 at Mercer L 0-310/23 at Georgia Southern L 1-310/25 at Winthrop* W 3-110/28 Charleston Southern* L 1-310/29 Coastal Carolina* W 3-011/2 at UNC Charlotte L 0-311/6 Towson State* L 0-311/9 East Tennessee State W 3-211/11 vs. Towson State^ L 0-3 *Big South Matches^Big South Tournament Match

Overall Record: 24-11 Big South Record: 4-39/1 vs. UNC Wilmington W 3-19/2 vs. North Carolina A&T W 3-09/2 at UNC Charlotte W 3-29/6 Mars Hill W 3-09/8 vs. UAB W 3-29/8 vs. Samford W 3-09/8 vs. Charleston Southern W 3-09/9 Wofford W 3-09/9 vs. UAB L 0-39/12 at Tennessee L 1-39/15 Florida A&M W 3-09/16 Tennessee State W 3-09/16 Appalachian State L 0-39/20 Wofford W 3-09/23 at Davidson W 3-09/26 South Carolina State W 3-09/29 vs. UCF L 0-39/30 vs. Troy State L 0-39/30 at Georgia State W 3-110/4 East Tennessee State W 3-110/8 at UNC Greensboro* L 1-310/11 at Appalachian State L 1-310/14 Liberty* W 3-010/15 Radford* W 3-010/18 at Wofford W 3-010/21 at Western Carolina W 3-210/24 Winthrop* W 3-110/26 Furman W 3-010/27 at Charleston Southern* W 3-210/28 at Coastal Carolina* L 2-311/1 UNC Charlotte W 3-211/2 North Carolina A&T W 3-011/4 at UMBC* L 0-3

11/7 at East Tennessee State L 1-311/10 vs. Winthrop^ L 2-3*Big South Matches^Big South Tournament Match

Overall Record: 21-16 Big South Record: 8-68/30 vs. UNC Wilmington W 3-18/31 vs. Western Carolina W 3-08/31 at UNC Charlotte L 1-39/6 vs. Georgia Tech L 0-39/6 vs. Charleston W 3-19/6 vs. Jacksonville State L 1-39/7 vs. Western Carolina W 3-19/7 at Furman W 3-09/7 vs. Georgia Tech L 0-39/11 Wofford W 3-19/11 Appalachian State W 3-19/20 vs. James Madison L 2-39/20 vs. East Carolina W 3-19/21 at Campbell W 3-09/21 vs. Mercer W 3-09/24 at East Tennessee State L 0-39/28 Liberty* W 3-19/29 Radford* W 3-010/1 at North Carolina L 0-310/2 at UNC Greensboro* L 2-310/6 at UMBC* L 0-310/8 at Wofford W 3-110/12 at Coastal Carolina* L 2-310/13 at Charleston Southern* W 3-010/16 at UNC Charlotte W 3-210/20 Coastal Carolina* L 0-310/23 Davidson L 2-310/26 Charleston Southern* W 3-010/27 at Winthrop* W 3-110/29 East Tennessee State W 3-011/2 at Liberty* L 2-311/3 at Radford* W 3-011/6 Winthrop* W 3-011/7 UNC Greensboro* W 3-011/10 UMBC* L 2-311/12 Tennessee L 0-311/15 vs. Liberty^ L 2-3*Big South Matches^Big South Tournament Match

Overall Record: 16-17 Big South Record: 5-78/29 vs. Western Carolina W 3-08/30 vs. Appalachian State W 3-18/30 at Wake Forest L 0-39/3 at East Tennessee State L 0-39/5 vs. UNC Charlotte L 0-39/6 at UNC Wilmington W 3-19/6 vs. Western Carolina W 3-09/9 High Point W 3-09/12 vs. Massachusetts L 1-39/13 at Penn State L 0-39/13 vs. West Virginia L 0-39/16 Appalachian State L 2-39/19 Providence L 0-39/20 Samford W 3-09/20 Belmont W 3-09/23 UNC Charlotte W 3-29/26 at Charleston Southern* W 3-09/27 at Coastal Carolina* L 0-39/30 at Davidson W 3-010/4 Liberty* L 2-310/5 Coastal Carolina* L 0-310/11 UMBC* W 3-210/17 at Liberty* L 2-310/18 at Radford* L 1-310/21 East Tennessee State W 3-210/25 at UM-Eastern Shore W 3-0

10/25 at UMBC* L 2-310/27 Winthrop* W 3-111/1 Tennessee L 1-311/4 at Winthrop* L 2-311/8 Charleston Southern* W 3-011/9 Radford* W 3-111/14 Coastal Carolina^ L 2-3*Big South Matches^Big South Tournament Match

Overall Record: 18-13 Big South Record: 3-59/1 at East Tennessee State L 0-39/8 Appalachian State L 1-39/11 UNC Wilmington W 3-09/12 UNC Charlotte L 0-39/12 Western Carolina L 2-39/18 at UNC Wilmington W 3-09/19 vs. High Point W 3-09/19 vs. UNC Greensboro L 1-39/22 at Tennessee L 1-39/25 vs. The Citadel W 3-09/26 vs. North Carolina A&T W 3-09/26 vs. Stetson W 3-09/26 at Coll. Of Charleston W 3-010/3 Liberty* L 2-310/4 Radford* L 1-310/6 at Winthrop* L 2-310/9 at High Point W 3-110/10 at Elon W 3-110/17 Charleston Southern* W 3-110/18 Coastal Carolina* W 3-110/20 East Tennessee State W 3-010/25 Winthrop* W 3-010/31 at Liberty* L 1-311/1 at Radford* L 0-311/6 Elon W 3-011/7 High Point W 3-011/10 North Carolina A&T W 3-111/13 at Charleston Southern W 3-111/14 at Coastal Carolina L 1-311/20 vs. Winthrop^ W 3-111/21 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 16-17 Big South Record: 8-69/3 vs. LaSalle W 3-09/3 vs. Evansville L 1-39/4 at Middle Tennessee L 0-39/4 vs. Coll. Of Charleston L 2-39/7 at Western Carolina L 1-39/11 Montreat W 3-09/14 East Tennessee State L 2-39/17 vs. Wofford W 3-09/18 at Mercer W 3-19/18 vs. North Carolina A&T W 3-09/24 vs. Bethune-Cookman W 3-09/24 at UCF L 1-39/25 vs. Rice L 0-39/25 vs. St. John’s L 1-39/28 at Appalachian State W 3-110/1 High Point* W 3-110/2 Elon* W 3-010/5 at Winthrop* L 0-310/8 at Charleston Southern* W 3-010/9 at Coastal Carolina* L 1-310/12 Tennessee L 0-310/15 Liberty* L 2-310/16 Radford* W 3-210/24 Winthrop* W 3-110/29 at High Point* W 3-010/30 at Elon* L 1-311/6 Charleston Southern* W 3-0

1994

1995

1996

1997

1998

YEAR-BY-YEAR RESULTS SINCE 1994

1999

Page 29: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

27/// F E A R T H E D O G ///

11/7 Coastal Carolina* W 3-011/9 at East Tennessee State L 2-311/12 at Radford* L 1-311/13 at Liberty* L 0-311/19 vs. Elon^ W 3-111/20 vs. Radford^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 13-21 Big South Record: 5-99/1 at Georgia Southern L 0-39/2 vs. Florida International L 1-39/2 vs. Jacksonville L 0-39/8 vs. Drexel W 3-29/9 vs. Bucknell W 3-19/9 at Youngstown State L 0-39/12 East Tennessee State L 0-39/15 vs. Wofford W 3-19/15 at Mercer W 3-09/16 vs. Middle Tennessee L 2-39/19 at Tennessee L 0-39/22 Campbell L 0-39/22 Loyola (MD) W 3-09/23 Pittsburgh L 0-39/23 North Carolina A&T W 3-09/30 Charleston Southern* W 3-110/1 Coastal Carolina* W 3-110/4 Winthrop* L 1-310/7 at Liberty* L 0-310/8 at Radford* L 0-310/13 Elon* L 2-310/14 High Point* W 3-110/18 at East Tennessee State L 0-310/25 Western Carolina L 0-310/28 Liberty* L 0-310/29 Radford* L 0-310/31 Wofford W 3-111/3 at Charleston Southern* W 3-211/4 at Coastal Carolina* L 0-311/8 at Winthrop* L 1-310/10 at Elon* L 1-310/11 at High Point* W 3-011/14 Gardner-Webb W 3-111/17 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 7-21 Big South Record: 5-98/31 Memphis L 0-39/1 South Alabama L 2-39/1 Morehead State L 0-39/4 at Gardner-Webb L 1-39/7 vs. Rutgers L 0-39/8 at Penn State L 0-39/8 vs. George Mason L 0-39/19 at Wofford L 0-39/21 at High Point* W 3-09/22 at Elon* L 2-39/25 at Coastal Carolina* W 3-19/29 Birmingham-Southern W 3-010/2 Charleston Southern* W 3-110/5 Liberty* L 0-310/6 Radford* L 0-310/14 Winthrop* L 0-310/17 at Western Carolina L 0-310/19 High Point* W 3-210/20 Elon* W 3-210/23 Coastal Carolina* L 2-310/26 at Samford L 1-310/27 at Birmingham-Southern L 2-310/30 at Charleston Southern* L 0-311/2 at Radford* L 0-311/3 at Liberty* L 0-3

11/9 at Winthrop* L 0-311/15 vs. Charleston Southern^ W 3-011/16 vs. Radford^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 26-8 Big South Record: 12-28/30 vs. UNC Wilmington W 3-08/30 vs. Mercer W 3-28/31 vs. Appalachian State L 2-38/31 at High Point W 3-29/6 vs. UMBC L 2-39/7 at Navy L 2-39/7 vs. Albany W 3-09/10 at Morris Brown W 3-09/13 vs. Wofford W 3-09/13 at Mercer W 3-29/14 vs. High Point W 3-19/17 High Point* W 3-19/24 at North Carolina A&T L 2-39/27 Liberty* W 3-19/28 Radford* W 3-210/1 at East Tennessee State W 3-110/3 Elon* W 3-010/11 at Charleston Southern* W 3-010/12 at Coastal Carolina* L 2-310/15 at Winthrop* L 0-310/16 Mars Hill W 3-010/16 Montreat W 3-010/19 Birmingham-Southern W 3-110/22 Western Carolina L 2-310/25 at Liberty* W 3-010/26 at Radford* W 3-111/1 at Elon* W 3-111/2 at High Point* W 3-011/8 Charleston Southern* W 3-211/9 Coastal Carolina* W 3-111/12 Winthrop* W 3-211/15 at Birmingham-Southern W 3-111/21 vs. High Point^ W 3-111/22 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 18-10 Big South Record: 9-59/5 vs. Elon W 3-19/5 vs. Mercer W 3-29/6 at UNC Wilmington L 2-39/12 vs. Loyola (MD) W 3-09/13 at VCU W 3-29/13 vs. Albany L 2-39/16 at Western Carolina L 0-39/26 Liberty* L 2-39/27 Birmingham-Southern* W 3-210/1 at Furman L 0-310/4 at Winthrop* L 1-310/7 at High Point* W 3-110/12 Charleston Southern* W 3-010/15 Montreat W 3-010/15 Mars Hill W 3-010/18 Coastal Carolina* W 3-110/25 at Birmingham-Southern* W 3-110/28 Radford* W 3-210/31 at Charleston Southern* W 3-011/1 at Coastal Carolina* L 1-311/4 High Point* W 3-111/7 Winthrop* L 0-311/11 North Carolina A&T W 3-011/14 at Liberty* L 0-311/15 at Radford* W 3-211/21 vs. Birmingham-Southern^ W 3-111/22 vs. Liberty^ W 3-211/23 vs. Winthrop^ L 2-3

