2011 the LuxS-Dependent Quorum Sensing System Regulates Early Biofilm Formation by Streptococcus Pneumoniae Strain D39

7/28/2019 2011 the LuxS-Dependent Quorum Sensing System Regulates Early Biofilm Formation by Streptococcus Pneumoni

1/42

1

The LuxS-dependent Quorum Sensing System Regulates Early Biofilm Formation1

by Streptococcus pneumoniae strain D392

3

4

5

Jorge E. Vidal*1

, Herbert P. Ludewick1, Rebekah M. Kunkel

2, Dorothea Zhner

3and Keith P. Klugman

16

7

8

91Hubert Department of Global Health, Rollins School of Public Health,

2Graduated Program in10

Population Biology, Ecology and Evolution and3Division of Infectious Diseases, School Medicine,11

Emory University12

13

14

15

Running title: LuxS-mediated regulation ofS. pneumoniae early biofilms16

17

18

19

*Corresponding author: Contact information, 1518 Clifton Rd NE Room 6007, Atlanta GA, 30322.20

Phone 404-712-8675, Fax: 404-712-8969. [email protected],21

22

23


2/42

2

Abstract1

Streptococcus pneumoniae is the leading cause of mortality in children worldwide and form2

highly organized biofilms in the nasopharynx, lungs and middle ear mucosa. The luxS-controlled3

quorum sensing (QS) system has recently been implicated in virulence and persistence in the4

nasopharynx, but its role in biofilms had not been studied. Here, we show that this QS system plays a5

major role in controlling S. pneumoniae biofilm formation. Our results demonstrate that the luxS gene is6

encoded by invasive isolates and normal flora strains in a region that contains genes involved in division7

and cell wall biosynthesis. The luxS gene was maximally transcribed, as a monocistronic message, in the8

early-mid log phase of growth and this coincides with the appearance of early biofilms. Demonstrating9

the role of the LuxS system in regulating S. pneumoniae biofilms, at 24 h post-inoculation two different10

D39luxS mutants produced 80% less biofilm biomass than the wt strain D39. The complementing11

strains encoding either the luxS in a plasmid or integrated as a single copy into the genome restored12

biofilm levels to that of the wt. Moreover, a soluble factor secreted by wt strain D39 or purified AI-213

restored the biofilm phenotype of D39luxS. Our results also demonstrate that LuxS regulates, during14

the early-mid log phase of growth, levels of lytA transcript, an autolysin previously implicated in15

biofilms and also the transcript ofply, encoding the pneumococcal pneumolysin. In conclusion, the16

luxS-controlled QS system is a key regulator of early biofilm formation by S. pneumoniae strain D39.17

18

19

20

21

22

23


3/42

3

Introduction1

Streptococcus pneumoniae (the pneumococcus) is a Gram positive pathogen that causes severe2

illnesses such as otitis media, pneumonia and meningitis, mainly in young children (


4/42

4

antibiotic resistance amongst S. pneumoniae strains. For example, in vitro studies show that S.1

pneumoniaebiofilms, in comparison to their planktonic cultures, have an increased resistance profile to2

all the classes of oral antibiotics widely used to treat pneumococcal infections, namely betalactams,3

macrolides and fluoroquinolones (11, 13).4

Several molecular factors, including virulence factors, have been implicated in S. pneumoniae5

biofilm formation. Studies by Moscoso et al (2006) found that the amidases LytA, LytC and LytB, and6

adhesins such as CbpA, PcpA and PspA play some role in S. pneumoniae biofilms (32). Another study7

by Munoz-Elias et al (2008) identified 23 genes (genes encoding for adhesins, choline binding proteins8

and cell wall components) implicated in biofilm formation and colonization in a mouse model (34). Two9

other important virulence factors implicated in production of biofilms are PsrP (44) and the10

neuraminidase NanA (40). While it is clear that all these factors may play a role in the development of11

the biofilm structure, the specific mechanism by which S. pneumoniae biofilms are built remains to be12

elucidated.13

Biofilm formation requires a concerted mechanism regulated, in part, by numerous14

environmental signals (24). In S. intermedius, S. oralis, S. gordonii and S. mutans strains, regulation of15

biofilm formation has been linked to LuxS (1, 7, 31, 42), an enzyme that synthesizes the autoinducer 216

(AI-2) required for quorum sensing (QS). The phenomenon of QS is a cell-to-cell communication17

mechanism that utilizes molecules called autoinducers, to regulate gene expression in response to18

environmental changes and cell density (23).19

The first described QS mechanism implicated a 17-aa peptide [competence stimulating peptide20

(CSP)] secreted by S. pneumoniae that regulates their competence state (50). Besides this QS system, S.21

pneumoniae reference strains (e.g. D39 and TIGR4) encode a luxS gene and produce AI-2 (21, 48).22

Some evidence suggests that this LuxS-controlled QS system might be part of the regulatory network23


5/42

5

controlling competence and LytA-dependent autolysis (43). In terms of pathogenicity, LuxS was1

implicated in virulence and persistence in the nasopharynx, by utilizing mouse models of pneumococcal2

infection (21, 48). The LuxS-generated signal has been implicated in differential expression of proteins3

in strain D39 (48) and regulation of genes involved in some metabolic processes, including the4

pneumolysin gene (ply) (21). In this work we demonstrate, for the first time, that LuxS plays a major5

role in controlling biofilm formation in S. pneumoniae strain D39. Two different D39-derivative luxS6

mutants were unable to produce early biofilms, while this phenotype was reversed by genetic7

complementation or physical complementation. Together, these results shed light on a new and8

important regulatory network of one of the most important human bacterial pathogens S. pneumoniae.9

10

Material and Methods11

Strains and bacterial culture media. S. pneumoniae reference strains, and derivatives, utilized in this12

study are listed in Table 1. All other S. pneumoniae, invasive strains isolated from blood or13

cerebrospinal fluid (N=53) and normal flora strains (N=50), belong to our laboratory collection. These14

strains were isolated from different geographic region, including but not restricted to USA, Spain,15

Taiwan, Peru or Brazil. Identification and serotyping was performed by standard procedures (8). S.16

pneumoniae strains were cultured on blood agar plates (BAP) or Todd Hewitt broth containing 0.5%17

(w/v) yeast extract (THY]. When indicated, 2% maltose (w/v), ampicillin (100 g/ml), tetracycline (118

g/ml), erythromycin (0.5 g/ml) or spectinomycin (110 g/ml) was added to the culture medium.19

DNA extraction. Genomic DNA from S. pneumoniae Table 1 strains was purified from overnight20

cultures on blood agar plates (BAP) using the QIAamp DNA minikit (QIAGEN) following the21

manufacturers instructions. DNA-containing supernatant from invasive isolates and normal flora strains22

was extracted by the chelex method (10).23


6/42

6

PCR reactions. Reactions were performed with genomic DNA (100 ng) or DNA-containing1

supernatant (3 l) as template, 1 M of the indicated pair of primers (Fig. 1A and Table 2), 1X Taq2

master mix (New England Biolabs) and DNA grade water. PCR reactions were run in a MyCycler3

Thermal Cycler System (Bio-Rad). Products were run in 2% agarose gels, stained with ethidium4

bromide and photographed using a ChemiDoc XRS gel documentation System (Bio-Rad).5

RNA extraction. Total RNA was extracted as previously described (54, 55). Briefly, a cell suspension6

was prepared using 200 l of acetate solution (20 mM sodium acetate [pH=5], 1 mM EDTA, 0.5% of7

sodium duodecyl sulfate [SDS, Bio-Rad]) and added with 200 l of saturated phenol (Fisher scientific).8

This was incubated at 60C in a water bath with vigorous shaking for 5 min and centrifuged 17,000 x g9

at 4C for 5 min. Cold ethanol was added to that supernatant, mixed well by inverting the tube and10

centrifuged 17,000 x g at 4C for 5 min to obtain the RNA pellet. The pellet was resuspended in 100 l11

of DNase-free, RNase-free water and additionally treated with 2 U of DNase I (Promega) at 37C for 3012

min. RNA concentration was quantified and stored in 20 l aliquots at -80C.13

qRT-PCR analysis. Quantitative RT-PCR (qRT-PCR) was performed using the iScript One-Step RT-14

