Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing...

Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine

(PGM™) Sequencing Instrument Human Identification Group, Life Technologies

8/16/2012 | Life Technologies™ Proprietary and confidential 2

07/02/12

Agenda • Overview of PGM™ instrument technology and chemistry

• Overview of PGM™ instrument workflow

• Potential applications of PGM™ instrument for human identification

• Early feasibility studies

• Future plans

07/02/12

Genotyping by Fragment Analysis or Sequencing

3500 Genetic Analyzer Fragment or sequence analysis by fluorescent

detection

Y-STR Haplotype

SNP Genotype

mtDNA Haplotype

Microbial ID

STR Genotype

Ion Torrent PGM™ Sequence analysis by

proton detection

Human Identification Applications on PGM™

STRs Mito SNPs

Short Tandem Repeats

Mitochondrial DNA

Single Nucleotide

Polymorphisms

07/02/12

PGM™ Instrument Technology

07/02/12

PGM™

One Touch Instruments Emulsion PCR and Enrichment

Instruments Semiconductor Chip

Sequencing Chemistry • Natural nucleotides • Natural enzymes

Sample Prep • Libraries • Clonal beads

Reagents Torrent Server

Informatics

The Ion Torrent PGM™ Instrument System

07/02/12

Ion Technology Core Principles

• Scalability • Semiconductor technology • 40 years of Moore’s law

• Simplicity • Natural nucleotides • No lasers • No optics • No camera • No fluorescence • No enzyme cascade

• Speed • Rapid detection of sequence

extension The Chip is the Machine TM

07/03/12

Scalable Semiconductor Technology

Wafer Semiconductor Manufacturing

Chip Semiconductor Packaging

Chip Cross Section Semiconductor Design

Semiconductor Scalability

▲ Ion 314 >150 Mb

▲ Ion 316 >850 Mb

▲ Ion 318 >1400 Mb

07/03/12

Sanger Sequencing Method for CE

07/03/12

PGM™ Instrument uses Simple Natural Chemistry

07/03/12

1 Nucleotide bases (dNTP’s) are sequentially flowed into well one at a time

2 Upon incorporation, the nucleotide releases a hydrogen ions which creates a pH change in the well

3 Sensing layer detects the change in pH

4 Sensing plate translates the chemical signal to a digital signal

5 Voltage detected is proportional to number of bases incorporated

Electric voltage measurement

Detection Chemistry on the PGM™ Instrument

Sensor Plate

Silicon Substrate

Drain Source Bulk

∆ pH

Sensing Layer

Schematic cross-section of a single well on a Ion Torrent sequencing chip

Bead with clonally amplified template

07/03/12

Demonstration of the Chemistry

07/02/12

Data Output is an Ionogram • An “Ionogram” is the output of the signals in flow space

• Must be read “up-and-down” along with “left-to-right”

• Height of bar indicates how many nucleotides incorporated during flow

• “Negative” or “zero” flows indicate no nucleotide incorporation • These observations are omitted when converting to nucleotide space

Key Sequence

Sequence: …AATCTTCTGAATTTCTGCAA…. (TTT)

(AA) (AA)

07/03/12

Summary of Technology

• Based on semiconductor technology • Simple, natural nucleotides • Nucleotides are flowed into chip one at a time • Nucleotide incorporation releases a H+ proton • Measure pH change by change in voltage • Voltage detected is proportional to number of bases

incorporated • Nucleotide sequence displayed as an Ionogram

07/02/12

PGM™ Instrument Workflow

07/02/12

PGM™ Workflow

OneTouch™ OneTouch™ES PGM™ AutoMate Express™ Torrent Server & Torrent Browser

07/03/12

OneTouch™ and OneTouch ES™ Instruments

Biotinylated Template + ISP

MyOne Bead + Streptavidin

Non-Templated ISP

emPCR®

Enrichment

07/03/12

Sequencing the Targeted Amplicons

Loading Port

07/02/12

Ion Torrent™ Server for Data Analysis

Desktop Analysis

Plugin Store (Ion Community)