*Big South Matches^Big South Tournament Match

Overall Record: 19-17 Big South Record: 8-69/1 at Appalachian State L 1-39/2 Lipscomb W 3-09/3 vs. Elon L 2-39/3 at North Carolina State L 0-39/4 vs. UNC Wilmington L 1-39/4 vs. Wofford W 3-29/10 at Campbell L 1-39/11 vs. Wofford W 3-19/11 vs. Western Carolina L 2-39/14 Charleston Southern* W 3-09/21 Furman L 2-39/24 vs. Memphis L 1-39/24 at UNC Greensboro W 3-09/25 vs. Florida Atlantic L 2-39/25 vs. Morgan State W 3-09/28 at North Carolina A&T W 3-110/1 vs. St. John’s L 1-310/1 at UMES W 3-210/2 vs. Delaware State W 3-010/2 vs. Niagara W 3-010/5 at Liberty* W 3-010/8 at Charleston Southern* L 1-310/9 at Coastal Carolina* W 3-210/15 Winthrop* L 2-310/16 Coastal Carolina* L 1-310/19 Western Carolina W 3-010/22 Liberty* L 0-310/23 Birmingham-Southern* W 3-110/26 at Radford* W 3-010/28 East Tennessee State W 3-211/2 at High Point* W 3-211/5 at Winthrop* L 0-311/9 High Point* W 3-111/11 Radford* W 3-011/13 at Birmingham-Southern* L 0-311/16 Liberty^ L 0-3 *Big South Matches^Big South Tournament Match

Overall Record: 25-7 Big South Record: 10-48/27 Appalachian State L 0-39/2 vs. Chattanooga W 3-19/3 vs. UNC Wilmington W 3-19/3 at North Carolina A&T L 2-39/9 vs. Memphis W 3-19/9 vs. Louisiana Tech W 3-19/10 vs. Flordia International W 3-09/10 at Mercer W 3-29/16 Samford W 3-19/17 Elon W 3-09/17 Western Carolina W 3-09/22 at Lipscomb W 3-09/24 at Birmingham-Southern* W 3-19/27 at Gardner-Webb W 3-09/30 Charleston Southern* W 3-110/2 Coastal Carolina* L 1-310/7 at Winthrop* L 1-310/8 at High Point* W 3-110/14 at Liberty* W 3-210/15 at Radford* W 3-010/21 High Point* W 3-010/23 Winthrop* L 0-310/28 at Charleston Southern* W 3-210/29 at Coastal Carolina* L 1-311/1 at East Tennessee State W 3-211/4 Radford* W 3-011/6 Liberty* W 3-011/10 at Western Carolina W 3-011/12 Birmingham-Southern* W 3-0

2005

2000

2001

2002

2003

2004

YEAR-BY-YEAR RESULTS SINCE 1994

Page 30: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

28 /// F E A R T H E D O G ///

11/15 Liberty^ W 3-011/19 at Coastal Carolina^ W 3-011/20 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 15-18 Big South Record: 10-48/25 vs. Canisius L 2-38/25 vs. Rutgers L 1-38/26 at James Madison L 0-38/26 vs. Duquesne L 2-38/29 at Elon W 3-29/1 Cleveland State L 0-39/2 UNC Greensboro L 2-39/2 East Tennessee State L 1-39/8 at Mercer L 0-39/8 vs. UAB L 0-39/9 vs. Nicholls State L 1-39/15 vs. Louisiana-Monroe W 3-09/16 vs. Charlotte L 2-39/16 at Samford L 0-39/23 Birmingham-Southern* W 3-09/29 Liberty* W 3-010/1 Radford* W 3-110/3 at High Point* W 3-110/6 at Winthrop* L 0-310/13 Coastal Carolina* W 3-110/15 Charleston Southern* W 3-010/20 Winthrop* L 1-310/22 High Point* W 3-110/24 Montreat W 3-010/27 at Liberty* L 1-310/28 at Radford W 3-111/3 at Charleston Southern* W 3-111/4 at Coastal Carolina* L 1-311/7 Gardner-Webb L 1-311/11 at Birmingham-Southern* W 3-211/14 Radford^ W 3-011/17 vs. Coastal Carolina^ W 3-211/18 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 12-22 Big South Record: 2-108/24 vs. TCU L 0-38/25 at Florida State L 0-38/25 vs. Florida Gulf Coast L 0-38/31 Western Carolina L 0-39/1 Kennesaw State L 2-39/1 USC Upstate W 3-19/7 vs. Missouri State L 0-39/8 at Chattanooga L 0-39/8 vs. Tennessee Tech L 0-39/11 North Carolina Central W 3-19/14 at Alabama State W 3-09/14 vs. Mississippi Valley State W 3-19/15 vs. Southern W 3-09/15 vs. Alabama A&M W 3-09/19 at East Tennessee State L 2-39/22 at Presbyterian L 0-39/23 Jacksonville L 1-39/28 at Coastal Carolina* L 0-39/29 at Charleston Southern* L 0-310/5 High Point* L 1-310/6 Winthrop* L 1-310/12 at Radford* L 1-310/14 at Liberty* L 0-310/19 at Winthrop* L 1-310/20 at High Point* L 1-310/23 at Gardner-Webb W 3-010/26 Charleston Southern* W 3-110/27 Coastal Carolina* L 1-311/2 Radford* W 3-1

11/3 Liberty* L 0-311/8 at USC Upstate W 3-211/10 Prebyterian W 3-111/15 vs. High Point^ W 3-211/16 vs. Winthrop^ L 1-3*Big South Matches^Big South Tournament Match

Overall Record: 18-14 Big South Record: 8-88/29 vs. Elon L 0-38/29 vs. Florida Gulf Coast W 3-2 8/30 vs. Maine L 2-39/5 vs. Hampton W 3-09/6 vs. Wofford L 1-39/6 at USC Upstate W 3-09/12 vs. William & Mary L 2-39/12 vs. Norfolk State W 3-09/13 at N.C. State W 3-29/16 at Western Carolina W 3-19/20 vs. Virginia Tech L 0-39/20 at UNC Wilmington W 3-29/23 North Carolina A&T W 3-0 9/26 High Point* L 2-310/4 at Winthrop* L 2-310/7 Presbyterian* L 1-310/10 at Radford* L 1-310/11 at Liberty* L 0-310/14 at Gardner-Webb* W 3-110/17 Charleston Southern* W 3-210/18 Coastal Carolina* L 2-310/25 at High Point* W 3-211/1 Winthrop* W 3-211/4 Gardner-Webb* W 3-011/7 Liberty* W 3-211/8 Radford* W 3-111/11 at Presbyterian* W 3-211/14 at Coastal Carolina* L 0-311/15 at Charleston Southern* L 2-311/21 Winthrop^ W 3-111/22 Liberty^ L 0-311/25 Wofford W 3-0

Overall Record: 25-10 Big South Record: 13-38/28 vs. UNC Wilmington L 1-38/28 vs. South Carolina State W 3-08/29 vs. Elon L 1-38/29 vs. The Citadel W 3-29/2 Western Carolina W 3-09/4 vs. N.C. State W 3-19/5 vs. The Citadel W 3-09/5 at USC Upstate W 3-09/11 vs. Savannah State W 3-09/11 vs. East Carolina L 1-39/12 vs. Wofford L 2-39/12 vs. Winston-Salem State W 3-09/18 vs. Winston-Salem State W 3-09/18 vs. Hampton W 3-09/19 vs. Providence W 3-19/19 vs. Wofford W 3-09/22 Gardner-Webb* W 3-19/25 at Radford* W 3-210/2 Charleston Southern* W 3-210/6 at Presbyterian* W 3-010/9 High Point* W 3-010/10 Liberty* W 3-110/16 at Winthrop* W 3-110/17 at Coastal Carolina* L 2-310/20 East Tennessee State L 2-310/24 Radford* W 3-010/27 Presbyterian* W 3-110/31 at Charleston Southern* L 2-311/3 at Gardner-Webb* W 3-111/6 at Liberty* W 3-1

11/7 at High Point* W 3-111/13 Coastal Carolina* L 2-311/14 Winthrop* W 3-211/19 at Radford^ W 3-011/20 vs. Coastal Carolina^ L 0-3*Big South Matches^Big South Tournament Match

Overall Record: 19-12 Big South Record: 11-58/27 vs. Davidson L 0-38/28 at James Madison L 0-39/3 vs. Stetson W 3-19/3 at South Alabama W 3-09/4 vs. Alabama State W 3-09/4 vs. Alabama A&M L 2-39/10 vs. UNC Greensboro L 1-39/11 vs. Austin Peay L 0-39/11 at ETSU L 1-39/18 vs. NC A&T W 3-09/18 at Western Carolina W 3-19/20 Gardner-Webb* W 3-09/24 Coastal Carolina* W 3-29/28 at Mercer W 3-010/1 at Radford* W 3-110/2 at High Point* L 0-310/5 at Presbyterian* W 3-110/8 at Charleston Southern* W 3-210/9 at Winthrop* L 1-310/16 Liberty* L 1-310/23 at Coastal Carolina* L 1-310/26 Mercer W 3-010/29 High Point* W 3-110/30 Radford* W 3-211/2 Presbyterian* W 3-011/5 Winthrop* W 3-211/6 Charleston Southern* W 3-111/9 at Gardner-Webb* W 3-011/13 at Liberty* L 2-311/18 vs. Charleston Southern^ L 2-3*Big South Matches^Big South Tournament Match

Overall Record: 15-14 Big South Record: 7-78/26 vs Troy W 3-2 8/26 at Samford L 0-3 8/27 vs UAB L 0-3 9/2 vs Elon W 3-0 9/2 vs Davidson L 0-3 9/3 vs Gardner-Webb W 3-2 9/3 at South Carolina L 0-3 9/9 vs East Tennessee St. L 0-3 9/9 vs Tennessee Tech W 3-0 9/10 at Chattanooga W 3-1 9/13 at Western Carolina L 1-3 9/20 at N.C. Central W 3-0 9/23 GARDNER-WEBB* W 3-2 9/30 at Liberty* L 0-3 10/1 at Radford* W 3-1 10/4 WESTERN CAROLINA W 3-0 10/7 PRESBYTERIAN* W 3-1 10/8 WINTHROP* L 1-3 10/14 at Gardner-Webb* L 0-3 10/21 at Coastal Carolina* W 3-1 10/22 at Charleston Southern* W 3-0 10/8 CAMPBELL* W 3-1 10/29 HIGH POINT* W 3-0 11/4 at Winthrop* L 1-3 11/5 at Presbyterian* L 1-3 11/11 RADFORD* L 2-3 11/12 LIBERTY* L 2-3 11/17 vs CAMPBELL^ W 3-0 11/18 vs Liberty^ L 0-3