PCR kit with SYBR Green (Bio-Rad) and the CFX96 Real-Time PCR Detection System (Bio-Rad).15

qRT-PCR reactions were performed in triplicate with 20 ng of total RNA, 500 nM concentration of each16

primer (Table 2) and the following conditions; 1 cycle at 50C for 20 min, 1 cycle at 95C for 10 min17

and 40 cycles of 95C for 15s and 55C for 1 min. Melting curves were generated by a cycle of 95C for18

1 min, 55C for 1 min and 80 cycles of 55C with 0.5C increments. The relative quantitation of mRNA19

expression was normalized to the constitutive expression of the housekeeping 16SrRNA gene and20

calculated by the comparative CT(2-CT

) method (27).21

Preparation of D39 derivative luxS mutant SPJV05 and complementing strains.22


7/42

7

To inactivate the luxS gene in strain D39, a DNA cassette containing the ermB gene (which1

confers resistance to erythromycin) flanked by 5 and 3 regions ofluxS was prepared. Briefly, the ermB2

was PCR amplified using primers Ery-L and Ery-R (Table 2) and cloned into pCR2.1 TOPO. Then, 53

(210 bp) or 3 (160 bp) sequences ofluxS were PCR amplified using primers Lux5-L and Lux5-R or4

Lux3-L and Lux3-R, respectively. Those PCR fragments were purified using Qiaquick gel extraction5

(Qiagen) and digested with KpnI and BamHI (5 luxS fragment) orXhoI and XbaI (3 luxS fragment).6

Digested fragments were again purified and ligated, using T4 DNA ligase (Promega), upstream or7

downstream respectively of pCR2.1 TOPO encoding the ermB to create plasmid pLuxS-ery-LuxS. The8

whole cassette luxS-ery-luxS (1.1 kb) was PCR amplified and then purified.9

The luxS-ery-luxS cassette was transformed into competent cells of wt strain D39 by standard10

procedures (18). This transformation reaction was incubated for 2 h at 37C, plated onto BAP containing11

erythromycin and incubated for 48 h at 37C in a 5% CO2 atmosphere. Colonies were screened by PCR12

using primers Lux5-L and Lux3-R and a transformant, named SPJV05, was obtained. The luxS mutation13

was also verified by sequencing. Another D39luxS strain EJ3, previously prepared and characterized14

(21), was kindly provided by Dr. Elizabeth Joyce from the Department of Microbiology and15

Immunology, Stanford University School of Medicine.16

To prepare complementing strains, the luxS wt gene was amplified using primers LuxReg-L and17

LuxReg-R or LuxP2-L and LuxP2-R (Table 2) and cloned into the Gram positive plasmid pReg696 (14)18

or the S. pneumoniae integrative vector pPP2 (15) to create pJVR6 and pJVPP9 (Table 1). Plasmid19

pJVR6 or pJVPP9 was extracted from ECJV10 or ECJV11, and used to transform competent cells of20

SPJV05 to create SPJV06 and SPJV07, respectively (Table 1). EJ3, resistant to spectinomycin, was only21

complemented with pJVPP9 or pPP2 (the empty vector).22


8/42

8

Preparation of the inoculum for biofilm assays. An overnight BAP culture was used to prepare a cell1

suspension in THY broth to an OD600 of 0.05 and incubated at 37C in a 5% CO2 atmosphere until the2

culture reached an OD600 of0.2. An aliquot (7x105

CFU/ml) was inoculated in triplicate into either an3

8-well glass slide (Lab-Tek) or polystyrene-treated 96-well or polystyrene-treated 24-well microtiter4

plate (Corning) containing THY with no antibiotics and incubated at 37C with 5% CO2 for the5

indicated time.6

Quantification of biofilm biomass by crystal violet. Biofilms were washed three times with PBS and7

then allowed to dry for 15 min. Crystal violet (0.4%) was then added and incubated for 15 min. After8

washing, crystal violet-stained biofilms were further dried at room temperature for 15 min. To quantify9

biofilm biomass, crystal violet was removed by adding 33% acetic acid solution. The absorbance 63010

(A630) of solubilized dye was obtained in a Epoch microplate spectrophotometer (Biotek).11

Quantification of biofilm biomass by a fluorescence-based assay. Biofilms were fixed with 2%12

paraformaldehyde (Sigma) for 15 min and made permeable by adding 0.5% Triton X-100 (Roche) and13

incubating 5 min at room temperature. After washing three times with PBS, biofilms were blocked by14

adding 2% bovine serum albumin (BSA) and stained for 1 h at room temperature with a polyclonal anti-15

Streptococcus pneumoniae antibody (40 g/ml) coupled to fluorescein isothiocyanate [(FITC)16

ViroStat, Portland, ME)]. To quantify biofilm biomass, FITC-fluorescence readings (arbitrary units)17

were obtained using a VICTOR X3 Multilabel Plate Reader (Perkin-Elmer). Fluorescence arbitrary18

units of 24 h biofilms of the wt strain D39 were set as 100% of biofilm biomass and used to calculate the19

percentage of biofilm biomass of all other tested S. pneumoniae strains or different time-points.20

Physical complementation of the biofilm phenotype and AI-2 studies. To assess for physical21

complementation, a mixture of two strains were incubated in the same biofilm assay but only the22

biomass of one strain was quantified. Briefly, wt D39 or SPJV05 strain was transformed with plasmid23


9/42

9

pMV158GFP, that encodes the gfp gene under the control of the inducible maltose promoter (36), to1

create SPJV01 and SPJV08 respectively (Table 1). Biofilm biomass of these fluorescent versions was2

similar to that of their respective parent strains (not shown). Then, a mixture of wt D39 and SPJV08, or3

wt D39 and SPJV01, was inoculated in the same biofilm bioassay. As controls, SPJV01 or SPJV08 was4

also inoculated in individual wells. After 6 h of incubation at 37C, biofilms were washed and5

fluorescence readings, or images, immediately obtained. For these experiments, arbitrary fluorescence6

units obtained from SPJV01 biofilms were set as 100% of biofilm biomass and biofilm biomass of all7

other experimental conditions was calculated.8

To physically separate those bacteria within the same biofilm assay, two chambers were created9

within the same well by installing a Transwell

filter device (Corning, NY USA). The Transwell

10

membrane (0.4 M) creates a physical barrier impermeable to bacteria, but allows passage of small11

molecules between the two chambers (top and bottom). The wt D39 strain was inoculated into the top12

chamber (Transwell filter), while SPJV08 was inoculated on the bottom chamber. To further confirm13

whether LuxS mediates this secreted QS signal, the luxS mutant strain SPJV05 was inoculated in the top14

chamber and SPJV08 in the bottom chamber. These biofilm-Transwell bioassays were incubated for 6 h15

at 37C in a 5% CO2 atmosphere and biofilms produced by SPJV08 in the bottom chamber were16

quantified and photographed as mentioned above.17

For AI-2 studies, D39 or SPJV05 was inoculated in triplicate in 96-well plates with or without18

different concentrations of chemically synthesized AI-2 (from 0.1 to 100 nM) (dihydroxypentanedione19

[DPD], Omm scientific) as utilized elsewhere (4, 9, 42) and incubated for 24 h. Biofilms were stained20

with fluorescence and biomass calculated as earlier mentioned. A concentration of 10 nM induced21

statistical different biofilm biomass when incubated along with D39 or SPJV05.22


10/42

10

Statistical analyses. All data were analyzed using the non-parametric two tailed Students t test and1

using the Minitab 15 software.2

3

Results4

The luxS gene is encoded in the same chromosomal region in S. pneumoniae isolates. Bioinformatic5

analysis of genome sequenced S. pneumoniae strains indicated that the luxS gene is located in a region6

that contains genes involved in division and cell wall biosynthesis. Specifically, luxS is situated7

upstream (6.4 kb) of the gene cps4A (encoding a capsule polysaccharide biosynthesis protein) and 48

kb downstream thepbp2X gene, whose encoded protein is involved in cell wall biosynthesis and a target9

for -lactam antibiotics (30, 57), followed by mraY [encoding a phospho-N-acetylmuramoyl-10

pentapeptide-transferase (3 kb)] (29) and 294 bp downstream the clpL gene encoding a putative ATP-11

dependent Clp protease (Fig. 1A).12

To investigate the presence of the luxS gene among S. pneumoniae strains, PCR analyses were13

performed with DNA extracted from invasive isolates and strains isolated from the nasopharynx of14

healthy children. Those PCR analyses revealed that all surveyed isolates (N=103) encode the luxS gene15

(Fig. 1B). To further study the location of the luxS gene, primers were designed so that a series of16

overlapping PCR reactions mapped its chromosomal location. This overlapping PCR approach17

demonstrated that the luxS gene is always located downstream of an ORF annotated as Sp0341 (TIGR418

annotation), which encodes a protein of unknown function. The size of the obtained PCR products was19

always the same and so included, as predicted by bioinformatic analysis, an intergenic region of94 bp20

between Sp0341 and luxS gene (Figs. 1A and B).21

Overlapping PCR identified downstream of luxS, in all surveyed isolates, a gene annotated as22

clpL encoding a putative ATP-dependent protease (Fig. 1B). For some invasive isolates (N=23) or23


11/42

11

normal flora strains (N=19) strains, the size of the PCR product correlated with that observed using, as1

template, DNA from the reference strain ATCC33400, which belongs to serotype 1 (1200 bp). All2

other strains allowed the amplification of a product (960 bp) similar to that of TIGR4 (serotype 4). The3

size of those PCR products could not be correlated with serotypes of the surveyed strain (not shown).4

Overlapping PCR detected genes mraY and pbp2X downstream ofluxS in 17 normal flora strains and5

22 invasive isolates (Fig. 1B). PCR analysis targeting mraY orpbp2X further clarified that these genes6

were not encoded in this position by the rest of the strains (not shown). Taken together, these results7

indicate that the luxS gene is encoded near the capsule locus (cps) in all surveyed S. pneumoniae8

isolates.9

Transcription of the luxS gene. In S. bovis and S. pyogenes, a homologous luxS gene is transcribed10

during early-mid log phase of growth as a monocistronic message (5, 46). Unlike S. bovis, whose11

direction of transcription is opposite to both its upstream and downstream genes (5), in S. pneumoniae12

the direction of transcription of luxS is the same as that of its upstream gene (Sp0341) and opposite to13

the downstream clpL gene (Fig. 1A).14

To evaluate whether luxS mRNA is cotranscribed with Sp0341 by S. pneumoniae strain D3915

qRT-PCR analyses were performed. These analyses showed that 4 h post inoculation, levels of luxS16

transcripts increased 20-fold with respect to the RNA from BAP (Fig. 2). While expression of Sp034117

mRNA also increased 16-fold, almost no change (0.5) was obtained for that of Sp0341-luxS. As18

expected, transcription of a housekeeping gene utilized as an internal control (gyrB) did not19

considerably change. Similar results were obtained by RT-PCR with S. pneumoniae strains TIGR4 and20

ATCC33400 (not shown). Overall, these results indicate that the luxS gene of S. pneumoniae is21

transcribed as a monicistronic message during the mid-log phase of growth.22


12/42

12

Development of a new fluroscence-based assay to quantify S. pneumoniae biofilm biomass. Before1

addressing the role of LuxS in S. pneumoniae biofilms, we quantified the biofilm biomass produced by2

reference strains D39, TIGR4 and R6 a non encapsulated variant of strain D39. As can be seen in Fig.3

3A, the crystal violet assay demonstrated biofilm formation by all strains. TIGR4 biofilm biomass was4

low (A600


13/42

13

formed by D39 is highly organized, forming compact layers of bacteria that create aggregates where the1

fluorescent signal is more intense (not shown). In contrast, fluorescence images of biofilms produced by2

SPJV05 or EJ3 clearly show few bacteria attached to the bottom of the wells (Fig. 4B). Indeed, both3

mutants appear to form small aggregates in the bottom of the well that do not progress to form a mature4

biofilm (Fig. 4B).5

To confirm the role ofluxS in S. pneumoniae biofilms, the complementing strains SPJV04 and6

SPJV06 were assessed for biofilm production. As shown in Fig. 4A, the luxS mutant complemented with7

either a copy of luxS integrated into bgaA or in a plasmid, SPJV04 and SPJV06 respectively, restored8

levels of biofilm biomass to that of the wt. Production of biofilm biomass by SPJV02, encoding the9

pPP2 empty vector, was similar to EJ3 (Fig. 4A), demonstrating that disruption ofbgaA did not alter the10

biofilm phenotype. Epifluorescence images of SPJV04 or SPJV06 biofilms show similar structures to11

the wt strain D39 (Fig. 4B).12

This biofilm phenotype is likely not due to growth rates or an autoaggregation defect.13

Comparative growth studies showed that D39 and its derivatives grew similarly in THY (not shown)14

Time-course studies also demonstrated that luxS mutants and complementing strains autoaggregate15

similar to strain D39 (data not shown).16

LuxS regulates early events in biofilm formation. To begin exploring the mechanism by which LuxS17

controls biofilm formation, a time-course study was conducted that evaluated early production of18

biofilms. Fig. 5A shows that 3 h post-inoculation 10% of biofilm biomass had already been produced19

by the wt strain. Biofilm biomass reached 25%, 45% and 80% after 4, 6 and 8 h of incubation20

respectively (Fig. 5A), while biofilm biomass 10 or 12 h post-inoculation was similar to those levels21

produced during a 24 h period (not shown). In contrast, biofilms produced by SPJV05 were undetectable22


14/42

14

at early time points (i.e. 2 or 4 h post-inoculation) while 8 h post inoculation produced only 15% of1

biofilm biomass (Fig. 5A).2

As seen in Fig. 5B, small pneumococcus aggregates could be detected as soon as 2 h post-3

inoculation with the wt strain. Those D39 aggregates became more evident after 4 and 6 h of incubation4

and almost covered the entire surface after 8 h (Figs. 5C, 5D and 5E). Bacterial aggregates produced by5

SPJV05, however, were smaller and only covered 20% of the surface 8 h post inoculation (Fig. 5F). As6

expected, the complementing strain produced similar biofilm biomass than the wt 8 h post-inoculation7

(Fig. 5G).8

Evidence that the LuxS-mediated AI-2 regulates early biofilm formation.9

To confirm that a QS signal was responsible for the biofilm defect of the luxS mutants, the wt10

strain and SPJV08 (SPJV05 encoding the gfp gene under the control of the maltose promoter) were11

inoculated in the same well with or without physical contact. If a QS signal released by the wt could12

induce an increase on SPJV08 biofilm biomass, SPJV08 fluorescence would increase.13

When the wt D39 and SPJV08 were inoculated together with physical contact, biofilm biomass14

of SPJV08 was similar to levels of SPJV08 alone and statistically different to levels produced by wt D3915

encoding pMV158GFP (SPJV01) (Fig. 6A). Even when co-cultured with D39, Fig. 6B shows almost no16

bacterial aggregates of fluorescent SPJV08 6 h post-inoculation. We hypothesize that the wt strain was17

able to attach to the surface and produced early biofilms but unable to incorporate, once initial18

aggregates had already formed, cells of the luxS null mutant. As a control, the wt strain and SPJV0119

were inoculated together and incubated for 6 h. Biofilm biomass of SPJV01 was 40% demonstrating20

that the wt strain outcompeted SPJV01 to produce biofilms (Fig. 6A).21

To avoid the formation of biofilms by the wt strain D39 when co-inoculated with SPJV08 but22

allow the secretion of a secreted factor, a transwell device was used. This system contains a membrane23


15/42

15

(0.45 M) that allowed the inoculation of the wt strain in the top and SPJV08 in the bottom while they1

were physically separated (Fig. 6A, inset). Given its pore size, the membrane allows the passage of2

small molecules. As shown in Fig. 6A, when the wt strain and SPJV08 where co-inoculated, SPJV083

was able to produce 25% of biofilm biomass of wt levels 6 h post-inoculation (Figs. 6A and 6C). Those4

biofilm levels were statistically different to levels produced by SPJV08 alone (Fig. 6A). In contrast,5

biofilm biomass of SPJV08 that had been inoculated in the bottom of the well, and SPJV05 in the6

transwell system, did not produce levels significantly different than SPJV08 alone (Fig. 6A).7

To confirm the role of secreted AI-2 in the biofilm phenotype, strain D39 or SPJV05 where8

inoculated along with chemically synthesized AI-2. As shown in Fig. 7, AI-2 allowed the production of9

more robust biofilm biomass than that produced by strains grown with no purified AI-2.10

Temporal expression of the luxS gene and evidences that LuxS regulates lytA mRNA and ply11

mRNA levels. Since we had demonstrated that LuxS regulates early biofilm formation, a time-course12

study was conducted to evaluate levels ofluxS mRNA expression during early-mid log phase of growth.13

The luxS transcript was found maximally expressed (28-fold increase) at 4 h post-inoculation (Fig.14

8A). At this time point, fold change ofluxS mRNA in some invasive isolates and normal flora ranged15

from 6 through 300-fold and expression could not be correlated to the subset of strains (not shown). A16

clear decline in levels ofluxS mRNA, in strain D39, was obtained 6 h (5-fold difference) and 8 h (3.8-17

fold difference) post-inoculation. As expected, gyrB mRNA levels did not significantly change after 2,18

4, 6 or 8 h of incubation (Fig. 8A). These results indicate that transcription of the luxS gene, and19

therefore its activity, is maximally expressed during the early-mid log phase of growth.20

Previous studies have demonstrated that LytA, the capsular polysaccharide, the neuraminidase21

NanA and choline binding proteins such as PspA play a role in S. pneumoniae biofilm formation (32,22

40). Increased levels of the pneumolysin (Ply) has also been detected in S. pneumoniae early biofilms23


16/42

16

(2). Therefore, transcription of genes and potential LuxS-mediated regulation were evaluated. Our qRT-1

PCR analyses demonstrated that wt mRNA levels of lytA, ply, cps4A, nanA and pspA similarly2

increased during the early-mid log phase of growth and then decreased 6 h post inoculation (Fig. 8A and3

not shown). In contrast, lytA mRNA levels in the luxS mutant decreased 4 h post-inoculation (Fig. 8B)4

while levels of the ply transcript dramatically decreased 2, 4 and 6 h post inoculation (Fig. 8C).5

Transcription levels of nanA, csp4A and pspA genes remained similar to that of wt (not shown).6

Complementing stains showed at all time points similar level of transcripts to that of wt (not shown).7

8

Discussion9

S. pneumoniae strains usually colonize the nasopharynx of healthy children during the first10

months of life and either remain asymptomatic or go on to cause disease such as pneumonia, meningitis11

or otitis media (17, 37). It has been postulated that the pneumococcus resides in the human nasopharynx12

forming biofilms (33). Despite the increasing importance ofS. pneumoniae biofilms during the last few13

years, the regulatory network behind these structures has not been completely elucidated. The current14

study now demonstrates, for the first time, that the luxS-controlled quorum sensing (QS) system15

regulates S. pneumoniae early biofilm formation. This AI-2 mediated regulatory network appears to be16

specific for a subset of biofilm effectors since, in this research and elsewhere (21), LuxS was found to17

regulate a particular set of genes in planktonic cultures.18

Recent experimental evidence indicates that the LuxS QS system is implicated in persistence,19

virulence and dissemination ofS. pneumoniae (3, 21, 48). A previous study by Stroeher et al. (2003)20

demonstrated that a D39 derivative luxS null mutant was less able to spread to the lungs or the blood21

than the wt strain D39, suggesting that the QS signal might be important for dissemination within the22

host (48). This luxS mutant was also less virulent for mice than wt strain D39 (48). Another study by23


17/42

17

Joyce et al. (2004) showed that this QS system is implicated in persistence in the nasopharynx of mice1

(21). Our results extend these observations by demonstrating that LuxS is absolutely required to2

establish early biofilm structures. While luxS mutants were unable to form early biofilms, the3

complementing strains fully restored the phenotype. In an attempt to verify that a secreted QS signal was4

controlling early biofilms, we utilized chemically synthesized AI-2, or AI-2 containing supernatants5

from wt D39, that demonstrated statistically significant more biofilm biomass when AI-2 was incubated6

along with the luxS mutant or wt (Fig. 7).7

Recent publications have also shown that the competence QS system (Com), which is regulated8

by the secreted competence-stimulating peptide (CSP), controls biofilm production by S. pneumoniae9

strains (38, 52). An investigation by Oggioni et al (2006) showed that supplementing strain D39 with10

exogenous CSP produces more biofilm biomass (38), and in a more recent publication, Trapetti et al11

(2011) demonstrated that a TIGR4 derivative comC mutant was unable to form biofilms while the12

phenotype could be restored by adding exogenous CSP (52). Specific CSP-regulated biofilm effectors13

and potential LuxS-Com synergism for biofilm development, if any, remain to be investigated.14

The current study shows that the luxS gene is encoded near the capsular locus in S. pneumoniae15

strains and transcribed as a monocistronic unit. Expression of the capsular polysaccharide has been16

implicated in virulence (35) and biofilm formation (32), however, the LuxS system does not seem to17

regulate capsule genes since our qRT-PCR studies showed that the luxS mutant contained similar levels18

ofcsp4A mRNA than the wt. Other proteins previously implicated in biofilms such as the neuraminidase19

NanA (40) or choline binding protein PspA (32) were also found not to be regulated by this system.20

Expression of lytA, however, encoding the autolysin involved in cell wall degradation (20) and21

production of biofilms (32), was found to be regulated by LuxS during the mid log phase of growth (Fig.22

8B). Whereas our experiments showed that lytA transcripts were higher, in the wt, during the early-mid23


18/42

18

phase (2-4 h) of growth, the mutant had reduced lytA mRNA levels 4 h post-inoculation. In line with1

these results, evidence indicating that LuxS may play a role in LytA-dependent autolysis in the2

stationary phase of growth (5-7 h post-inoculation) has been published (43). Therefore, LuxS appears to3

regulate mRNA levels oflytA in exponentially growing cultures that results in a defect of the autolysis4

phenotype during the stationary phase. A complete characterization of the biology of this phenomenon is5

under investigation in our labs.6

Evidence now directly links production of pneumococcal biofilms with LuxS regulation. For7

instance, a previous report found that a luxS mutant produced a different protein expression profile8

(cytosolic and membrane proteins) than the wt strain D39 (48). Joyce et al (2004) using microarrays9

detected 46 genes down-, or up-regulated by the LuxS system, only when they utilized RNA extracted10

from the wt strain D39 and the luxS mutant growing at early-mid log phase of growth (21). Since levels11

of the luxS transcript are also higher during early-mid log phase of growth (Fig. 8A), and luxS mutants is12

unable to produce biofilms (Fig. 4A), regulation of genes encoding proteins implicated in early biofilm13

formation, such as lytA, should be a main target for the LuxS-generated signal.14

Regulation of proteins present in early biofilms has been previously investigated (2). A particular15

association between early biofilm-produced proteins and the LuxS system was the discovery that levels16

of pneumolysin (Ply), a protein implicated in colonization and virulence in animal models (19, 39),17

increase during early stages of biofilm formation (2). Its encoded gene (ply) has also been detected by18

microarray analyses to be regulated by the LuxS system (21). Our studies now extend this observation19

by demonstrating, utilizing qRT-PCR, that LuxS dramatically impact levels ofply transcripts during the20

early-mid phase of growth (Fig. 8C). The contribution of the pneumolysin to S. pneumoniae-produced21

biofilms is unclear and, given that D39ply had reduced ability to colonize the mouse nasopharynx (39),22


19/42

19

requires further elucidation. It may have a role in initial attachment since Ply is not secreted by1

pneumococcus, but rather located in the cell wall (41).2

Our study also introduced a new fluorescence-based biofilm assay, which is specific for S.3

pneumoniae strains. While other non-specific fluorescence methods have been used to visualize S.4

pneumoniae biofilms in vitro (2, 12, 32), our newly developed assay utilizes an anti-S. pneumoniae5

antibody coupled to fluorescein (FITC) that permits quantification of the biofilm biomass and direct6

visualization of those structures, in a single assay. This assay may also be useful for studies where a7

heterogeneous population of bacteria (i.e. normal flora strains) are present with or within S. pneumoniae8

biofilms, for example, in samples collected from children with pneumococcal diseases, animal studies9

and in vitro studies dissecting the contribution of other bacteria to pneumococcal biofilms.10

An important feature of our assay is that the permeabilization of the biofilm structure with Triton11

X-100 may allow those anti-S. pneumoniae antibodies to reach most pneumococci within the biofilm12

matrix. Fluorescence arbitrary units were consistently higher only when biofilms were made permeable13

before staining with the fluorescent antibody. Since S. pneumoniae biofilm structures have been14

calculated to be 25 M thick (32), it is possible that the crystal violet dye does not reach all15

pneumococcus cells within the matrix. The new fluorescent assay is more sensitive being able to both16

quantify and visualize early biofilm structures (bacterial aggregates) within 2 h post-inoculation (Fig. 3).17

In contrast, our experiments and those reported by Munoz-Elias et al (2008) (34) using crystal violet,18

detected S. pneumoniae biofilms 6-8 h post-inoculation.19

Utilizing this new assay to gain insights into the biofilm biology, pneumococcal biofilm20

formation evolved in three stages: (1) initial attachment between 2-4 h, (2) formation of bacterial21

aggregates between 4-6 h occupying 50% of the surface and (3) biofilm development. Similar stages22

have been previously described using a continuous-flow biofilm reactor, although stages in that study23


20/42

20

were observed between 1 to 6 days (2). Once bacterial aggregates were produced (stage 2), biofilms1

continues exponentially growing even in the absence of planktonic cells (Kunkel et al, unpublished). In2

fact, with the only exception of csp4A whose mRNA levels remained similar, biofilm cells showed3

higher levels of nanA, ply, pspA and lytA transcripts 6 h post-inoculation than their counterpart4

planktonic cultures (not shown), clearly demonstrating an active metabolism within biofilm cells.5

Attempts to find out levels of these transcripts in a luxS background failed because the absence of6

biofilm cells at this time-point.7

In summary, we have demonstrated that the S. pneumoniae LuxS-controlled QS system regulates8

early biofilm formation. Biofilm structures might be important forS. pneumoniae strains to persist and9

possibly cause important diseases such as otitis media or pneumonia. Findings in the current study may10

have implications for developing new targets to reduce pneumococcal carriage and, therefore11

pneumococcal disease.12

13

Acknowledgment14

This research was supported in part by PHS Grant UL1 RR025008 from the Clinical and Translational15

Science Award program, NIH, National Center for Research Resources (JEV). We thank Dr. Elizabeth16

Joyce from Stanford University for providing us strain EJ3, Dr. Reinhold Brckner from the Department17

of Microbiology, University of Kaiserslautern, for providing pPP2, Dr. Finbarr Hayes from the18

University of Manchester UK for providing pReg6969 and Dr. Lesley McGee from the Centers for19

Disease Control and Prevention (CDC) and Dr. Carlos Grijalva from Vanderbilt University for20

providing some S. pneumoniae isolates. Also thanks to Dr. Manuel Espinoza from the Centro de21

Investigaciones Biologicas Madrid, Spain for his kind gift of plasmid pMV158GFP and Joshua Shak22

for critical reading and suggestions to this manuscript.23


21/42

21

References1

1. Ahmed, N. A., F. C. Petersen, and A. A. Scheie. 2009. AI-2/LuxS is involved in increased2

biofilm formation by Streptococcus intermedius in the presence of antibiotics. Antimicrob Agents3

Chemother53:4258-63.4

2. Allegrucci, M., F. Z. Hu, K. Shen, J. Hayes, G. D. Ehrlich, J. C. Post, and K. Sauer. 2006.5

Phenotypic characterization ofStreptococcus pneumoniae biofilm development. J Bacteriol 188:2325-6

35.7

3. Armbruster, C. E., W. Hong, B. Pang, K. E. Dew, R. A. Juneau, M. S. Byrd, C. F. Love, N.8

D. Kock, and W. E. Swords. 2009. LuxS promotes biofilm maturation and persistence of nontypeable9

Haemophilus influenzae in vivo via modulation of lipooligosaccharides on the bacterial surface. Infect10

Immun 77:4081-91.11

4. Armbruster, C. E., W. Hong, B. Pang, K. E. Weimer, R. A. Juneau, J. Turner, and W. E.12

Swords. 2010. Indirect pathogenicity of Haemophilus influenzae and Moraxella catarrhalis in13

polymicrobial otitis media occurs via interspecies quorum signaling. MBio 1(3). pii: e00102-10.14

5. Asanuma, N., T. Yoshii, and T. Hino. 2004. Molecular characterization and transcription of the15

luxS gene that encodes LuxS autoinducer 2 synthase in Streptococcus bovis. Curr Microbiol 49:366-71.16

6. Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the Chemical Nature of the17

Substance Inducing Transformation of Pneumococcal Types : Induction of Transformation by a18

Desoxyribonucleic Acid Fraction Isolated from Pneumococcus Type Iii. J Exp Med 79:137-58.19

7. Blehert, D. S., R. J. Palmer, Jr., J. B. Xavier, J. S. Almeida, and P. E. Kolenbrander. 2003.20

Autoinducer 2 production by Streptococcus gordonii DL1 and the biofilm phenotype of a luxS mutant21

are influenced by nutritional conditions. J Bacteriol 185:4851-60.22


22/42

22

8. da Gloria Carvalho, M., F. C. Pimenta, D. Jackson, A. Roundtree, Y. Ahmad, E. V. Millar,1

K. L. O'Brien, C. G. Whitney, A. L. Cohen, and B. W. Beall. 2010. Revisiting pneumococcal2

carriage by use of broth enrichment and PCR techniques for enhanced detection of carriage and3

serotypes. J Clin Microbiol 48:1611-8.4

9. De Keersmaecker, S. C., C. Varszegi, N. van Boxel, L. W. Habel, K. Metzger, R. Daniels, K.5

Marchal, D. De Vos, and J. Vanderleyden. 2005. Chemical synthesis of (S)-4,5-dihydroxy-2,3-6

pentanedione, a bacterial signal molecule precursor, and validation of its activity in Salmonella7

typhimurium. J Biol Chem 280:19563-8.8

10. de Lamballerie, X., C. Zandotti, C. Vignoli, C. Bollet, and P. de Micco. 1992. A one-step9

microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Res Microbiol10

143:785-90.11

11. del Prado, G., V. Ruiz, P. Naves, V. Rodriguez-Cerrato, F. Soriano, and M. del Carmen12

Ponte. 2010. Biofilm formation by Streptococcus pneumoniae strains and effects of human serum13

albumin, ibuprofen, N-acetyl-l-cysteine, amoxicillin, erythromycin, and levofloxacin. Diagn Microbiol14

Infect Dis 67:311-8.15

12. Donlan, R. M., J. A. Piede, C. D. Heyes, L. Sanii, R. Murga, P. Edmonds, I. El-Sayed, and16

M. A. El-Sayed. 2004. Model system for growing and quantifying Streptococcus pneumoniaebiofilms17

in situ and in real time. Appl Environ Microbiol 70:4980-8.18

13. Garcia-Castillo, M., M. I. Morosini, A. Valverde, F. Almaraz, F. Baquero, R. Canton, and19

R. del Campo. 2007. Differences in biofilm development and antibiotic susceptibility among20

Streptococcus pneumoniae isolates from cystic fibrosis samples and blood cultures. J Antimicrob21

Chemother59:301-4.22


23/42

23

14. Grady, R., and F. Hayes. 2003. Axe-Txe, a broad-spectrum proteic toxin-antitoxin system1

specified by a multidrug-resistant, clinical isolate ofEnterococcus faecium. Mol Microbiol 47:1419-32.2

15. Halfmann, A., R. Hakenbeck, and R. Bruckner. 2007. A new integrative reporter plasmid for3

Streptococcus pneumoniae. FEMS Microbiol Lett 268:217-24.4

16. Hall-Stoodley, L., F. Z. Hu, A. Gieseke, L. Nistico, D. Nguyen, J. Hayes, M. Forbes, D. P.5

Greenberg, B. Dice, A. Burrows, P. A. Wackym, P. Stoodley, J. C. Post, G. D. Ehrlich, and J. E.6

Kerschner. 2006. Direct detection of bacterial biofilms on the middle-ear mucosa of children with7

chronic otitis media. Jama 296:202-11.8

17. Hava, D. L., J. LeMieux, and A. Camilli. 2003. From nose to lung: the regulation behind9

Streptococcus pneumoniae virulence factors. Mol Microbiol 50:1103-10.10

18. Havarstein, L. S., G. Coomaraswamy, and D. A. Morrison. 1995. An unmodified11

heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus12

pneumoniae. Proc Natl Acad Sci U S A 92:11140-4.13

19. Hirst, R. A., B. Gosai, A. Rutman, C. J. Guerin, P. Nicotera, P. W. Andrew, and C.14

O'Callaghan. 2008. Streptococcus pneumoniae deficient in pneumolysin or autolysin has reduced15

virulence in meningitis. J Infect Dis 197:744-51.16

20. Jedrzejas, M. J. 2001. Pneumococcal virulence factors: structure and function. Microbiol Mol17

Biol Rev 65:187-207.18

21. Joyce, E. A., A. Kawale, S. Censini, C. C. Kim, A. Covacci, and S. Falkow. 2004. LuxS is19

required for persistent pneumococcal carriage and expression of virulence and biosynthesis genes. Infect20

Immun 72:2964-75.21


24/42

24

22. Kadioglu, A., J. N. Weiser, J. C. Paton, and P. W. Andrew. 2008. The role ofStreptococcus1

pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol 6:288-2

301.3

23. Kaper, J. B., and V. Sperandio. 2005. Bacterial cell-to-cell signaling in the gastrointestinal4

tract. Infect Immun 73:3197-209.5

24. Karatan, E., and P. Watnick. 2009. Signals, regulatory networks, and materials that build and6

break bacterial biofilms. Microbiol Mol Biol Rev 73:310-47.7

25. Klugman, K. P., S. A. Madhi, and W. C. Albrich. 2008. Novel approaches to the identification8

ofStreptococcus pneumoniae as the cause of community-acquired pneumonia. Clin Infect Dis 47 Suppl9

3:S202-6.10

26. Lanie, J. A., W. L. Ng, K. M. Kazmierczak, T. M. Andrzejewski, T. M. Davidsen, K. J.11

Wayne, H. Tettelin, J. I. Glass, and M. E. Winkler. 2007. Genome sequence of Avery's virulent12

serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated13

laboratory strain R6. J Bacteriol 189:38-51.14

27. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-15

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-8.16

28. Lizcano, A., T. Chin, K. Sauer, E. I. Tuomanen, and C. J. Orihuela. 2010. Early biofilm17

formation on microtiter plates is not correlated with the invasive disease potential of Streptococcus18

pneumoniae. Microb Pathog 48:124-30.19

29. Massidda, O., D. Anderluzzi, L. Friedli, and G. Feger. 1998. Unconventional organization of20

the division and cell wall gene cluster ofStreptococcus pneumoniae. Microbiology 144 ( Pt 11):3069-21

78.22


25/42

25

30. Maurer, P., B. Koch, I. Zerfass, J. Krauss, M. van der Linden, J. M. Frere, C. Contreras-1

Martel, and R. Hakenbeck. 2008. Penicillin-binding protein 2x ofStreptococcus pneumoniae: three2

new mutational pathways for remodelling an essential enzyme into a resistance determinant. J Mol Biol3

376:1403-16.4

31. Merritt, J., F. Qi, S. D. Goodman, M. H. Anderson, and W. Shi. 2003. Mutation of luxS5

affects biofilm formation in Streptococcus mutans. Infect Immun 71:1972-9.6

32. Moscoso, M., E. Garcia, and R. Lopez. 2006. Biofilm formation by Streptococcus pneumoniae:7

role of choline, extracellular DNA, and capsular polysaccharide in microbial accretion. J Bacteriol8

188:7785-95.9

33. Moscoso, M., E. Garcia, and R. Lopez. 2009. Pneumococcal biofilms. Int Microbiol 12:77-85.10

34. Munoz-Elias, E. J., J. Marcano, and A. Camilli. 2008. Isolation ofStreptococcus pneumoniae11

biofilm mutants and their characterization during nasopharyngeal colonization. Infect Immun 76:5049-12

61.13

35. Nelson, A. L., A. M. Roche, J. M. Gould, K. Chim, A. J. Ratner, and J. N. Weiser. 2007.14

Capsule enhances pneumococcal colonization by limiting mucus-mediated clearance. Infect Immun15

75:83-90.16

36. Nieto, C., and M. Espinosa. 2003. Construction of the mobilizable plasmid pMV158GFP, a17

derivative of pMV158 that carries the gene encoding the green fluorescent protein. Plasmid 49:281-5.18

37. Nobbs, A. H., R. J. Lamont, and H. F. Jenkinson. 2009. Streptococcus adherence and19

colonization. Microbiol Mol Biol Rev 73:407-50.20

38. Oggioni, M. R., C. Trappetti, A. Kadioglu, M. Cassone, F. Iannelli, S. Ricci, P. W. Andrew,21

and G. Pozzi. 2006. Switch from planktonic to sessile life: a major event in pneumococcal22

pathogenesis. Mol Microbiol 61:1196-210.23


26/42

26

39. Ogunniyi, A. D., K. S. LeMessurier, R. M. Graham, J. M. Watt, D. E. Briles, U. H.1

Stroeher, and J. C. Paton. 2007. Contributions of pneumolysin, pneumococcal surface protein A2

(PspA), and PspC to pathogenicity ofStreptococcus pneumoniae D39 in a mouse model. Infect Immun3

75:1843-51.4

40. Parker, D., G. Soong, P. Planet, J. Brower, A. J. Ratner, and A. Prince. 2009. The NanA5

neuraminidase ofStreptococcus pneumoniae is involved in biofilm formation. Infect Immun 77:3722-6

30.7

41. Price, K. E., and A. Camilli. 2009. Pneumolysin localizes to the cell wall of Streptococcus8

pneumoniae. J Bacteriol 191:2163-8.9

42. Rickard, A. H., R. J. Palmer, Jr., D. S. Blehert, S. R. Campagna, M. F. Semmelhack, P. G.10

Egland, B. L. Bassler, and P. E. Kolenbrander. 2006. Autoinducer 2: a concentration-dependent11

signal for mutualistic bacterial biofilm growth. Mol Microbiol 60:1446-56.12

43. Romao, S., G. Memmi, M. R. Oggioni, and M. C. Trombe. 2006. LuxS impacts on LytA-13

dependent autolysis and on competence in Streptococcus pneumoniae. Microbiology 152:333-41.14

44. Sanchez, C. J., P. Shivshankar, K. Stol, S. Trakhtenbroit, P. M. Sullam, K. Sauer, P. W.15

Hermans, and C. J. Orihuela. 2010. The pneumococcal serine-rich repeat protein is an intra-species16

bacterial adhesin that promotes bacterial aggregation in vivo and in biofilms. PLoS Pathog 6.17

45. Sekhar, S., R. Kumar, and A. Chakraborti. 2009. Role of biofilm formation in the persistent18

colonization ofHaemophilus influenzae in children from northern India. J Med Microbiol 58:1428-32.19

46. Siller, M., R. P. Janapatla, Z. A. Pirzada, C. Hassler, D. Zinkl, and E. Charpentier. 2008.20

Functional analysis of the group A streptococcal luxS/AI-2 system in metabolism, adaptation to stress21

and interaction with host cells. BMC Microbiol 8:188.22


27/42

27

47. Sloan, G. P., C. F. Love, N. Sukumar, M. Mishra, and R. Deora. 2007. TheBordetella Bps1

polysaccharide is critical for biofilm development in the mouse respiratory tract. J Bacteriol 189:8270-6.2

48. Stroeher, U. H., A. W. Paton, A. D. Ogunniyi, and J. C. Paton. 2003. Mutation of luxS of3

Streptococcus pneumoniae affects virulence in a mouse model. Infect Immun 71:3206-12.4

49. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg,5

R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D.6

Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H.7

Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S.8

Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter,9

B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome10

sequence of a virulent isolate ofStreptococcus pneumoniae. Science 293:498-506.11

50. Tomasz, A. 1965. Control of the competent state in Pneumococcus by a hormone-like cell12

product: an example for a new type of regulatory mechanism in bacteria. Nature 208:155-9.13

51. Tomasz, A. 2000. Streptococcus pneumoniae : molecular biology & mechanisms of disease.14

Mary Ann Liebert, Inc., Larchmont, NY.15

52. Trappetti, C., L. Gualdi, L. Di Meola, P. Jain, C. C. Korir, P. Edmonds, F. Iannelli, S.16

Ricci, G. Pozzi, and M. R. Oggioni. 2011. The impact of the competence quorum sensing system on17

Streptococcus pneumoniae biofilms varies depending on the experimental model. BMC Microbiol18

11:75.19

53. van der Poll, T., and S. M. Opal. 2009. Pathogenesis, treatment, and prevention of20

pneumococcal pneumonia. Lancet 374:1543-56.21


28/42

28

54. Vidal, J. E., J. Chen, J. Li, and B. A. McClane. 2009. Use of an EZ-Tn5-based random1

mutagenesis system to identify a novel toxin regulatory locus in Clostridium perfringens strain 13. PLoS2

One 4:e6232.3

55. Vidal, J. E., K. Ohtani, T. Shimizu, and B. A. McClane. 2009. Contact with enterocyte-like4

Caco-2 cells induces rapid upregulation of toxin production by Clostridium perfringens type C isolates.5

Cell Microbiol 11:1306-28.6

56. Weimer, K. E., C. E. Armbruster, R. A. Juneau, W. Hong, B. Pang, and W. E. Swords. 7

2010. Coinfection with Haemophilus influenzae promotes pneumococcal biofilm formation during8

experimental otitis media and impedes the progression of pneumococcal disease. J Infect Dis 202:1068-9

75.10

57. Zerfass, I., R. Hakenbeck, and D. Denapaite. 2009. An important site in PBP2x of penicillin-11

resistant clinical isolates of Streptococcus pneumoniae: mutational analysis of Thr338. Antimicrob12

Agents Chemother53:1107-15.13

14

15

16

17

18

19

20

21

22

23


29/42

29

Figure legends1

Fig. 1. Overlapping PCR approach to locate the luxS gene in S. pneumoniae isolates. A) Schematic2

representation of a 6.2 kb region that includes the quorum sensing luxS gene. Solid bars underneath the3

locus diagram depict the primers utilized for overlapping PCRs shown in panel B). B) DNA from a4

collection ofS. pneumoniae invasive isolates and normal flora strains (lanes 1-15), ATCC33400 (lane5

16) or TIGR4 (lane 17) was used as template in PCR reactions with primers indicated at right. Size of6

the PCR product, in bp, is indicated at left in all panels.7

Fig. 2. Monocistronic transcription of the luxS gene during the mid-log phase of growth.8

Quantitative RT-PCRs were performed with RNA extracted from D39 grown overnight in a blood agar9

plate (BAP) or THY broth 4 h post-inoculation. Primers amplified the ORF Sp0341, Sp0341 and the10

luxS gene (0341-luxS), the luxS gene or the gyrase B subunit gene. Average CT values were normalized11

to the housekeeping 16S rRNA gene and the fold differences were calculated using the comparative CT12

method (2C

T) (27). Values on the bars indicate the calculated fold change relative to the overnight13

BAP culture. Error bars represent the standard error of the mean calculated using data from three14

independent experiments.15

Fig. 3. Quantification of biofilm biomass ofS. pneumoniae strains. Panels A and B. An aliquot of the16

indicated strain, was inoculated in triplicate in 96-well plates and incubated for 24 h at 37C in a 5%17

CO2 atmosphere. In panels C and D, S. pneumoniae D39 was inoculated and incubated the indicated18

time. Biofilms were stained with (A and C) crystal violet or (B and D) with a polyclonal anti- S.19

pneumoniae antibody coupled to fluorescein. Biofilm biomass (arbitrary fluorescent units) of wt strain20

D39 24 h post-inoculation was adjusted to 100% and percentage of biomass of the other strains or time21

points was calculated.22


30/42

30

Fig. 4. Biofilm formation by S. pneumoniae strain D39 is regulated by the luxS gene. A) The1

indicated strain was inoculated in 96-well plates and incubated for 24 h. Biofilms were stained by2

fluorescence and biomass of wt D39 adjusted as 100% to calculate all others. In all panels, error bars3

represent the standard error of the mean calculated using data from, at least, four independent4

experiments. Asterisks (*) indicate statistical significance (p0.05), calculated using a non-parametric t-5

test, in comparison with wt D39. B) Biofilms were imaged using an inverted fluorescence microscope.6

Bar at right bottom panel is also valid for all panels.7

Fig. 5. Time-course study of biofilm formation. Strain D39 or SPJV05, was inoculated in 96-well8

plates and incubated for 1-8 or 24 h at 37C in a 5% CO2 atmosphere. A) Biofilms were stained with an9

anti-S. pneumoniae antibody coupled to fluorescein and quantified using a fluorometer. Biofilm biomass10

of wt strain D39 24 h post-inoculation was set to 100% and all others calculated. Error bars represent the11

standard error of the mean calculated using data from three independent experiments. Asterisk (*)12

indicates statistical significance (p0.05), calculated using non-parametric t-test, in comparison with wt13

D39 8 h post-inoculation. Biofilms formed by the wt D39 after 2 h (B), 4 h (C), 6 h or 8 h (E) or SPJV0514

(F) 8 h post-inoculation or complementing SPJV06 8 h post-inoculation were imaged using an inverted15

fluorescence microscope. Bar at left bottom panel is valid for all panels.16

Fig. 6. Physical complementation of the biofilm phenotype of the luxS mutant. A) SPJV01, SPJV0817

or a mixture of the indicated strains were inoculated in 24-well microplates and incubated for 6 h.18

Transwell filters were installed in some wells (inset) and SPJV08 was inoculated in the bottom and D3919

or SPJV05 in the top. These Transwell-biofilm bioassays were also incubated for 6 h and biofilms20

produced by SPJV08 on the bottom was quantified. * or#

indicates statistical significance (p0.05),21

calculated using non-parametric t-test, in comparison with wt D39 or SPJV05 respectively. Panel (B)22


31/42

31

shows the fluorescence image of SPJV08 inoculated along with wt D39 and incubated for 6 h.1

Fluorescent biofilms formed by SPJV08 on the bottom of the Transwell-biofilm bioassay, when strain2

wt D39 (C) or SPJV05 (D) had been inoculated in the top chamber and incubated for 6 h.3

Fig. 7. Exogenous AI-2 increases the biofilm biomass of wt and luxS mutant. StrainD39 or SPJV054

was inoculated in 96 well plates and incubated for 24 h at 37C in a 5% CO2 atmosphere. Where5

indicated AI-2 (10 M) was added to the wells. Biofilms were stained by fluorescence and biomass of6

D39 wt set as 100% to calculate all others. * or # indicates statistical significance (p0.05), calculated7

using non-parametric t-test, in comparison with wt D39 or SJPV05, respectively.8

Fig. 8. Regulation of lytA mRNA and ply mRNA transcripts by luxS. Strain D39 or SPJV05 was9

inoculated in THY broth and incubated for 2, 4, 6 or 8 h at 37C. RNA was extracted from these THY10

cultures or from an overnight culture in BAP. A) RNA from D39 wt was utilized as template in qRT-11

PCR reactions with primers that amplified the lytA, luxS, ply orgyrB gene. Average CT values were12

normalized to the 16S rRNA gene and the fold differences, relative to BAP, were calculated using the13

comparative CT method (2CT) (27). Values of each time point indicate the calculated fold change14

relative to the overnight BAP culture. (B and C) RNA from D39 or SPJV05 was used as template qRT-15

PCR reactions with primers targeting the lytA gene (B) orply gene (C). Average CT values were16

normalized to the 16S rRNA gene and the fold differences, relative to D39 wt, were calculated as17

mentioned. Panel show representative figures of three independent biological replicates.18

19

20

21

22


32/42

32

Table 1. Strains and plasmids used in this study.1

Strain Description Reference or source

D39 Avery strain, clinical isolate capsular serotype 2 (6, 26)

R6 D39-derivative unencapsulated laboratory strain (26)

TIGR4 Invasive clinical isolate, capsular serotype 4 (49)

SPJV01 D39 encoding pMV158GFP, TetR This study

EJ3 D39-derivative luxS null mutant, SpecR (21)

SPJV02 EJ3 encoding pPP2, SpecR, TetR This study

SPJV04 EJ3 encoding pJVPP9, SpecR, TetR This study

SPJV05 D39-derivative luxS null mutant, EryR This study

SPJV06 SPJV05 encoding pJVR6, EryR, SpecR This study

SPJV07 SPJV05 encoding pJVPP9, EryR, TetR This study

SPJV08 SPJV05 encoding pMV158GFP, EryR, TetR This study

E. coli TOP10 cells Cloning host Invitrogen

ECJV10 E. coli TOP10 encoding pJVR6 This study

ECJV11 E. coli TOP10 encoding pJVPP9 This study

Plasmids

pCR2.1 TOPO Cloning vector Invitrogen

pReg696 Low copy plasmid for Gram positives (14)

pPP2 Integrative plasmid forS. pneumoniae strains (15)

pJVPP9 pPP2 encoding the luxS wt gene from strain D39 This study

pJVR6 pReg696 encoding the luxS wt gene from strain D39 This study

pLux-ery-Lux pCR2.1TOPO encoding the luxS-ery-luxS cassette This study

pMV158GFP S. pneumoniae mobilizable plasmid encoding the greenfluorescent protein gene

(36)

3

4

5


33/42

33

Table 2. Primers used in this study.1

2

Primers Target gene(s)* Sequence** PCR product size (bp)

JVS1L pbp2X-mraY AGTAAGTCAACAAAGTCCTTATCC 600

JVS2R TATTGCTGAATTGGCTACTAAATA

JVS3L mraY-clpL GGTAAATGAAAGCCTTACTAGAAC 482

JVS4R TGTTAAGTTTCGACCTAGTTTTG

JVS5L clpL-luxS CTAAGGAAGACCTTTCTAAGATTG 953

JVS6L ACATCATCTCCAATTATGATATTC

JVS7L luxS-Sp0341 CTATCACAGCTACAGAAAATCCT 306

JVS8R AAAACTTTCGACAATAACTTCTTT

lytA-L lytA AGTTTAAGCATGATATTGAGAAC 272

lytA-R TTCGTTGAAATAGTACCACTTAT

luxS-L luxS ACATCATCTCCAATTATGATATTC 257

luxS-R GACATCTTCCCAAGTAGTAGTTTC

0341-L Sp0341 (560) TATGTCCAATATGTACCACGAC 386

0341-R TGAAGTCAAGAACTGTTTGATAGT

gyrB-L gyrB AATAGTTGGAGATACGGATAAAAC 227

gyrB-R TATATTCAACGTAACTAGCAATCC

16SrRNA-L rpsP AACCAAGTAACTTTGAAAGAAGAC 126

16SrRNA-R AAATTTAGAATCGTGGAATTTTT

LuxP2-L luxS TTGGTACCGAGAGGTTTTCTCTCTGTCTCA 554

LuxP2-R TTTCTAGATTAAATCACATGACGTTCAAAG

Ery-L ermB AAAAATTTGTAATTAAGAAGGAGT 795

Ery-R CCAAATTTACAAAAGCGACTCA

Lux5-L luxS (30) TTGGTACCGAACTTGACCACACCATTGTC 208

Lux5-R TTGGATCCATGGTGAACAGTCAATCATGC

Lux3-L luxS (275) TTCTCGAGACGTCACACCAGTGCTAAAAT 159

Lux3-R TTTCTAGAATGAGTCTTGCCCATTCTTTA

LuxReg-L luxS TTGGATCCGAGAGGTTTTCTCTCTGTCTCA 554

LuxReg-R TTGAGCTCTTAAATCACATGACGTTCAAAG


34/42


35/42

Fig.1

A

1 3 4 5 7 8 9 10 11 12 132 6 14 15B 16 17

JVS78380

luxS300

JVS56

960

1200

JVS34480

JVS12600


36/42

.

20

ssion

mBAP

+19.3

10

15

mRNAexpre

extractedfr

.

0

5

Foldchangei

relativetoRN

+2.06

lux

Sp034

0341-lux

gyr


37/42

Fig.3

A B

0.60100

0.2

0.4

iofilmsCV

A6

iofilmbiom

as

40

60

80

D39

TIGR4

R6

%

0

20

D39

TIGR4

R6

C

0.6

0.8

CVA630

0.2

0.4

Biofilm

Time (h)

D100

120

mass

40

60

80

%Biofilm

bio

Time (h)

2 4 6 8 10 12


38/42

Fig.4

A

biomass

80

100

120

%Biofilm

20

40

60

**

*

0

D39

EJ3

SP

JV

04

SP

JV

02

SP

JV

05

SP

JV

06

SPJV04D39 EJ3

100m


39/42

Fig.5

A

)84.27.28

8 14.73.5SPJV05 *

Time(h

253.5

24.69.3

9.43.6

1.870.62

3

4

5

39

20 40 60 80

% Biofilm biomass

E F G


40/42

Fig.6

SPJV08+SPJV05

answell

*

A

SPJV08+D39

SPJV08 **

*SPJV01+D39T

20 40 60 80 100

% Biofilm biomass

B C D


41/42

Fig.7

D39+AI-2

SPJV05

SPJV05+AI-2

**

*

#

20 40 60 80 100 120 140

% Biofilm biomass

D39


42/42

Fig.8

A40

50 luxSly tA

gyrB

ply

RNAexpression

oBAP

50.9

31.328.9

0

10

20

o

ldchangeinm

relative

-2.7-0.82

-3.4

10.4

22.3

13.8 13.8

28.0

5.02

22.3

Documents

2011 the LuxS-Dependent Quorum Sensing System Regulates Early Biofilm Formation by Streptococcus Pneumoniae Strain D39