Plug-Ins Cloud Analysis

NextBioXfr (Plug-In)

Torrent Server Torrent Browser Run Reports Plug-Ins

HID_SNP_Genotyper variantCallerForMtDNAAlignment (TMAP) RNA-seq (IsoEM) U. Connecticut Variant Annotation (SNPeff) Edge Biosystems De novo assembly (MIRA)

07/03/12

Ion Torrent™ Product Workflow

Individual Step Application Specific

Multiplex Step Generic

Multiplex Step Application Specific

07/02/12

Ion Community http://ioncommunity.iontorrent.com

PGM™ Users − Site prep − User guides − FAQs − Videos − Discussion Forum

Torrent Suite − Torrent Suite Guides − Release notes − File formats − Database schema

07/02/12

Potential Human Identification Applications for PGM™ Instrument

Human Identification Applications on PGM™

STRs Mito SNPs

Short Tandem Repeats

Mitochondrial DNA

Single Nucleotide

Polymorphisms

07/03/12

Common STR Genotyping Technologies

• Capillary electrophoresis • Detection of STR loci by fragment length and fluorescence

• Mass spectroscopy • Sequence differences in STR alleles but not location

Identifiler® Kit

07/03/12

PGM for STR Genotyping • Allows large number of STR loci to be sequenced simultaneously

• Combine autosomal, Y, X STR markers • Increased discrimination from SNPs in repeats or flanking regions

• Allows identification of up to 96 individuals simultaneously on one chip

• Requires 10 ng of DNA input- similar to most NGS platforms • Suitable for reference type samples • Optimization of lower input needed for forensic samples

• May require updated database information • Process/criteria for uploading sequence information and/or SNPs in the profiles • Process/criteria for query of profile

• Convert to length to query existing databases

• Use SNP information for further exclusion capability • Frequency information on SNPs detected

• For the purposes of statistical calculations for inclusion

07/02/12

Human Identification Assays on PGM™ Mitochondrial DNA Sequencing

Missing person/verification of human remains

Genealogical research

07/03/12

MOST COMMON APPROACH - Sanger sequence with BDT v1.1 chemistry

Mitochondrial DNA Sequencing Methods

SNaPShot for mito coding region SNPs

07/02/12

PGM™ for Mitochondrial Sequencing • Able to sequence the whole 16 kb mito genome on one chip with high coverage

• CE requires 90 reactions (26 for PCR, 64 for sequencing) for whole genome sequencing using the MitoSeq protocol

• Able to sequence the control region plus targeted SNPs in the coding region on one chip

• Able to sequence up to 96 individuals on a single chip

07/03/12

Mitochondrial Whole Genome Sequencing

Coverage across the mtGenome Number of reads mapped

Mitochondrial genome - 16,569 bases

07/03/12

Mitochondrial Whole Genome Sequencing

Coverage

Reference

Zoomed into Polymorphisms

07/03/12

Mitochondrial Haplotypes H

Potential Human Identification Assays on PGM™

• SNP genotyping • Missing person identification • Paternity • DVI • Molecular “phenotype”

• Phenotypic SNPs for investigative leads

Eye color

Hair color

Facial reconstruction

07/02/12

Features of SNPs • Abundant in the human genome (~9 million)

• 90% of human genetic variation comes from SNPs • SNPs occur about every 300 bp; coding and non-coding regions • Most SNPs are biallelic • Low mutation rate (1 X 10-9 per locus per generation) • High heterozygosity & low population heterogeneity • Small amplicon size

07/03/12

Common SNP Technologies • Allele discrimination methods

• Sequencing • Primer extension • Ligation • Hybridization • Enzymatic cleavage

Limitation on number of SNPs detected simultaneously

SNaPshot® Assay

Oligo ligation assay (OLA)