2006

2007

2008

YEAR-BY-YEAR RESULTS SINCE 1994

2009

2010

2011

Page 31: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

29/// F E A R T H E D O G ///

ALL-TIME RESULTSTeam W L Alabama A&M 1 1Alabama State 2 0Albany 1 1Appalachian State 3 8Austin Peay 0 1Belmont 1 0Bethune-Cookman 1 0Birmingham-Southern 11 2Bucknell 1 1Campbell 1 2 Canisius 0 1Charleston, College of 3 1 Charleston Southern 28 7 Charlotte 4 6Chattanooga 1 1Citadel 3 0 Clemson 0 1Cleveland State 0 1Coastal Carolina 11 22 Davidson 1 2Delaware State 1 0Drexel 0 1Duquesne 0 1East Carolina 1 1 East Tennessee State 7 13 Elon 10 7Evansville 0 1Florida Atlantic 0 1Florida A&M 1 0Florida Gulf Coast 1 1Florida International 1 2Florida State 0 1Furman 2 2 Gardner-Webb 9 2George Mason 0 1Georgia Southern 0 3Georgia State 1 2Georgia Tech 0 2 Hampton 2 0High Point 28 4 Howard University 2 0Jacksonville 0 2Jacksonville State 0 1James Madison 0 2Kennesaw State 0 1LaSalle 1 0Liberty 13 25Lipscomb 2 0Louisiana-Monroe 1 0Louisiana Tech 1 0Loyola (Md) 2 0Maine 0 1Massachusetts 0 1Mars Hill 4 0Maryland-Eastern Shore 2 0Memphis 1 2 Mercer 9 2 Middle Tennessee 0 2

Team W L Mississippi Valley State 1 0Missouri State 0 1Montana State 1 0Montreat 4 0Morehead State 0 1Morgan State 1 0Morris Brown 1 0Navy 0 1Niagara 1 0Nicholls State 0 1Norfolk State 1 0North Carolina 0 1 North Carolina A&T 13 1 North Carolina Central 1 0North Carolina State 2 1Penn State 0 2Pittsburgh 0 1Presbyterian 6 2Providence 1 1Radford 23 12Rice 0 1Rutgers 0 2Samford 3 2Savannah State 1 0South Alabama 1 1 South Carolina State 2 0South Carolina Upstate 4 0Southeastern La. 1 0Southern 1 0St. John’s 0 2Stetson 2 0Tennessee 0 6Tennessee-Martin 1 0Tennessee State 1 0Tennessee Tech 0 2 Texas Christian 0 1Towson 0 2 Troy 0 1UAB 1 2UCF 0 2UMBC 1 6 UNC Greensboro 2 7 UNC Wilmington 8 4 Virginia Commonwealth 0 1 Virginia Tech 0 1Wake Forest 0 1 West Virginia 0 1Western Carolina 11 8 William & Mary 0 1Winston-Salem State 2 0Winthrop 13 25 Wofford 12 4Youngstown State 0 1

All-Time Results Since 1994

Page 32: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

30 /// F E A R T H E D O G ///

UNC ASHEVILLE ATHLETICS HALL OF FAMEUNC Asheville’s Athletics Hall of Fame was established in 2003 and has had nine classes inducted. A total of 22 athletes and administrators have been enshrined. Of those 22 inductees, four are former volleyball players: Ilona Fekete, Danielle Meyer, Elissa Steffen and Loralee Smith. One is a former coach, Lisa Rhodes (inducted in 2012).

Ilona Fekete Thimmer (1990-92)Inducted in 2003

Ilona Fekete Thimmer established a tradition of great volleyball at UNC Asheville from 1990-92. She led the Bulldogs to three straight Big South Conference regular-season titles and two straight tournament crowns. She also led the nation in blocks as a sophomore in 1990 and was among the nation’s leaders in that category the next two seasons. The Pembroke Pines, Fla., native was the Big South Player of the Year in 1990 and was an all-conference and all-tournament selection for three seasons. She is the school’s all-time leader in total blocks and block solos. Thimmer was inducted into the inaugural class of the Big South Conference Hall of Fame. She and her family reside in Vero Beach, Fla.

Danielle Meyer Harrison (1990-93)Inducted in 2007

Danielle Meyer Harrison was the Bulldogs’ starting setter for four years and is third all-time on the career assist list with 5,187. She helped lead UNC Asheville to three straight Big South Conference regular-season championships and two tournament titles. She was the Co-MVP of the 1992 Big South Conference Tournament. The Bulldogs were 35-6 against Big South opponents during her career. She was an all-conference selection twice and was part of the 1991 UNC Asheville team that was selected to the National Invitational Volleyball Championships in Dayton, Ohio. She and her family reside in Illionis.

Elissa Steffen Mount (1991-94)Inducted in 2008

Elissa Steffen Mount enjoyed a sensational career for the Bulldogs. She is UNC Asheville’s all-time career leader in three different categories. Elissa is the all-time leader in kills (1,775), digs (2,179) and attempts (4,993). She was an all-conference performer as a junior and senior and was a part of two Big South Conference championship teams as a freshman and sophomore. Elissa helped lead UNC Asheville to its fi rst ever post-season tournament as a Division I school when the Bulldogs were selected to participate in the 1991 National Invitational Volleyball Championships. She and her husband Jeremy live in Hawaii with their two children.

Loralee Smith (1994-97)Inducted in 2009

Lorelee Smith was a three-time fi rst team Big South All-Conference selection. She completed her career as UNC Asheville and the Big South’s all-time leader in assists with 5,904 and that record still stands today. Lorelee also holds the school and Big South record for most assists in a season with 1,852 set in 1996. She was the 1997 Big South Conference Scholar-Athlete of the Year and twice earned All-Region All-Academic honors.

Page 33: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

31/// F E A R T H E D O G ///

• A •Missy Allen, 1989-90Khristine Ambrose, 1997-00Suzanne Aubel, 1999-2003Kim Ayscue, 1990-91

• B •Shannen Bagge, 2006-07Jennifer Baker, 1996-99Suzanne Barca, 2001-02Aretha Barnes, 1990Jessica Beal, 1998-2000Tina Bell, 1989-90Pat Bembry, 1983-84Kelsey Benorden, 2007-10Tricia Bivens, 1990Angie Boyte, 1987-88Amy Breitenstein, 1989Kristy Brinkley, 1999-2001Beth Brown, 1996-98Mellisa Brumbaugh, 1991Kelly Budnik, 2000-03Judy Burgess, 1983-84Heather Burns, 2005-08Rose Butler, 2002-05

• C •Kim Camby, 1986-88Cindy Carswell, 1984Ursula Carswell, 1994-95Kim Cass, 1988-92Tracy Clark, 1985Rebecca Clausen, 1998-99Beth Cole, 1985-88Tonya Collins, 1994Jonette Corn, 1990Laura Cowart, 1996Karie Crisp, 1995-96

• D •Kelly Danielson, 1996-97Belinda Deyton, 1995Jaimie Dorfman, 2010-Jenna Dover, 2007-10Mellie Durham, 1992-95

• F •Ilona Fekete, 1990-92Samia Fercha, 1997Lauren Ficker, 2006-09Meredith Foster, 2010-Fonda Frady, 1985,1987-88Pam Freeman, 1992-93

• G •Paige Garland, 1998Cally Geiger, 1995-98Tina Gilbert, 1988-89Laura Glass, 1984Gina Golkiewicz, 1990-92Allison Green, 1998-2000

Sherri Green, 1986Alysha Greer, 2006-07Karen Griffi ths, 1983-84Kathy Griffi ths, 1986Kim Groendel, 1984-85Rachel Guinane, 2007-10

• H •Sabrina Harrison, 1996-97Danielle Hartman, 2004Krysti Havens, 2002-05Tiffanie Hazel, 1997Chandra Hicks, 1996-99Brenda Hollingsworth, 1986Bridget Holliday, 2006-09Brooke Holliday, 2006-09Jennifer Hutchins, 1990-93

• J •Jennifer Jackson, 1988Alexa Jacobs, 2005Emily Jacobs, 2002-03Una Japundze, 2009Linwood Jaycocks, 1997-00Jessica Jones, 1999-2002

• K •Chelsie Kenley, 2009-Rory Kelly, 2003-04Jessica Keys, 1998Samantha King, 1997Neecole King, 1991Anne Kuester, 1994-97

• L •Jenna Lahmayer, 2000Allison Lambert, 2004-05Melinda Lee, 2004

• M •Angela Martin, 1986-87Kaitlyn McDaniel, 2006-09Katie Meindl, 1999-2000Amber Mendenhall, 1988-92Danielle Meyer, 1990-93Marie Meyer, 1983-85Cindi Miller, 2008-11Raquel Miotto, 2006-09Adrienne Moore, 1999-2001Hallie Morse, 2010-11Kim Mosteller, 1985Angie Mulkin, 1986-87Megan Murphy, 2002-05

• N •Hannah Neal, 2001Karen Noffsinger, 1984-85Ryan Norman, 2002-03

• O •Kelly O’Grady, 1988-90

Talia Ogle, 2003-05Rachel Olivo, 2008-10Sara Orozco, 1983-84Kim Osborne, 1993-96

• P •Emily Palma, 2006Anna Beth Parlier, 2009-10Robin Pentz, 1986Joy Perez, 1998Sandra Potter, 1987-89

• R •Carrie Ramsey, 1999Jenni Reynolds, 1994-97Lisa Roberts, 1983Elizabeth Rodriguez, 1998-2001

• S •Jessica Salyers, 2003-04Lia Scott, 2008Stephanie Scott, 1994Mallory Schaffert, 2005-06Holly Shelton, 2009-Frida Sigurdardottir, 2000-03Regan Simpson, 2008Courtney Skillman, 1997Tammy Sluder, 1985-86Lorelee Smith, 1994-97Bonny Sneed, 2001Elissa Steffen, 1991-94Joan Sterk, 1983-84Alex Stewart, 2010-Tracy Stradling, 1986

• T •Heather Terrell, 1998-2001Courtney Tucker, 1994-96

• U •Elif Unlu, 2003-06

• V •Holly VanWagner 1986-87

• W •Angela Ward, 1999Rachel Wells, 2010-Monica White, 1988Leslie Whitfi eld, 1999-2002Kim Wieters, 1987-90Amanda Wiles, 2002-05Nikki Williams, 1985Dana Wilson, 1994Tracy Winfree, 1986Mary Wortas, 1986-87Ashley Wrightenberry, 2004-07

*Current players in BOLD

ALL-TIME LETTERWINNERS

Page 34: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

32 /// F E A R T H E D O G ///

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH CONFERENCE

Page 35: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

33/// F E A R T H E D O G ///

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerJames Companion

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Offi ce ManagerTerri Ballard

Assistant Director of MarketingMatt VanSandt

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing AssistantMelissa Estepp

Public Relations AssistantBriana Mayes

Administration/Multimedia AssistantEarl Laing

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Softball UmpiresBetsy Kidd

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Volleyball Offi cialsDaniel Leake

Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute

Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop

BIG SOUTH QUICK FACTS

Page 36: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

34 /// F E A R T H E D O G ///

Page 37: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

35/// F E A R T H E D O G ///

ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.

Vision

UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.

Mission

UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.

Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.

At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.

Alma Mater

In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.

Hail Our Alma Mater, Hail UNCA.

Learning be your watchword,Greatness be your way.

High upon the mountains,In the Land of Sky,

Stands our Alma Mater,Lift your voices high.

Noble Alma Mater,Hear our words of praise.

May we love and honor you,Until the end of days.

Page 38: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

36 /// F E A R T H E D O G ///

WWWWWWiWWWiWWiWWWiWiWiWiWWW hhhhthththth a a aaaabobobobobobbbobbobobobobooboboboututututuuu 333,77,700000 sstututudededeeeennntntntntttts ssssss frfrfrfrf omomomomm 4 4 444 44422 22 2 ststststatatatata esesese aaa aaandndndndndndndndndndndndndndndndndndndnndnddnnndnn 11 9 cococococoooooocoocoooooooooooocouuuuununuuuuuunnnuntttrtrttrtrt iieieies,s, UUU UUUUUNCNCNCNCNCNCCCCCCCNCCNCCCNCCCCCCNNCCCCCCCCCCCCCCCCCC AA AAAAAA A AAAAAAA AAAA AAAAAAAAAAAAAAAAAshshshhshshshshsshshshhheveveveveeveveeveeeeeevililillilillili leeleee is ononoonne off tthhhehe nnnnnatatiioo ’n’n’’n’n’nnn sssssssssstototototototototottottototttotoooopp pppppppp p p ppp p p p ppp pp pupupupupupupppuppupupupuupppppppppp blblblb icicicicc l l libibibibbbbbibbbbbbbererererererererererereerererralalaaaaaaaa a artrttsss s ununununuunivivvivererererrsisisisisisitititititit esesee a aandndnddnd o oooneneneee o o o offfff f fffffffff thththththththe eeee 17717177 ii insnnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnssnsn ttitiittttttttitututt titions in tttttttttttttttttttttttttthehehehehehehehehehehehehehehheeheheheehheeeeheehehee U U UUUUUU U UUUUUUUUU UUUUUUUUUninininininnnnininininininininnnninniivevevvevevevvevevevevevvevvvvvvvvvevv rsrsrsrsrsrsrsrsrsrssssssssitititittitttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NNNNNNNNNNNNNorrrthhhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaasyssysysysyssssyyystttttttttttttstssstemeemmmmmmm. . UNUNUNUNUUNUUNUNUNUNUNUNUNUNUNUUNUNUNUUUUUUUUUUUUUUUUUU C C C C CCCCCCCCCCCCC AsAsAshehehehevivviviviviviviviviivviviillllllllllllllllllllllllll eeeeeee ofofofofffefefefeersrsrsrrs mmmmororororre e ththhhhhanananan 333 3333 333333000000000000 00000 mmmmmmmammm joojoojojorsrsrsrsrsrsrss l l lll lllllleaeaeaeeae diddididididididiiddiiididiiidiiinnnnnnngnggnnnnnnnnnnnnggnnnnnnnngggg t to o ththe babababababababababababbababbbbbbachchchchcchchelelelelelelelelellelelelllllelororoorororororororororororooroorrrororrororrrorr ooooo oooo ooooooooooofffff f ff ffffff ffffff ffff f ff fff araararararaarararararararrrarrarararrrararrartststststtststststststtsstsssssss, , , , , , ,,, ,,, bababababaabababababbbababaabababbbabbabbaachchchchchchchchhchchhcchchchchchchchchchchhchhchchccchhchhhcchchhhcc eleeeeeeeeeee or ooooooooooof ffffffffffffffffffffffffffffffff scssscscsscscscscscieieeiiiiencn eeeaaanananna d d d d mamamamaaasttststststststereeeeeereeeeeeeeeeeeee oooo oof ffff fffffffffffff lililililililililiilliliiiiiiiiiiiibebebebbebebbbebebebbeeeeebbbbbbbbbbb rararararrrrrr l l lllll ararartstststtststssts dd ddd egegegegegrereeesesss......

HHeHeHeHHeH rererere a aa arerere a a a f f fewewewe m m morororee e eeeee ee fafafactctctsssssss ssssss anaaananaaaaaana d dd fi fi gugureeeeeereresss.s.s.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClClCCCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezezeeeezee:::::::: 20202020202022

MoMoMoststst P Popoppuulululaaarararaaaa M M MMaaaaajaaaaajajorororss ss sss bbbybybybybbbb E E EEEEEEEEEEEEEEnrnrrrrrrrrrololo lmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssyyyyyyyyyyysyychchhhhhhhhoooololoololoolooololololooolololoooo ogogogooogogoggogoogggoggyyyy,y,y,y,y,yy L L L LLititititittereererereere atatatturrrureeee,e,ee,e, EEEEEEEEEEEEnvnvnvnvvvnvvvvvnvvvvvnvvvviririrrrrrrononononnnnnonononnnnnnonnnnnnnnnnnnmmmemememeeeeeeemememmeeeeem ntntntntnntntntnnnnnnnnnnntnntn alalallalalalalalalalalallllalalalallalalaaaaaa SSSSS SSSSSSSSSSSSSSSSSSS SStututututututututtuuttutuutututututututtututututututtuuutuudidididididididdidddididdididdididididdddddidid esesesesesesesesesesesssseseesessssessesessseeseesssssesess, , , , , ,,,,,,, HeHeHeHeHeeH althth &&& &&&& WW WWWWWWWWWWWWWWWelee lnnesese sssPrPrromomomotottotioioioi nn,n, aaandndnd A A AAAAAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrtrrtrttrtrrtrtrtrtrtrtrrt

FuFuFuF llbllblbblbbbbbbbllbblllblblblbl ririr gghgghghghghhhhghghhhhhgggghgghgghgg t t AAAAAwwwwwwAwAwAAAAA arararardsdsdsssssssssssdssss: ::: ::: :::: 373737373737377773737737373737777733737337777377373 s s s sttututututt dddeeeeedeeeeeeeeed ntntntnttntntntnn s s hhavev reeeeceecececcee eieiiiiieieieiieivevvvevev d dddddd dddd ddd ththththhhhhhhhhhe e prprprprprprrprprprrppprprprrrrp eseseseseseseseseseseseseeeesttititittttttttt gigigigiouououous s s s awawawaawaawawawawawawawawwawawawawawaawwawaararaarrrrararararraarraraararddd

UnUnUnUnUUnnnnUnnnUUnnnddddedededddddddd rgrgrggggggrgrgrgrgrgrgrgrggrggggraraaaaaaaaaaaddduduuuddd atatatatatatataaate eeee e ReReReReReeR seseseseseearararchchchhc :: :::::: MoMoooorere tt thahahan hhhahahahahaahhhh lfffflfflffff o ooof f ffffff stststtttuuudududududdeeeeneneneeeenenee tststststss cc c c ccccccc cccccccccccccccomomoomplpplplp eetetetetetetttetettettteeeeeeeee e eeeeeeeeeeee orooorororrrrorrororororrroooo igiggggininininiininininininiini aaaaaaaalalaaalaaaa r rrrrrrrrrrrrrrrrreeeseeesesesssseseessseesse eeeeaeaeaeaeaeaeaeaae rcrrcrrcrccrcrcrcrcrchhhhhhhh h hh hhhhhhhhhhhhhhh iininiinninninnininiiinnnininnniiinnninnninnnn tttttttttttt ttttttt ttttttttttthhhhhhhhheehehhhehheheiririrrirr fi fi fi fififififi e e ee e eeeeeldldlddd o oooof f ffffffff stststststttudududududududduddyyyyyyyyyythththrorougugh hh thththhthhhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUnnivivivivivivivviviviiverererererererereeersisisis tytytyyyyyyyyyy’s’s’s’s nnnnnnnnnnnaaaatatataa ioioionananalllllly y y rrrrerererrr cocoooococoooognngngnnngnngngnggggg izziziziiizizzizzi edededdedededededddeddedddd U U UUUUUUU UUUUU UUUUUUUUUUUUUndndndndndndndndnndndnddnndndnddndndndddndnddddddereeeeeeerererereeeeerereeereeeereeeeeee grgrgrgrrgrgrgggggg ddddadadaddadduauauuuuauauauuuuauaaaauaaaateteteteteteeeeteteteeteeteetetttttttttteee R R Reeeseseseesesesesesesesseeseseeseeseseeseesseeseeseseseesseeeeeeeaeaaaeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhhhhh hhhhhhhhhhhhhhhhh hhhh hhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogoogogogogogogogoooggogooogoogogggoogogogogooggoo rrrarararaaarararraraaarrararaaraarraraaararraaaar mm.mm.m.mmm.mmmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCNCCC AAAA A AAAAshshshshhhhhevevevvvililililillleleleleleleleeffofoooooooof unundeeeeeeeeed d thtththhthhhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatitititititionononononononoo allllllalala CCCCCCCCCCCCCCCCConononnooonoo fefefefeferrerer ncnce e e onono U UUUUUUUnddndndnndndnddnnnn ererrrrerrrrggrgrgggg aadadaadaddadaddaa uauauuuauauaaauauuaauaaaauaaauaau ttttteteteteetttetttttttt R RR RR RRRRRRRRReseseeeesesesesesesesssesesesesesseeeeeee eaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhh h hhhhhh momoorere tthahan n 22222222525252555525522222225255525552222 yy yyyeaeeeeaeaeaeaeaeeaeeeeeeeeaeeeeaeaeaeaeeaeaarsrrsrsrsssrssrsrssrrrsrrrsrsrsrrssrsrsrrrsrssrsssss aaaaaaa aaaaaaaaaaaaaaaa goggggggogogogogoggggogogogogogoggoggoggggggggggg .

StStStStStStSStStS udddudududududdduddududdyyyy yyyyy yyyyyy y yyy AbAbAAA roorooooooooooaaaaaddddaa a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndnndnndddnddnnd S SS SSSSSSSSSSSSSSSSttuttuututututututututttt dddydydydyddyddddydydyddydy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeneenneneee t t tt oofofffooooooo sssss sssssstutututuuuuuuuuddddddddddededddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnnnn sssss ssssssss tatatatattaaaaataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaaaa a aaaaddddddddvdvvvdvvddvvdvvvanananannanannannnanananananannnanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegegegeee o o o oo oooo o o o ooooff ff ff ffff ffffff lelllleleleleellleeeleeeleeleleeeleleleeeeaararararararararaaaara ninininininininnininininnnnininn ngngnngnggngnnnnngngngnngngngnnnnngnngnnnnnngnnngnnggnnggngg ooooooo ooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp ororoooooooooooooooo tututtutuutttuuututuuuttttuuuttttuuuuuuuuunininininininn ttititttt esessss i iinnnnnnnotototottototoototootheheheheheeheheeheeh rr rrrrr ststststststtststtstatatatatatttatatatttteseseseseseeseseeeeee aaaanndndndddddddddddddddddddd ccccc cccccccccccccccccccooououooooo ntnnnntnttntnttntttrrrriririrrrirrirrirriiiesesess w whihihilele e enrnrnrololollllllllelelelellleeeleel ddd ddddddddddddd atataatatatatt UU UUUUUUU UU UNCNCNNCNCNCNCCCCNCNCNCNCNNCNCCC A A AAAAAAAAAAAAA A AAAAAAAAAAA Ashshshshshhshshhhhhhshshhhhhshshhhhshhshhevevevevevevevevevvevvevevvevevvveveveeveve ilililililllliillillilliiililleleleleleleleleleleleelelee... .

StStS ududenenenenenentttttt tt AAAAtAtAtA hlhlhlhlhlhllh eteeeteetttee e ee GGGrGrrGrGGradadadadadaaduauuauauauaaaaaaatitititititiititittitiononononoo RRRRRRRR Ratatatattttttatatttattttattteeeeee:e:eeeee:ee:ee UUUUU U UNCNNCNNCNNCCNCNCNCNC AAAA AA Ashhshshshshshevevevevevevevililililiililli lelllelelleee ss sssss sttutudeddentnnnnnnnntntnnnnnnnnnn -aaaththtthhththththhhthhthhthhlelelleleeeelelelelleelel teetetetetetetetetetetettteeeeeeeeeessssssssssssssssss s sss hahahahahahahahahahahhahaahahahahhhahahahhhhahahaahhh vvvevevevevvevvevvevevevee o oo ooooonenennn o of f ththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrarrrarraateteteteess sss iiniiininininni t ttttthhehhehehehe NNNNN NNNCACACACACACACACAA.A.A.AA.AAA O OOOOOurururururr ssssss stutututututut dedededededentntntntntntnn a-a-a-athththtttthleleleteteetes ssss ononononon a a a aththleleetitiitititicc c scscscscscscscchohohoohohoohohoooolalalalllallalalalalalarrrsrsrsrsrsrshihhihihhhhihihhhihih pspsps whoho p plalay yy alalaaa ll fofooooourururrurururrrurururrurur yyyyyy yy yyeaeaee rsrs aaattt UNUNCCCAAAsAsAshehhehevivivilllllle e hahahahavevevve a aaa 9 9 999 9 pepepepepeercrcrcrcrcrcenenenentt ttt grgrrradadadaadaduauaauatiititiioonon rrratatate.e.

FaFaFaFaFaFaFaaFFFFFFFaFaccucucucuucuc ltlltltltlty:y:y:yy:yyyyyyy 222222 2101010001001010100 fffff ffululululluullll-l-l-l--l-l-ll titititititit memememememememeeee f fffffffffaaaacacaa ulullululullultytytytytytytytyyyyyy mm m m m mmmmmmmememememememememeeeee bbbbebebbebebersrsrsrrsrsrsssr , , , ,, 84848448484848484848484%%%%%% % % wiwiwiwithththtthhhh tt tttttereeerererererrrmimimimimmmimimm nananaal l l dedeededeeeegrggrgrggrgrrggg eeeeeeeeeeeeees

COC PLAC: UNUNC C AsAshehevivillllee isiis thehe hhheaeadqdquauau rtrterers s fofor the e CoCCounncic l of PPububblilicc c Liberal Artsts C Coolleges, aa2727-mmemembeber r orgagaaninizazazattition of f state-supppporteed libebeberall arts collegegeges that rrrececogogninizeze t ttheee immpmportancncnceee ofoff liberal ara tsts a andnd s sccicieneenceccess ededucatiion for succesee s ss innn a comom lplexx g gloloobabab l soocicieeety.

CCCCaCaCaCaCaCCCCCCCaCaCCaC mpmpmpmpmpmpmpmpmpmpmpmpmpmpppus LifeRRReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeee Haalllls:s: Abob utu oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleeleeeeeeeeeeleleleeeee a a aaa a aaaaaaaaaaaaaanononnonononnononnooonoonnnnnnnoononnonnonnnnnn ththththththththththththththththtthththththhthhththththererererererererererererererererererereerererrerrerr tt t t ttt ttt tttttt tttttttttt ttthihihihihihihihihihihihihihihihhhihhhhihhihhhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrddrdrdrddddrr ll ll l ll llll l ll ll l iviviviviiviiviviviivivivivivivive withthini aa one-mileraraararaadidididddididdd usususususus o o oooffff ff fff ccacacacacaaaaaaaacaaaacccc mpmpmmmmmmmmmm usus.

AtAtAtAAAAAthlhlhlhlhletetettee iciciciccs:s:s:ss:s:: 1 115 5 5 55 NCNNNCNCNCNCNCNCNCCCCCCCCCCCNCCCAAAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetttettettttteteeet amamamamammamamamamamamamamamamaaaaaaaaaaa s s

StStStStStStStStStStStStudududdudududududududenenenneneneneneenennene ttttttttttt t GrGrGrGrGrGGrGrGrGrGrGrouoouououououououououpspspsps:: :: MoMoMoMoMooMoMoMoMoMoooM rerrerrererereereerrerreerrerereererr t t ttt tttthahahahahahahahahaahahahahahaaahhaan n n nnnnnnnn 6060606060060600600000 c cccccccccccccccccccclululululululululululululuuululuulullubsbbsbsbsbssbsssssbssbsbsbsbsbsssbsbb aa aa a a aaaaaaaaaaaandddndndndndndddndnddddndndndndnd ooo o ooo ooo o ooooooooooooooorgrgrgrgrgrgrgrgrgrgrgrgrgrgrgrgrggggananizzata ioionss, raaaaaaangngngngngngngngngngngngngngnngngngnnngnginininininininininninininininininniiininiinng g g ggggg ggggg ggg ggg ggggg gggggggggggggg gg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrrfrrrrromomomomomoomomomomomomomomomomomomomoommommmomomomomooo h hhh hh h hhhononononononnororororor s s s s ssococococococo ieieieieietititititieseseesss t ttttttttto o o oo o iniininnini trtrtttrtrrtrrrrrtrttrrtrrrrrrrrraaamamamamamamamaaamaaaamaaa urururururururrurururuurrrurruruurrururralaalaalalalallalalalalalalalalaaaaspspspspspspspsporororororroortstststst

Innnnnntttteteeercrcululuuuulltututututututtuuturaraaaraararral CeCeCeCeCeCCeCCeeCCeentntnttnttttttttttererererererererererererererereer & & &&&&&&&&&&&&&&&&& O OO OOOOOOOOOOOOOffiffiffiffififfiffiffiffiffififfiffiffiffif cccccc cc c e eeee ofoooffoffo MMMMM MMMMulululluuuluultititttitittticucuucucucucuucultlttltlttltturururururururururrurralalalalalalalalal SS S S S SS SS S SStututututututututuuudededededededededededeeededentntntntntntntntntntnnntnttnt P PPPPPPPPPP P Prorororoorororororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrramamamamamamamamaamama s:s Thee Inttttererererererererccucucucuuuucucuultlltltltuuururrurrrrrurrralalalalalalalalalalaal C C CC C C enenenennteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohohh uuususuususuususususususususssususuuuseseesesesseseseseseseseseseseseseseessssssseesssseessssesessscococooocoococococococococc ffmfmfmfmffmffmmfmmfmfmfm orrrororororororororo tttttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaccccaaa eseesesesesessssessessses f ff fff f ffffffffffffforororoorororororororororororr mmmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetititititititititittittingngngngngngnggggggngngngngngn s,s,s,s,s,s,s,ss,s,s,s,ss,s s ss s ssssooco ial eveveveneneneentstststt a aaaaa anndndndndddnd p p p p ppp pppppprogrgrgrgrrrrramamamamamss ssss ininininvovovovooooovovvoovov lvlvll ininnininingggg gg sususususususususuusussusuuuuchchchchchchchchchcchcchcccc d dd d dd d ddddivivivvvvvvvi erererererererssssesesssssssee groupppppss ssss asasasasasasasasasass AA A AA A AA AAAA Alllllliaiaaaaai nnnncncncncncccccccncnncncnccncncncnncnccccnnn e,e,e,e,e,e,e,ee,e,e,e,e,ee,e,e,e,e,,e,eeeeeeeeeeeeee,,,ee,,, BBBBlllBBBBBlaacacacaacacacaaaaa kk k kk StSSttttttStttttudududududuududeneeneneenenennnentstststststssssss A A AA A AAAAAAAsssssssssssssssococococoococococococococococo iaiaaiaiaiaiaiaiaiaiaiaiaiaiaiattititititititittiititititittitit onononononononononononononono , ,, ,,, , , , ,, InInIInInInInInInInIInInnnInntetetetetetetetttetteteteteternrnrnrnrnnnrrrrrr aatataaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududududdddudenenennenennenenne ttt t t tttttt AsAAAAsAsAsAAsAsAsAAssosososossosossss ciiciciciciiiiiiiatatatatatatattatatatttiioioioiooiooioiooioonn,n,nnn,,A AA AAAAsisisisssisisisis anannanannannananannnnaann SSSSS SStut deddddeeeeeeeeeeentnntnttnttttnttntntntttn ssss s ininnnnnnn A AAAAAshss eveveveeveevevvevevvvilille, , HHeHeHeHHeHHHHeHeHeHHHHH rmrmrrmanananaannan@s@@@s@s@s@s@s@s@s@s@s@s@@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@ss@s@s@s@OOOrOrOOOrrrOOrrOOrO gugugugugugullllllll ooooooosososos@@@@@ssss@@@@@@@ eeeeeen n nnnnnn nn LaLaLaLaLaLaas ss ssssssssssss AmAmAmAmAmAmAmAmAmAmAAmAmAmAmAAmAmmererererererrerererererererrericicicicicciciciciciccicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ( ((HOHOHHOHOHOHOHOHOHOHOHOHOHOHOHOHOHOLALALLLALAALALLLLALAL )))))))) annanananaannnananand ddddddd d dd d ddd HiHiHiHHiHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeeleee . .

ThThTTThThThThhThTThTTTThTTTTTTThThThhe eeeeeeee SShShShShShShSShhShShShShererererererererererririiiririririririirilllllllllllllll C CCCCCC CCCCCCenenenenenenenenteteteteeteteeeeeter:r:r:r:r:r:r:rr::r:rr WiWiWiWWWiWiWiWiWiWiWiWiWiWiWiWWiWilllmllmlmlmlmlmlmlmllmmlmaaa aaaaaaaa M.MMM.MMMMM.M.MMMMMM S SSSSSSSSSSSSShhehehheheeeheheeehheheheherrrrrrrrrrrrrrrrrrrrilililiiililiilillllll CCCeCeC ntntnttereree i iis ththhthheeeeeeee e unuuuuunununuunununnniviviviiiiviiivivivivererererererrerrrer isisisisisisisiiisisiisisisisisis tyttytytytytytyytytytyttytytytyyttytytytytyttyty’s’s’s’s’s’s’s’s’s’s’’ss’sssssssss nn n n nnnnnn nnnnnnnn nneweewewewewewewewewweweweweweeewwwesesesesesesseseseseseeseeeesessessttttt tt ttttttt aanaaaaannnnd d d lalaargrgrgrgesesessssssssessssst t ttttttt fffafafafaaaaaaaafaf cccccciiicccccccccciliiiitytytyty, ,, ooffffffffffffffffffefefffffeeeeeffffefefeeeriirr ngngngngngngngngngngngngnggngngngngngnggngggnngggggga a rarangngnggge e e ofoff aa acacacadededeeemimiimimimimic c c c cc ananananannnnddd d d d dd ououoouououtrtrtrtrtrtreaeaeaeaeaeaeachchchchchchcchhh p p prrorogrgramamss fofocucusesed d ononononnn hhhhh h hh heaeaeaeeaaaeeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy llll l l lllliviviviiviviviivvvvininininiiininng gg gg g ggg ananananananananananananand dddddd dd dd weweweweweeeeweewwwww lllllllllllllllllllllneneneneeneneneneneneneneessssssssssssssssssssssssssssssss pppppppp pp ppppp p p pprororrororororoororrrrororororroroooomomomomommmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeecececececeecececccc nnntntnterere iii iis s s hohohomemmmemee tt ttooooo o thththhhththhheeeee eee acaacacacacaca addadadaddadadememememmemiciciccicicic DDDDDDepeeppparararartmttmeeeneent t fof HHHHHHHHHeaeaaeaealtltttthh hhhh ananaa d d WeWWeWWWWWWWWWeWWW lllllllllllllll nenenn sss, wwithhhhhhth c clalaassssrooroomomommomss,s, ddddddededededeeededdicicicccciicicatatattttttededddedededeeded sssssss ss spapapaapapapapapapapapacecececececcececececececececececcececececeececeffofofff r r unundedergrgr rar duate researchh, a hiighghghghghg -tech tttet acachingngngnngng/ddememmonoonstststs rararar titiononnn kkitittttchchchchchhhhchhhchhccheneeenenennnennnnnnen, , , , , ,, ,, ,,,,,, ananand d d rereeeseseseseeseeeararararararararaaaarraraaaarararraraaraa chchchchhhhhhhcch aaaaa aa aaaaanndndndndnnd lleaarnnininnngggggglalalalalal bsb .Theee S SSherrrrrriliiiiii l Ceeeeeeeenter includeeeeeeeeeeeeeeeeessss ssssssss ssss anann e eexpxpxpxxx ananansisisiveve fififi fifi tt tnenenessssss c ccenenenenennneennnttttetetetetetettetteeerrrr,rrrrrrrr,rrrrr,rrr aaa a aa b b bbioioioioiooiooioioooioi fffefeffeefefeffefffefeffeeeeededededededededdeddeededdde bbabababababababbababababbabaackckccckckckckckckkcckkckckckckcckckcck lll l lllababbababaababababbbbb aa a aaaa nnndndd mmmmmmmmmmmmmmedededdedededddddddddddddddititiittttiitittititttatatatatata ioioiooion n rrrrrrrorrrrrrrrrrrroomoomoomomomommomomomommomomooooomooo , , , anananaaa d tththththththhtththht eee eeeee WWWWWWeWeWeWWWWW lllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé

KKiKiKK mmmmmmmmmmmmmmelelelelelelele A AAAA A A AAAAArererereerrrenananananana::: : : ThThThThThThe eeee neneneneneeww ww KKiKKKK mmmmmmmmmmmmmmmmmmmmeleleleleleleeelee A AA AAAA AAArereerenanana, , wwwhich issis p pararara tttt t ofofofofofofofofofoffofof t t t ttttthhehehehehehhh SSS hheherrrrrrr iiililll CeCeCeCeCeCeCeentntntntntntnttnttntnterereerereererr, ,, , , caccccacacacacaccccann nnnn n seseseseseeeataatatatataaaaatttat uu u u uu uup p p pp pp tottoooooooooo 3 3 33,8,8,8,8,8888,8,88888, 000000000000000000000000peopopppppopopppleleelelleellelle f f f f f ffffffforororororororooo ccccccconononononncecececeecertrtrtrtrtr s,s,ss,s, c cccccomomomomomommmemmemmencncncncncncccnccceeemememememememeemememeneneenenennennnnnentstststs, , , cocoonnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttc ururururururuuru esesesese ,, , , , , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig atatatatatatatatataaatta ee ee eee e e e memememmemmemeemem nn’n’n’n’nnnnn s s ss sss anananananannnnddd ddd d d wwowowowowowww memememeemeeem n’n’n’n’nnnnn s s ssss babbababababaaababbbbaabaassssss----s--ssketbbbbbbbbbalaalalallalallalaa l lll l llll gagagagagagagagagagggagamememmememeemmmes,s,ss,s,ss h h hh hheaeaeaeaeaealtltltltltlthh h h h h fafafafaffairirriririrs,s,sss,s aaa andndddddddd c ccc c c cc cc cccccomoomomomomomomomomomoo mmmumumummmmmmm nininityyytt eeeeventtts..s AsAsAA hehehevvvvviviiiillllllllle e e eeeeeee cococoooooocococooommmmmmmmmmmmm unu ity..

Page 39: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

37/// F E A R T H E D O G ///

KuKuKuKKKKuKKuKuKuKKuKuKuKuKKKuKKKKuKuKuKuKKKuKuKKuKuKuKudodododododododododododododdododdododdddoododdddododoodosssssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUUUNNUUNNUNNNNUU C C C CCCC CCCCCCCC AsAsAsAsAAAAsAAsAsAAAsAAsAAAsssAsheheheheheheheheheehheheeheeheeeeeheeeeevivivvivivivvivivivivivivivivvv llllllllllllllllllle ee e e ee eeee ofofofofofofofooooffffo fefefefefefefefefefefeefeeeeeeeeeeeeefersrrsrsrrsrssrsrsrrssrsrsrrsrsrsrsrs a a aaaa aaa aaaaaaa ““““““ “““ “““tototototototttotttttooooot p-p-p-p-p-p-p-p-ppp nononnononononononoonononooonotctctctctttttcttttcccttcttt hhh h hhhhh hhhh acacaccacacacacacacacaacaaaa adadadadaddadadadaddadadadaddddda ememememememememememmeemeemeeememeemememmmiciciciciccciciciciccccicci e e e e eeee xpxpxpxpxpxpxpxpxpxpxxppxxpxxpxppxpperereeerereeereereeererrerieieieeeeieiieienncncnnccccncncccncnn e,ee,e,e,e,eeeeeeeee,e,,, ”” ””” ” ”””””” anananananananananananananana d,ddd,d,d,ddddd,ddddddd,d,d,d,d,d,d,ddd,dd b bbb b b b bbb bbbbbasasasaasasasasaaa ededededededededededededeeedeeeedee ooo oooooo oo oon nnn nnnn n nnnnnnn stststststststststsstststssssststududududududududdududuuuuuuuddeneneneneneneneneenneneneeennnnennnnnnnt tt t tttttt tttt ttt t tttt sssusususususssss rrvrvrveyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseseseeeseeeee popopopoppoppppppppp nsnsnssn esesesesesesssesssssss, , , , , ,,,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAAsAsAssAssA hehehehheheheheeeehehheeheheheheevivivivivivivvivivivivvvivvivviv llllllllllllllllllleeeee e eeeee eeeee ee isisisisisisisisisisssss r r r r r rrrrrrrr ranaanananannananananannaaaanaaanaanaa kekekekekekekekekekekekekeekekekkkkeekeeeekedddddddd dddd dddd d d d 11111111111111111111111111111thtthththththththtththththththhthtttttttt i i i ii iiiii iinnnnnnnnnnnnnn nnn n ththththththththththththhththhthththt eeeeeee ee nananananatitititttiititittitiitititt onon o on n ththee “c“colollelegege c citity y gegetsts hhigigh mamarkrks”s” lisst. - TThehe P Prir ncncetetonon R Re-e-viviviviv ewewewewewewewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTThee e e eee e e BeBeBeBeBeBeeeeBeBeBBeBBeeeBBBeB stststsstststststststtstttsttststttsstssts 3 33 3 3 3 333 333333333777777777777777777777777777777777777777 C C C CC C C C CCCC C CCColololololooolollooololoolooolollelelelegegegegeggggggggggggg s s s - 202202020013131313133 E EE E dididitititititiononononn”” (A(A(A(AA((((((((((( ugugugguguggggggggggggusuususussusttt tt t t 20202020202201212121222)))))))))))))

UNUNUNUNUNUNNNUNNUNUUUNUNU C CC CCC CCCC AsAsAsAsAsAsAAsAAsAsAsAsAsAssshehehehhhehehehheeeheheeheviviviviviviviviivivvvv lllllllllllllllleee e e ee e ee rararrararararararararrrr knknknknknknknkkknknknkknknkkknkknkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n ququq alalitty y ofofo teaeaching, carareeeerr prprprprpprrprrrprprrpppppp osososososospepepepepepepeeeeeep ctctctcttttcccccccccccccc s,s,s,ss,s,s,ssss,ss g gg ggg ggggg ggrarararaaaararaaraaraarraduddududududududududududududududduuuatatataattaatataaaaaatiiioioioiiiioioioion n n n nnnnnn rrraaaarraraaaatet s,s and sstututudedededed ntn debebe t leeveel..Off theeehe e e igigiggghththhththhh u uniiveersrsititieies s inin N NNoororthth C CCararolo inina a aa aa a aaa ththhthththththtthththththatatatatttataatatatatatatatat mamamamamamamamamamaaamamamm dedededeededeeedeeedededd ttttttttt ttttttthehhhehheeeeeheheheehehehhheeheehehhee ll llllllll llllisisssssssississssssissssisst,t,t,t,t,t,tt,tt,ttt,tt,t,ttt o oo o o o oo oooonlnnnlnllnlnnlnlnlnlnlnlnllllllln yyyyyy y y yy y y yy yyy y yy yyy UNUNUNUNUNUUNNUNUNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-C ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higigheher r thhthhhananana U UUNCNCNNN AAshsheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeeepapapapapapapapapapaaapp rererererereererererererrererr d d d dddd d ddd dd dddd bybybybybybybybybybybybbybybybybyy thththththththhthhttt eeee e ee CeCeCeCeCeCeCeCeCeCeCeeeeeeeCeeeCentntntnntntntnnnnnnnnnn ererererrerrrrrrrr fff f ffffff fffff ooororrorooorororororrorororrrorrorroo CCCCCCCCC CCCCCCCCCCCCoooolololololoolooooo leeeeeleleeleegegegegegegeggee AAAAAAAffffffffffffffffffffffffororororororororororororoorrrdadadadadadadadadadadadaddadadadaabibibibibibibibiibiiilililililillllllllll tytytytytytytytytytytytytytttyyy a a a a a a a aaaaa aandndndddndndndndnddnndnndn PPP PP PPPPP PPPPPPPPPPrororororororororoorororoooooroodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc ivivivivivviviviivivivivivvvvititttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyy.y - - - - -- F FF Fororororororororororororrororrorrro bebebebebebebebebebebebebebebbess s s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagagaagagagagagagagagagagagaggagaggaaaziziziziziineneneneneneneneenenennene ( ( ( ((( (( ( ((((AuAuAAuAuAuAuAAuAuAuuAAuuA guguguguguguguguuguuguguuguustststsststsssss 2 2 2 222 2222010101001000000 2)2)2222222222

“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“U“U“U“U“U“U“UUUNNNCNNCCNCNNNCCNNNNCNCNNCCCNNNCNNCN A AAAAAAAA A A AAAAA Ashshshshshshsshsshshshsshshs eveveveveevvvvvvvvveeevvvviilililililililililiiilllii leleleleleeeeeeeleleeee a aa a a aaaaaaaaaaaaaaaaaandndndndndndndndndndndndndnndndndnnndn t ttttttttttthehhheheheheeeeehhehhheehee c cccccccititititittitityy yyyyyy yy ofofofoffffofoofoffoffo A AAA AAAAAAAAAAAshshshhshshhhhhhhshshhheveveveeeveeveveveveee ilililillillililllillelelelelelelelleeele aaa aa a arererererreereree ssss s steteeetetetetetteeteteeepepepepeepepepepepeeppeppededddeeddedddededdd iiiii ii i iii innnnn nnn whwhwhititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhhwwhwhw erererereeereerereree e e e e e e eeeeeeeee elelelelelellelelleleele sesesese inininnninininnnninnninnnnn t tt tt ttttthehehehheheheheheheheheeheehehheheeeeeh w w w wwwworororororororldlldldlddddddlldldldlldldldddddddddlddd.................. . AsAAAsAsAsAsAsAsAAAsAsAsAsAAAsididididdidididididiiddidddiddididiiddiii eeee eeee fffrfrffrrfffffrfrfrffffffffffrfff oooooomomomomoomoooo t theeheirir l llonoononong g g g lilil ststtt oo of f fi firsrst t dedeeeescscs enentsts a andndnd r racace e e iiiwiwinsnsnss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAsAsAsAshehehehehheheheevvivivvvvvv lll e e alalalalalallalalalaalaalalumumumummummmumummuu s ss ss ssssss ss sss anananananananannnddddd ddd ddddprprpppprprpprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsooooo o oooooooooo gigiiigivevvevvvvvevvvveev b baaaaacaccacccccacacaack kk k toto tt theheh p padadddldldldlininii g g gg cocommmmmmmm ununititty.y.yy”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror SSchchoooooooooooolslslslslslslsllsslsl i ii ii i i iii i iiin n nn n n nnnnn nnn ththththththhththththhththhee ee ee e e e eeeeBllueueueueueueu RRididgege,”,”””””””””””””” B B B B Bllllulullllllll e e RiRidgdgggggee eeeeeeeeeeeeee e OuOuOuOuOuOOOOuOOuOuOuOOutdtdtdttdtdtdooooooooooorsrsr ( ( (((((((((AuAuA guguggugggggggggggg stst 2 22222010100112)2)

UNUNUUU C C AsA hehevvvvvviviviviiivivivvvivvvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisissisisisiisisisissisisssssssss ““““““““““ ““ onononononononononooonononnnnnonooo eeeeeee eee e ofofofofofofofofofofofofoofofofofofoooooofof tttttttttttt t ttthehehehehehehehehhhhheheheheheehehheheeee bbbb b bb b bbbbbeseeseseseseseesesessseseseesssessssttt t t t ttt t ttt t ededededededededeedee ucucucucatatioiooonanann ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononononononoooonononononnnnnno sesessesesesecucucucucucuccuu itiitiiiititititititiiit veveveveeveveveeee y y yyy y yeaeaeaaeearsrsrsrsrs,, ,UNUNC C AsAshehevivilllllllllllllllllllleeeee’e’e’’e’eee’e’eeeeeeeeeee s ss s s s s ss ss EnEnEnEnEEnnEnnvivivivviviviviviv rorororoorooonmnmnmnmnmmnmnn enenenennentatataatatallll l StStSStSttttStudududuuduuuduuuu ieieieieeees s s s s s s s PPrPrPrPrPrPPPrrrogogogogogogoggrararararararararam m mmmmmmmmm hhahahhhhhhahahhhhhahahahas s s ssssss bebebeebebebebebebebeeebebebeebebbeenenenenneeneneneneneeeneene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeedededededdddd ttttttttt t ttt ttoooooo oo o ooo ooo thththththththththththhththththththeeeeee eeeee eeeeeee lilillililiiliststststststtststststttttttt ooo oo oo o o oof fff prprppppp e-e-prprofoffoffffffffofffffffffffffo eseseseseeeseseseesseeeeeeeee sisisisisisiiiononononoononnonalalaalaalaal ppp p pprorororrororororoo--grgramams s wiwithth u unuuuunusususususususususususususussuuualalallaaalalaalallalalalalaala ssssssss sssssstrrtrtrtrtrtrtrtrtrtrttrtrttrtrttrrrrrreneneneneenennenenennnnnenenenne gtgtgtggtggtggtgtgtggttgtgthhhhhhhhhhhhhhhh hh ininnininininiinininininnnnnnn p p pp pp pppp p p p ppp prererereerererereererererereepapapapapaapapapaapapapapapapapappp rriririririririririrrirrriririrrrir ngngngngngngngngngngngngngngngnnggngnnnggn sssssssssssss s s ssstututututututututtuuutututuutututuututudedededeededeeeededededededeeeeentntntntnntnttntntnttntntnnntnn sssssssssss s ss fofofofofofofofofofoof r r rrrr rr cacacacacacacaccaarererererererereerererererreers.ss.ss. - -- T TTTT TTThehehehehhehehhh F F FFFFFFFFFFisisisisisisisssskekekekekekekekkekeke G GGGGuiuuuuiuidedddedeededee t t tttt ttt to ooo ooo CCoCoCCCCCCCoCoCoCoCoC llllllllllllllll egegegegegegegegegeegeggesesesesessesseessseseess, 2020202020200202020001313333 EdEditioi n n (J(Jululy y 202012122)))

UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges andd uuniniversr ittiees.s -- TThehe PPriincncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeen n Colllegegese for 2012” (April 2020112))

UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded as a a “B“Beest VaV luue”e” p pubbliic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)

UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbublililic cc c c cocolllll eggegggess, ,, iwithth tthehe fi fif fththhhh l lowowowowowesestt tototatall cost of f ffaattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , ,, ,,,, annananananddddd d thththththe ee ee ee eieieighghghghgg ththth l l lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededdebtbttbtbtbt aa a a amomomomomomomomomonnngngngngnggg gg g ggrrarar duduatatatatateses. . -- Kiplpppp inininniingegeer’’s ss s PePP rsrsrsrsr onalalalalaa F Financee MMagazinene ( ( ((((((JaJaJJaJaanuunuuununn aarararararra yyyy y y yyy 20220202020202202020121222212122212))))))

UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAsAshehehehehehheeheh viviviviviv llllllllllllee e e ee rarararaaaarararraanknknknknkkkkkknkkkssssss s s eeieiiieeieeighghhghghhhhhhghghgg tththththththhhthth i i i in nnnn ththtthttththeeee ee e e nanananananananannatitititititititittt ooonononnoooono a aaaa a aaaamomomomomomoomomm ngngngngngng PPPPubububbblililil ccc c c c LiLiLiLLLLiLiLiLL beebeebeeeeebbbb raalll l AAAArrrrtstststststststs C CCCCCCC CCC ooooolololoolo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarorororororororrorororor lililiililiililinananannanaana ii ii iiinsnsnsnsnssnsnsstittititiitttttiiit tutututuuuuuuututitititittititiononononnonononnnnnnnnoonn llllll ll lll isisisiisiisisi tetetettteettttt ddd d ddd d dd amamamamaamaaaamonononnnnononnnongg g gggg NaNaNaNNNNaNNNaNN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseseseseeeses whoooooooooosesesesesesesesse sssssssstutututuuuututut denntttttttsss s s ggrgrrrrrrrgg aaaadddaddddduauauauauauauau tteteete wwwwwittttti h hh h ththththththththt e eeeeeeleleeeleeeleeeaasasaaasasaaasasasasastttt t t t t ttt t t ttt amamamammamamamamaaamamaamououououououountntntntntnn ooooooof fff f f dededededededededd btbtbbtbtbtbbtbtt. .. - - - U.U.U.UUUUUUU S.S.S.S.SSSS. N NN NNNN Newewewwwss s & &&&&& &&& WoWWoWoWoWWoWorlrlrlrrrlr d d ddddddddd ReReReReReReReReReR popopopopopooortrrrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ ““““AmAAmAmAmAmmmmAmmeeeereee ica’s Best Colleges” ((SeSeptpteemmmmmbebebebebebeb rrr r 2000000000111111111111))))))))

UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAssAsAsA hehehheheheheheheheehehheeeevivivvivivvivviviviviviv llllllllllllllllllllllee e eee iiiiiiisisisisis oo oo o oneenennenenenneeeee ooooo oo oooofffffff fff f f f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiciiiccic ’’’’’a’’’a’aaa sss ss “1“1“1“1“11“1“1“1111000 0000 0000 0 000 BBBBeBeBBeBeBeBeBeBeBeBestststststststtststss CCC C C CCCCCCCCCCCCC lllolololoololollolololololo lllleleleeelelelelleleleegegegegegegegeegegegeggegegges ss s s fofoof r r hthhhthe e e e MoMMoMooMMoMMooonenneneneeenen y.y.y.yyyyy.yyyyyy”””” ” --- -- BaBaaBaBaBaBaBaBaBaBaBaBBaBaBaBanknknknknknknknnnknknknnknnkrarararararararr teteeeeteteteteeteee c.cccccc.cc.cc.c.c.comomomomommomomomommmom, aa aaaa lelellll adadadadadaddadadddddininninnininggg g ggg gg gg g gg g g ggggg ooononononononononlilililililineeneneneenene sosososooosoososourururururuuruuurururururrrrururrurrcececececceccecececececcceccececeecececececeececcecece ooo o oo oo o ooo o offffff f f fff f fifififi fi fifi fifi fi fififi fifi fi fifififififinananananananananananannannanananannnaaan ncncncncncncncncncncncncnnncnn iaiaiaaiaiiaaaiaiaaaaaaial ll ll ll l llllllll ininnninnfofofooofooooooooooormrmrrmrmrmrmmrmmmrrmmmrmrmmmmr atatatatattataaataaaatatatattataaa ioiooooioiooooioioioooiooooi nnnn n nnnn nn nnnnnn (J(J((J(J(J((J(J(J((J(J(J((J(Junununnnnunnunuununnununnnunneeee e eee e eeeee e ee 20202020202020202202020202002202222011111111111111111111))))))))))))))))

AdAdAdAdAdAdAdAdAdAdAdAdAA mimimimimimimimmmimmimimimmmmimiiisssssssssssssssssssssssssssssss ioioioioioioioioioiioioioiooioioooonsnsnsnsnnsnsnnsnsnnsnnnsssMiMiMiMiMiMiMiMiiMiMiMMMiidddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%0%0%0%0%%0%0%00%0%0%%%%0%0%0%00%0%00000%0 o oo ooooo ooooooooofffffffffffffff ff fffffff ininininininininnnnnnnnnnnnnccocococcocccococococcccccococococcococcooccccccccc mimimimimimimimmmmimiinngnngngnngnggngngngnnngnngnnnngnngggggg f ff f fffff ffffrererererererreeerererrerrererereererrr shshhshsshsshssshsshhhshhhshhhshssss memememememmemememmemememennnnnnnnnnnnnn nnn n SASASASAAASASASASASASASASASASASAAASASASASASASASAASAAAATT TT TTTTTTTTTTT TTTT TTTTT TTTTTTT sscsccssscsscs ororororrrrrrrorrrrorrorrrrrrrrrroo e:e:e:ee:e:eee:eee:e:e:e:eeeee 1 1 11 1 1111100900090909009090900900909099990-0-000-0-0-0-0-000000-0-0-00-00-0-00-0-0000 1211122121222221211211221212221221211212125050050505005005000505050050505050505055555550000 ( (((( (( ((( (( (((( ((((FFFaFaaFFaFaFaFaFaFaaFaFaFaFaFaFaFaaaFaalllllllllllllllllllllllllllllllllllllllllll 222222222 2 22 2 22 222 2 222222 010100101010101010101010010100010101010100101011010110110 1)1)1)11)111))1))11))1))))11)1))1)11)

AnAAAAAAAAnAAAnAAnAnAnAnAnAAAAAA nnnununuuununnunuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-nnn-n-nnn-nnnnnn StStStStStStStStStSttttatatattatattee e eee eeeee ee eeeeee TTTuTuTTuTuTTuTTTuTTuTuTuuitittititiii iioioioionnnnnn n n nnn ananannaaaaanaaaaaaaa dddddddddddddd d dddd FeFeFeFFeFFeFeFeFeFeFeFeFeFeFeeeeesesesesesseseseseseseeeeeeese :::: : $5$5$5$55$ ,3,3,3,3,,33333,33333333333333939393939393939939939939999939999 (((((( ( (((((((( ((((2020202020202020202020202020202222222 11111111111111111111111---111-1-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))

AnAnAnnnAAnnnnnnAnnnnnnunununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StSStSttStS atatttatattttttttteeee eee e eee TuTuTTuTuTuuTuuTTTuuTuTTuTuTuTTTTuTTuuTTuTuuuT itittiititiitititioioioioioioioioon n n aananananananaaaaaaanannnnd d FeFeeeesesesesesesesesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$$1$$$$$$1$1$1$1$$ 9999999999,99999999999,9,000202020220020020200202000220202002000000222000002222202202002025555555 555 5555 5 555555555 (((2(2(2(2(2(2((2(2(220010101111111-1-11-1-1-1-1-11-122212122222222222))))))))))))) ))) )

AvAAAAAvererreerereereraagggagagagagaaaagagagggee e eeee e AAnAnAnAnnunununnunnn alalalalallllllllll HHHHHHHHH H ououuusisisisisingngngng aaaa aaa anndnddddddndddddddnddndndnd MMM MMMMMMMMMMMMM MMM MMMMM Meaaaeaeaaeaeaaeaeaeaeaaeaeaeaealllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $ $$$7,7,7,7,30330303 222 2 2 2 (2(2(22(2(2222222(22(2222(( 00000010110100 1-11111 12121221212122) )

FiFiFFFFFFFiFiFFiFFFFFiFFFiiinananananannanananananannncncncnccccccccccnccciiiiaiiiiiiiaiall l AAiAiAiAiAiAiAiAAiAAid:d:d:d:d:dd:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla fffffffff ff ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s s ssss rererereereerereeeeerer ccceceeeceeceeececceeceeecec iviviviivivvvvvvvvivvivivvviviivi ee ee e e eeeeeeeee fi fi fi fifi fifififififififififi fi fi nannanananananann ncnciaial l aiaiiid,dd,d,d w www wwiititittititittthhhhh hh hhhh h h h momomomomoomorerererereerereee tt thahahhahhhahahahahahahhhah nn n 8555585858555 p pppppppereerererereeee ccecececccecccececececececeeentntntntntntntntntnnn oo ooooooffff fff ststststtududududdududududududuuduududdudeneneneeneneneneeeneneneneneennnttttststststttstststs’ ’’ fi fi finannn ncnccccccccciaaiaiiaiaiaai l ll neneneeeneneenenennn edededededededddde m mmmmmmm mmmmmmmmmeteteteteet..

Page 40: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

38 /// F E A R T H E D O G ///

Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission state-ment.

With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.

During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Colleges and several majors in Religious Studies and Anthro-pology have been added to the curriculum. Dr. Ponder has encouraged innovative collabo-ration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Systems, the City of Asheville, the Re-naissance Computing Institute and others for enhanced learning and research opportuni-

ties for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.

Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Caro-lina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with count-less others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.

A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.

Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.

Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”

A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.

DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE

Page 41: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

39/// F E A R T H E D O G ///

Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events

from concerts to graduation.

Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.

Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.

In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.

In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.

Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.

JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES

Page 42: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

40 /// F E A R T H E D O G ///

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”

In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

Page 43: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

41/// F E A R T H E D O G ///

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR

Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS

Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

Page 44: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

42 /// F E A R T H E D O G ///

Judith BohanBusiness Manager

James WestfallAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Lydee BenoitAssistant Volleyball

Coach

Mary CaseyAssistant Women’s

Soccer Coach

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

ASHEVILLE SUPPORT STAFF

Eric LinnellAssistant

Athletic Trainer, ATC

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Sherrill

Center

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Janell CraytonAssistant Women’s Basketball Coach

Russ GardinerAssistant Women’sBasketball Coach

Nick McDevittAssistant Men’s

Basketball Coach

Joel WilliamsAssistant Track & Field

Coach

Adam PuettAssistant Cross Country Coach

Honey BrownAssistant Women’sBasketball Coach

Donna PeekAdministrative

Assistant

Brady BurreshDirector of Facilities

Jim WallaceAssistant

Athletic Trainer, ATC

Omar AhmadHead Strength &

Conditioning Coach

Page 45: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

43/// F E A R T H E D O G ///

Brenda Mock KirkpatrickWomen’s Basketball

1st year as head coach

Michele DemkoWomen’s Soccer

3rd year as head coach

Matt KernMen’s Soccer

3rd year as head coach

Tom SmithBaseball

4th year as head coach

Jesse NormanCross Country/Track

6th year as head coach

Elizabeth LykinsWomen’s Swimming

1st year as head coach

Lise GregoryTennis

6th year as head coach

Eddie BiedenbachMen’s Basketball

17th Year as head coach

Frederico SantosVolleyball

2nd year as head coach

UNC ASHEVILLE HEAD COACHES

Page 46: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

44 /// F E A R T H E D O G ///

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

Page 47: 2012 UNC Asheville Volleyball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

45/// F E A R T H E D O G ///

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

Page 48: 2012 UNC Asheville Volleyball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

46 /// F E A R T H E D O G ///

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

BULLDOG ATHLETICS ASSOCIATION

Page 49: 2012 UNC Asheville Volleyball Media Guide

2012 SCHEDULE2012 SCHEDULE Aug. 24 vs. ETSU (Gamecock Inv.) 10 a.m.Aug. 24 vs. ETSU (Gamecock Inv.) 10 a.m. Aug. 24 vs. Akron (Gamecock Inv.) 3 p.m. Aug. 24 vs. Akron (Gamecock Inv.) 3 p.m. Aug. 25 vs. Temple (Gamecock Inv.) 10 a.m. Aug. 25 vs. Temple (Gamecock Inv.) 10 a.m. Aug. 25 @ South Carolina (Gamecock Inv.) 7 p.m. Aug. 25 @ South Carolina (Gamecock Inv.) 7 p.m. Aug. 31 vs. New Mexico (Tiger Inv.) 11 a.m. Aug. 31 vs. New Mexico (Tiger Inv.) 11 a.m. Aug. 31 @ Savannah State (Tiger Inv.) 3 p.m. Aug. 31 @ Savannah State (Tiger Inv.) 3 p.m. Sept. 01 vs. Maryland E.S. (Tiger Inv.) 11 a.m. Sept. 01 vs. Maryland E.S. (Tiger Inv.) 11 a.m. Sept. 01 vs. Southern Utah (Tiger Inv.) 3 p.m. Sept. 01 vs. Southern Utah (Tiger Inv.) 3 p.m. Sept. 04 WESTERN CAROLINA 7 p.m. Sept. 04 WESTERN CAROLINA 7 p.m. Sept. 07 @ UNCG (Spartan/Aggie Inv.) 7 p.m. Sept. 07 @ UNCG (Spartan/Aggie Inv.) 7 p.m. Sept. 08 vs. American (Spartan/Aggie Inv.) 11 a.m. Sept. 08 vs. American (Spartan/Aggie Inv.) 11 a.m. Sept. 08 @ N.C. A&T (Spartan/Aggie Inv.) 7 p.m. Sept. 08 @ N.C. A&T (Spartan/Aggie Inv.) 7 p.m. Sept. 14 vs. Towson (49er Inv.) 4:30 p.m. Sept. 14 vs. Towson (49er Inv.) 4:30 p.m. Sept. 15 at Charlotte (49er Inv.) 12:30 p.m. Sept. 15 at Charlotte (49er Inv.) 12:30 p.m. Sept. 15 vs. Kennesaw State (49er Inv.) 4:30 p.m. Sept. 15 vs. Kennesaw State (49er Inv.) 4:30 p.m. Sept. 21 @ Gardner-Webb* 7 p.m. Sept. 21 @ Gardner-Webb* 7 p.m. Sept. 28 RADFORD* 7 p.m. Sept. 28 RADFORD* 7 p.m. Sept. 29 LIBERTY* 6 p.m. Sept. 29 LIBERTY* 6 p.m. Oct. 05 @ Winthrop* 7 p.m. Oct. 05 @ Winthrop* 7 p.m. Oct. 06 @ Presbyterian College* 2 p.m. Oct. 06 @ Presbyterian College* 2 p.m. Oct. 12 GARDNER-WEBB* 7 p.m. Oct. 12 GARDNER-WEBB* 7 p.m. Oct. 19 CHARLESTON SOUTHERN* 7 p.m. Oct. 19 CHARLESTON SOUTHERN* 7 p.m. Oct. 20 COASTAL CAROLINA* 6 p.m. Oct. 20 COASTAL CAROLINA* 6 p.m. Oct. 26 @ High Point* 7 p.m. Oct. 26 @ High Point* 7 p.m. Oct. 27 @ Campbell* TBA Oct. 27 @ Campbell* TBA Nov. 02 PRESBYTERIAN COLLEGE* 7 p.m. Nov. 02 PRESBYTERIAN COLLEGE* 7 p.m. Nov. 03 WINTHROP* 2 p.m. Nov. 03 WINTHROP* 2 p.m. Nov. 09 @ Liberty* 7 p.m. Nov. 09 @ Liberty* 7 p.m. Nov. 10 @ Radford* 4 p.m. Nov. 10 @ Radford* 4 p.m. ALL CAPS - HOME GAMES * - BIG SOUTH CONFERENCE MATCH ALL TIMES EASTERNALL CAPS - HOME GAMES * - BIG SOUTH CONFERENCE MATCH ALL TIMES EASTERN

Page 50: 2012 UNC Asheville Volleyball Media Guide