Homozygote 2

Homozygote 1 Heterozygote

TaqMan® Assay

07/02/12

PGM™ for SNP Genotyping

• Allows combination of large number of SNPs in one multiplex • Combine autosomal, Y-, X- chromosome and phenotypic SNPs simultaneously

• Allows identification of up to 96 individuals simultaneously on one chip

• Requires 10 ng of DNA input - similar to most NGS platforms • Suitable for reference type samples • Optimization of lower input needed for forensic samples

PGM™ for SNP Genotyping

• 136 SNPs – 103 autosomal and 33 Y covered by amplicons < 150bp

• Based on published SNPs with high heterozygosity and low Fst

• Genotype match probabilities of 10-31 - 10-35

Human Identification SNP panel version 01

Each arrow represents one or more SNPs

07/03/12

Library Preparation Protocol

Prepare library 10ng DNA input

07/03/12

SNP Amplicon Coverage

Female - Individual

Y SNPs

Male - Individual

HID on ION Community Website

Visit ION Community Website

What’s Available: Protocols, Plug ins, and other Tools Click HID icon Register/Login

ION COMMUNITY PAGE HID PAGE

Genotype Calling on PGM™

07/02/12

Ion AmpliSeq™ Technology: Designer or Custom Panels

Single-tube ultra-high multiplex PCR, single day workflow More Info @ www.ampliseq.com

+ Up to 6,144 primer pairs per tube

10 ng gDNA

Construct Library Prepare Template Run Sequence Analyze Data Customize Panel

07/03/12

Summary Demonstrated Applications for HID

• Whole mitochondrial genome of five individuals sequenced on 1 chip

• Autosomal and Y SNPs from multiple individuals sequenced on 1 chip

• 314 chip mean high quality coverage was 50x for mitochondrial genome and 1000x for SNPs

• Barcodes enable sequencing multiple samples on 1 chip

07/03/12

Future Plans • Investigate potential external collaborators for research applications on

the PGM

• Explore potential research protocols • for whole mitochondrial genome sequencing for reference sample • for sequencing large SNP multiplexes for reference samples

• Investigate sequencing of other human or microbial identification markers

07/03/12

Thank You

Refer to product page on the Life Technologies website for Limited Use License.

The content provided herein may relate to products that have not been officially released and is subject to change without notice.

Exploring Human Identification Applications for the Ion Torrent Personal Genome Machine Sequencing...

Technology

Genome Sequencing - NDSUmcclean/plsc411/Genome Sequencing...Genome Sequencing . ... Here the Phred scores are overlaid on the chromatogram of a Sanger sequencing output. ... o Directed

Sequencing at sea: challenges and experiences in Ion Torrent PGM

sequencing of genome

Sequencing the Human Genome€¦ · • Weber, J. L., & Myers, E. W. (1997). Human whole-genome shotgun sequencing. Genome Res, 7(5), 401-409. – Use clone end sequencing generating

Genome Sequencing: Harmonia axyridis

Sequencing the Maize Genome Maize Genome Sequencing Consortium rwilson@watson.wustl.edu

Genome mapping Genome sequencing Next Gen sequencing

GENOME SEQUENCING. I. Genome sequencing The Sanger Method (1977) Denaturation +priming Polymerization

Genome-Sequencing Types

Genome Sequencing Project

Plant Genome Sequencing

Clinical genome sequencing

Ultrasensitive single-genome sequencing: accurate

GENOME-WIDE SEQUENCING: PROBAND

Genome Sequencing and Assembly

Sequencing the Human Genome

Ion Torrent PGM sequencing for genomic typing of Neisseria ... · 68 The introduction of affordable an d fast benchtop NGS machines like the Ion Torrent Personal Genome 69 Machine

Whole-Exome Sequencing and Whole-Genome Sequencing in

Sequencing a genome (a) outline the steps involved in sequencing the genome of an organism; (b) outline how gene sequencing allows for genome- wide comparisons

Class 02: Whole genome sequencing. The seminal papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA