View
3
Download
0
Category
Preview:
Citation preview
DEVELOPMENT OF MOLECULAR DIAGNOSTIC PROCEDURE TO DETECT
INHERITED DISORDERS
Submitted By
Mohthash Musambil
111702018
M.Sc. Medical Biotechnology
Manipal Life Sciences Centre
Project Guide:
Dr. P. Gopalakrishna Bhat
Professor
Division of Biotechnology
Manipal Life Sciences Centre
Manipal University
Submitted to:
Division of Biotechnology
Manipal Life Sciences Centre
Manipal University, Manipal-576104
Karnataka, India.
1
CERTIFICATE
To
The Director
Division of Biotechnology
Manipal Life Sciences Centre
Manipal University, Manipal
As thesis advisor for Mohthash Musambil (Reg. No. 111702018) for the dissertation work
titled “Development of molecular diagnostic procedure to detect inherited disorders”, I
certify that I have read this dissertation, find it satisfactory and in compliance with the University
rules and regulations towards the partial fulfillment for the award of Master of Science in
Medical Biotechnology of Manipal University, Manipal.
Place:
Date:
Thesis Advisor’s Signature
Thesis Advisor’s Name and Address:
Dr. P. Gopalakrishna Bhat
Professor,
Division of Biotechnology,
Manipal Life Sciences Centre,
Manipal University,
Manipal
2
ACKNOWLEDGMENT
First and foremost, I thank God Almighty for providing me an opportunity to carry out this project under the
able guidance of experienced scientists and professionals.
I would like to express my gratitude to Dr. K. Satyamoorthy, Director, Manipal Life Sciences Centre, for
giving me an opportunity to do my project work.
I sincerely acknowledge my project advisor Dr. P. Gopalakrishna Bhat, Professor, MLSC, whose capable
direction showed me the path towards the realization of this project.
My most sincere thanks go to Dr. Shama Prasada. K, Assistant Professor, MLSC, who offered guidance and
encouragement to me through every step of this project. I would also like to extend my gratitude to Dr. T G
Vasudevan, Assistant Professor MLSC and Ms. Neetha John, Research scholar, MLSC, for their help and
support. I would also like to thank Mr. Rajesh and Mrs. Sandhya, laboratory assistants, who were extremely
helpful in performing the capillary electrophoresis of the TP PCR products for this project.
My deepest gratitude goes out to the other PhD scholars, laboratory assistants, technical staff, academic staff
and students, who have helped me in a timely manner at various steps of this project.
3
CHAPTER NAME CONTENT PAGE NUMBER
1. Introduction 1. Genetic disorder………………………………………………………....................................10
1.1. Single gene disorder……………………………………………………………………… 10
1.2. Autosomal recessive disorder………………………………………………………………10
1.3. Autosomal dominant disorders…………………………………………………………….11
1.4. X-linked recessive disorders………………………………………………………………..11
1.5. X-linked dominant disorders……………………………………………………………….11
1.6. Chromosome–Linked Single-Gene Disease………………………………………………..12
1.7. Multifactorial and polygenic (complex) disorders……………………………………… 12
1.8. Neurodegenerative disorders.......................................................………………………….12
1.9. Trinucleotide repeats and Neurodegenerative diseases…………………………………..13
1.9. a. Trinucleotide repeats in humans……………………………………………………...13
1.9. b. Friedreich Ataxia………………………………………………………………………13
1.9. b. (i). The clinical symptoms include…………………………………………………14
1.9. b. (ii). Genetics…………………………………………………………………………15
1.9. b. (iii) Diagnosis………………………………………………………………………...15
1.9. c. Current Methodology in diagnosis of triplet repeats…………………………………16
1.9c. (i) Southern Blot……………………………………………………………………….16
1.9. c. (ii). Polymerase Chain Reaction (PCR)…………………………………………….17
1.9. c. (iii). Triplet Repeat Primed PCR……………………………………………………17
2. Review of literature
2. Friedreich ataxia……………………………………………………………………………....19
2.1. The effect of triplet repeat expansion………………………………………………………20
2.2. Frataxin………………………………………………………………………………………20
2.3. Frataxin protein and its functions………………………………………………………….21
2.4. Molecular Mechanisms of the GAA Expansion……………………………………………23
2.5. Triplet repeat primed PCR (TP PCR)……………………………………………………...24
2.6. PCR Design…………………………………………………………………………………...25
2.7. Primer Action………………………………………………………………………………...26
2.8. Triplet Repeat primed PCR for Friedreich ataxia (FRDA)……………………………….28
9
9
10
10
10
10
11
11
11
12
12
12
13
14
15
15
15
16
16
18
19
19
19
22
23
24
25
27
TABLE OF CONTENTS
4
LIST OF TABLES AND FIGURES
2.8. a. Primers Used……………………………………………………………………………….29
2.8. b. PCR Condition…………………………………………………………………………….29
2.8. c. Primer Action……………………………………………………………………………...30
3. Aim and objectives:
3.0. Aims and Objectives of the Study……………………………………………………………32
3.1. Work plan……………………………………………………………………………………..32
4. Materials and Methods:
4.1. DNA isolation from blood sample (Phenol Chloroform method)………………………….34
4.2. Reagents……………………………………………………………………………………….35
4.3. Triplet Repeat Primed PCR (TP PCR)……………………………………………………...35
4.4. Expected Size of the PCR product…………………………………………………………...36
4.5. Primer concentrations used…………………………………………………………………...36
4.6. Other Reagents………………………………………………………………………………...37
4.7. Capillary electrophoresis……………………………………………………………………...37
4.8. The electropherogram…………………………………………………………………………38
5. Results:
5.1. DNA Isolation from Blood (Control Patients)………………………………………………….40
5.2. Primer dilutions…………………………………………………………………………………..41
5.3. TP PCR Results…………………………………………………………………………………...42
6. Discussion…………………………………………………………………………..53
7. Conclusion………………………………………………………………………….56
8. References…………………………………………………………………………..59
9. Synopsis …………………………………………………………………………….64
10. Appendix…………………………………………………………………………..70
28
28
29
31
31
33
34
34
35
35
36
36
37
39
40
41
52
58
60
65
71
5
LIST OF FIGURES
Figure No. Title Page No
1 Effect of GAA triplet repeat expansion 20
2 Location of Frataxin gene 20
3 Frataxin protein functions 21
4 Molecular mechanism of GAA repeats expansion in FRDA 23
5 Primer action 27
6 Primer action of FRDA TP PCR 30
7 Expected PCR product size TP PCR-FRDA 36
8 PCR condition TP PCR –FRDA 36
9 Electropherogram 38
10 DNA Isolation from Blood (Control Patients) 40
11 Primer Dilution 41
12 TP PCR results 42
13 TP PCR results 42
14 TP PCR results 43
15 Capillary electrophoresis results 44
16 Capillary electrophoresis results 44
17 TP PCR results 45
18 Capillary electrophoresis results 45
19 TP PCR results 46
20 Capillary electrophoresis results 46
21 TP PCR results 47
22 TP PCR results 47
23 TP PCR results 48
24 Capillary electrophoresis results 48
25 TP PCR results 49
26 Capillary electrophoresis results 50
27 TP PCR results 51
28 Capillary electrophoresis results 51
29 TP PCR results 52
19
19
20
22
26
29
35
35
37
39
40
41
41
42
44
43
44
44
45
45
46
46
47
47
48
49
50
50
51
6
LIST OF TABLES
Table No. Title Page No.
1 The common neurodegenerative trinucleotide repeat diseases 13
2 Primer sequence s used in TP PCR 25
3 PCR condition 25
4 Primers used in TP PCR for FRDA 28
5 PCR condition of TP PCR done for FRDA 28
6 Primer sequences and their modification-TP PCR FRDA 54
7
LIST OF ABBREVATIONS
CE : Capillary electrophoresis
Comm Taq pol : Commercial Taq polymerase enzyme
DM : Myotonic dystrophy
DMSO : Dimethyl sulfoxide
dNTP : Deoxyribonucleotide Triphosphates
DRPLA : Dentatorubral-Pallidoluysian Atrophy
FRAX : Fragile X syndrome
FRDA : Friedreich ataxia
FXN : frataxin gene
HD : Huntington disease
HM Taq : Homemade Taq polymerase enzyme obtained from the Thermus aquaticus
MJD : Machado-Joseph disease
Negative control : PCR mix without DNA
PAH : Phenylalanine hydroxylase
PHEX : Phosphate-regulating endopeptidase
PKU : Phenylketonuria
SBMA : Spinal and bulbar muscular atrophy
SCA1 : Spinocerebellar Ataxia type 1
TMAC : Tetramethyl ammonium chloride
TP-PCR : Triplet Repeat Primed PCR
8
INTRODUCTION
9
1. Genetic Disorder:
Genetic disorders are illness caused by abnormalities in gene or chromosome. They run in
families and the onset of the disease varies in different diseases with respect to age at which the
symptoms appear and the severity of the disease. Some diseases may be even lethal to fetus.
Most of genetic diseases are rare and affect one in every thousands or millions and also
occurrence is varied to a great extent among different ethnic groups.
About 2-5% of all live born have genetic disorder. They are often severe and incurable, some can
be treated but many are not. They are classified as inherited disorders and follow predictable
inheritance patterns. Since the beginning of the twentieth century thousands of genetic disorders
have been characterized with respect to their symptoms, nature, severity, pattern of inheritance as
well as metabolic and molecular defects. Biochemical and molecular diagnostic procedure play
an important part in the detection of the disease. Among the inherited disorders, the best studied
and characterized are single gene disorders.
- Kingston. M (2002)
1.1. Single gene disorder:
Single gene disorder occurs due to mutation in single gene. About 4000 human diseases are
classified under the category of single gene defects. The pattern of inheritance of the single gene
disorders may vary in different ways. The common types of inheritance pattern observed in
single gene disorders are autosomal dominant, autosomal recessive, x-linked dominant, x-linked
recessive disorders.
1.2. Autosomal recessive disorders:
These disorders are due to defect in the genes located in any one of the 22 autosomes and the
phenotype is expressed (manifested) only when both the alleles are mutated. These diseases are
usually observed in the progeny of phenotypically unaffected parents but each parent carrying
one defective gene.
Phenylketonuria (PKU) Type 1 is one of the best examples of a single-gene disease that shows
autosomal recessive inheritance pattern. PKU occurs due to the mutations in the gene that
10
encodes the enzyme phenylalanine hydroxylase (PAH); when such mutations occur, the affected
person cannot convert aromatic amino acid phenylalanine to tyrosine and as a result leading to
accumulation of phenylalanine which impairs development of brain. This leads to severe mental
retardation in the affected child.
1.3. Autosomal dominant disorders:
In these types of disorders one defective allele is enough to show the phenotype of the disease
and normal allele is recessive. The phenotype appears in all generations and here both male and
female offspring are equally affected.
Huntington's disease is a classic example of autosomal dominant disorder and it is one of the
progressive neurodegenerative disorders. Main feature of this disease is its late onset (Age: 35-
44), affected individuals has already transmitted the defective gene to the next generation.
1.4. X-linked recessive disorders:
In this type of disorders more of the males show the phenotype compared to the females in the
pedigree. Another characteristic of such disorders is that in most cases the offspring of an
affected male becomes affected and his daughters remain as carriers.
Hemophilia A, a blood-clotting disorder is one of several single-gene diseases that exhibit an X
chromosome-linked recessive pattern of inheritance. Males having mutant factor VIII gene will
always suffer from hemophilia from birth, where as women are rarely affected. Duchene
muscular dystrophy is another example of X -linked recessive disorder.
1.5. X-linked dominant disorders:
These disorders are characterized by a pattern in which affected males transmit the condition to
all their daughters but not to any of their sons. However, mother with single defective gene will
transmit the disease to both sons and daughters. X chromosome-linked dominant diseases are
rare. One example is X-linked dominant hypophosphatemic rickets; in this dominant mutations
occur in the phosphate-regulating endopeptidase gene (PHEX), present on the X chromosome.
Rett syndrome is another example.
11
1.6. Y Chromosome–Linked Single-Gene Disease:
Y chromosome-linked diseases are very rare in occurrence. In these disorders only males are
affected and any defective gene in the Y chromosome will be in dominant condition and gets
transmitted to all males in the next generation. One example of Y-linked disorder is
nonobstructive spermatogenic failure, which leads to infertility in males.
- Antonarakis & Beckmann (2006)
1.7. Multifactorial and polygenic (complex) disorders:
Genetic disorders also occur due to complex, multifactorial, or polygenic factors which are
associated with the effects of multiple genes in combination with lifestyles and environmental
factors. They include mostly heart disease and diabetes. They do not exhibit Mendelian pattern
of inheritance, characterization of genes associated with these diseases is more complex and only
some of them have been identified.
- Badano & Katsanis (2002)
Specific genes responsible for many of the single gene disorders have been detected;
characterized and specific diagnostic tests have been developed. Subgroup of these disorders
have common manifestation affecting the development and functions of brain and are referred to
as neurodegenerative disorders.
Griffiths et.al. (2000)
1.8. Neurodegenerative disorders:
Neurodegeneration is a term that refers to the progressive loss of structure or functions of
neurons, including death of neurons. Diseases, including the Fragile X syndrome (FRAX),
Myotonic dystrophy (DM), Spinal and bulbar muscular atrophy (SBMA, also known as Kennedy
disease), Huntington disease (HD), Dentatorubral-Pallidoluysian Atrophy (DRPLA),
Spinocerebellar Ataxia type 1 (SCA1) and Friedreich ataxia (Table 1) occur as a result of
neurodegenerative processes.
Some of these disorders affect the development and function of brain. Many of these disorders
have been found to be associated with copy number variation involving short triplet repeat
12
expansions (Table-1). These disorders occur due to gene mutation in single genes and these
defective genes get transmitted from one generation to another.
1.9. Trinucleotide repeats and Neurodegenerative diseases:
1.9 .a. Trinucleotide repeats in humans:
The first triplet repeat disorder studied in humans is Fragile X syndrome caused due to the triplet
repeat CGG in the year 1991.Since then many Neurodegenerative disorders have been known to
be caused by expansion of unstable trinucleotide repeat sequences, these include Myotonic
dystrophy (DM), Spinal and bulbar muscular atrophy (SBMA, also known as Kennedy disease),
Huntington disease (HD), Dentatorubral-Pallidoluysian Atrophy (DRPLA), Spinocerebellar
Ataxia type 1 (SCA1), Machado-Joseph disease (MJD), and Friedreich ataxia. Studies regarding
these diseases in more detail lead to understanding of involvement of the unstable repeats and the
mechanism by which the repeat expansions cause disease symptoms.
- Timchenko & Caskey (1997)
Trinucleotide repeat disorders are also called as trinucleotide expansion disorders as these
disorders are caused by trinucleotide repeat expansion in the genome.
In this kind of disorder, mutation causes trinucleotide repeats in certain genes to exceed normal
threshold which is different for different genes, the first triplet disorder to be identified was
Fragile X syndrome caused due to expansion of trinucleotide repeats CGG.
Neurodegenerative trinucleotide repeat diseases are broadly classified into two categories (Table-
1)
A Polyglutamine repeat disorder where the CAG repeats in the coding segment of the
gene is translated in to polyglytamine.
Trinucleotide repeat is present in untranslated region of the gene, disease manifestation
has been shown to involve has more varied molecular mechanisms, including gene
repression.
13
Table 1: The common neurodegenerative trinucleotide repeat diseases - Everett (2004)
1.9. b. Friedreich Ataxia:
This disease is named after the German physician Nikolaus Friedreich, who first described it in
the 1860s.Friedreich ataxia (FRDA) is an inherited disease that causes progressive damage to the
nervous system, resulting in symptoms like gait disturbance, heart diseases, diabetes and even
speech problems affecting one in 1 in 50,000 people among Caucasian population. It is less
studied in Indian population. It occurs due to the degeneration of nerve tissue in the spinal cord;
sensory neurons essential for directing muscle movement of the arms and legs. The spinal cord
becomes thinner and nerve cells lose some of their myelin sheath .
1.9 .b. (i). The clinical symptoms include:
• Changes in vision
• Progressive gait and limb ataxia, absent lower limb reflexes.
• Dysarthria, Cardiomyopathy, Scoliosis, and foot deformity.
• Jerky eye movements and loss of balance -Schmucker &Puccio (2010)
Translated (polyQ) triplet repeat diseases Untranslated triplet repeat diseases
Disease Triplet repeat sequence
Huntington’s disease(HD) CAG
Dentatorubralpallidoluysianatrophy CAG
Spinocerebellarataxia(SCA)1-7,17 CAG
Kennedy’disease CAG
Disease Triplet repeat sequence
Spinocerebellar ataxia-8, CTG
Spinocerebellar ataxia 12 CAG
Friedreichic Ataxia- (FRDA) GAA
Myotonic Dystrophy CTG
Fragile X syndrome CGG
14
1.9. b. (ii) .Genetics:
This disorder is caused due to expansion of GAA repeats in the first intron of frataxin (FXN)
gene present on chromosome 9q13. The majority of individuals with this disease have
homozygous GAA trinucleotide repeat sequence in the first intron of FXN gene. The others are
heterozygous for the GAA expansion and point mutation. The presence of 60 to 1300 GAA
repeat expansion in the FXN gene results in inhibition of the gene expression which in turn
results in production of insufficient amount of mitochondrial protein frataxin. Healthy persons
are characterized by 7–22 GAA repetitions, while patients carry 200–900 GAA repeats in this
locus. Studies have reported that frataxin protein is involved in many important function of cell
such as it act as iron transporter, iron-binding protein, Fe-S cluster assembler, oxphos stimulator,
and mitochondrial antioxidant. These mutations do not result in the production of abnormal
frataxin proteins. Instead, they cause gene silencing and decrease in the quantity of the gene
expressed through induction of heterochromatin structures.
– Klockgether (2011), Holloway et.al. (2011)
1.9. b. (iii). Diagnosis:
Initial diagnosis of patients with FRDA condition is made by a physical examinations and tests
to assess sensory and motor functions of nervous system by a neurologist. In addition, tests such
as Computerized Tomography (CT scan), Magnetic Resonance Imaging (MRI), and Electro
Myogram (EMG) to assess extent of damage. After the first report of association of triple
nucleotide (GAA) repeat expansion in FRDA in 1996, there was a rapid development in
molecular diagnosis procedures for detecting triple nucleotide expansion by molecular approach.
Diagnostic tests have been developed employing Southern blotting, PCR amplification of the
gene at the site of expansion and various modification of these methods. All these tests are aimed
at not only the diagnosis of affected person but also to assess the carrier status of parents,
siblings, and offsprings of the affected individuals.
15
Lack of precision and accuracy in determining the exact size of GAA repeats by conventional
PCR amplification procedure led to improvisation of this method. One of the modification found
to be promising is Triplet repeat primed PCR (TP PCR) in which more than two primers are used
that amplifies the pathogenic trinucleotide repeats.
- Marmolino (2011), Holloway. et.al. (2011)
1.9. c. Current Methodology in diagnosis of triplet repeats
1.9. c. (i). Southern Blot:
Southern blot is routinely used molecular biology method for detecting deletions/copy number
variation, insertion of segments of DNA in the specific region of the target gene. In case of
detection of triplet repeats, Southern blot is one of the accurate and most reliable methods. It
helps in detection of pathological expansion of triplet repeats. The disadvantage of Southern blot
is that it requires larger quantity of DNA, time consuming and labor intensive.
- Southern. E (1975)
1.9. c. (ii). Polymerase Chain Reaction (PCR):
The most commonly employed method for detection of such triplet repeats is polymerase chain
reaction (PCR) with carefully designed set of primers targeted to triplet expansion segment.
Automation of PCR, availability of sequence data, non-radioactive labeling methods have made
it one of the routinely used techniques in medical and biological research labs as well as
diagnostic purposes. But in case of detecting long expansions of triplet repeats which are
commonly associated with disorders, normal PCR fails to give reliable results.
- Bartlett and Stirling (2003).
16
1.9. c. (iii). Triplet Repeat Primed PCR:
The TP-PCR assay was first described by Warner et.al. (1996) to detect CAG repeat expansion in
DNA from Myotonic dystrophy patients or their family members and has been modified to assess
FRDA by Ciotti et.al. (2004). The main differences here compared to the normal PCR is that
fluorescently labeled locus specific primers flanking the triplet repeats and a set of paired primers
which amplifies the long expanded triplet repeats from multiple priming sites are used. It results
in rapid identification of large pathogenic repeats.
In this study we have made an attempt to standardize the protocol for detecting the GAA repeat
expansion in suspected patients of FRDA.
17
REVIEW OF LITERATURE
18
2. Friedreich ataxia:
German pathologist and neurologist, Nikolaus Friedreich who practiced in University of
Heidelberg, Germany described this disease in 1863. He is the first neurologist who described
the clinical symptoms and manifestations of a type of ataxia, which was later referred to as
Friedreich Ataxia in the medical literature. It is the most common of the hereditary ataxias with
a prevalence of 1 in 50 000 in Caucasian population. It is less studied in Indian population. A
recent study on FRDA families in Indian population by Singh et.al. (2010) describes existence of
a common origin of FRDA in Indian and Caucasian populations. The detailed study on the age of
mutation and haplotype analysis suggests that the origin of the Friedreich’s ataxia (FRDA)
mutation came from pre-mutation alleles which were transmitted to India through European
migration. They also concluded that the South Indian population acquired the FRDA more
recently through mutations that got transmitted from combination of North Indian with the pre-
existing South Indian population Singh et.al. (2010).
The disease usually has a late onset with an average age ranging from 20-25 in most of the cases
and in rare cases even at early age of 7. Friedreich ataxia ultimately results in the degeneration of
nerve tissue and neurons essential for directing muscle movement. Spinal cord becomes thinner
and nerve cells lose some of their myelin sheaths. FRDA is transmitted as autosomal recessive
disorder. Campuzano et.al. (1996) reported that the most common molecular abnormality
associated with Friedreich ataxia was a homozygous expansion of GAA repeat in the first intron
of the frataxin gene located on the long arm of chromosome 9. Frataxin is a mitochondrial
protein thought to be playing an important role in iron metabolism. GAA repeat expansion
inhibits frataxin expression both quantitatively and qualitatively. Lengths of the expanded GAA
repeat are inversely proportional to Frataxin transcription and expression. The normal repeat
length is less than 39 and in Friedreich ataxia patients generally have repeats ranging from 100 to
1700. Also it has been noted among FRDA patients, symptoms and severity are not uniformly
manifested with the similar extent of expansion. Possibly factors such as nutrition, modifier
genes and somatic mosaicism also play a role in such variation. The expansion of triplet repeats
GAA leads to meiotic and mitotic instability in the genome. Studies on the variation in the entire
length of frataxin gene revealed that in addition to GAA repeat expansion mutations at coding
segments also contribute to the pathogenesis. About 2% of patients of FRDA are compound
19
heterozygotes, having the GAA repeat expansion on one allele and having a point mutation on
the other.
- Pianese et.al. (1997), Campuzano et.al. (1996) and Cossee et.al (1999), Ciotti et.al. (2004)
2.1. The effect of triplet repeat expansion
The frataxin gene codes for a protein called frataxin which is translocated to the mitochondrial
inner membrane and essential for many of the metabolic activities of mitochondria particularly
maintaining Iron Sulfur cluster. Pathogenic GAA repeats (100-1700 repeats) in the introns has
been shown to result in inhibition of its expression which in turn leads to lower amount of
frataxin protein. The triplet repeat expansion affects the frataxin production quantitatively in
many of the human tissues studied.
Figure 1-Effect of GAA triplet repeat expansion -Ciotti et.al. (2004)
2.2. Frataxin:
Frataxin (FXN) gene is located at position 9q21.11 and the gene size is about 64,920 bases and
extends from 71,650,175 bp -71,715,094 bp. It consists of five exons and shows tissue specific
expression and actively expressed in tissues such as brain, heart, liver, skeletal muscle and
pancreas. The expression of frataxin is highest in the CNS, spinal cord and lower levels are seen
in the cerebellum and cerebral cortex.
Figure 2-Location of Frataxin gene - http://www.genecards.org/
20
Studies carried out in mouse models by Cossee et.al (2000) show that frataxin is
developmentally expressed in mice and the frataxin knockout mouse dies in utero and this can be
avoided by expression of human frataxin. Conditional gene-targeting techniques are used in this
kind of research where in the mice the frataxin gene has been disabled in muscle and neural
tissues. In mouse models where the frataxin expression is suppressed in muscle resulted in
hypertrophic cardiomyopathy. But the neural knockouts lead to progressive ataxia associated
with neurodegeneration in the cerebellum and dentate nucleus. Further it was also observed that
respiratory chain complex was impaired associated with accumulation of iron in the
mitochondria of affected neurons.
2.3. Frataxin protein and its functions:
Frataxin is a mitochondrial protein consisting of 210 amino acids and is present in the inner
mitochondrial membrane. The exact role of frataxin inside the mitochondrion is actively
investigated by several groups and some of suggested functions are represented in the figure-3.
Figure 3 Frataxin protein functions- Everett and Wood (2004), Schmucker and Puccio (2010)
-Schmucker and Puccio (2010)
21
Studies in yeast frataxin homologue 1 protein (Yfh1p) by Babcock et.al. (1997), and Wilson and
Roof (1997) provided one of the first evidence that frataxin is involved in mitochondrial iron
balance. Disruption of Yfh1p leads to mitochondrial iron excess which in turn results in
impairment of oxidative phosphorylation, increased sensitivity to oxidant stress.
Karthikeyan et.al. (2003) reported that excess amount of iron inside the mitochondria results in
the formation of toxic reactive oxygen species (ROS) which cause damage to mitochondrial
DNA as well as proteins and also sometimes damages even nuclear DNA. The other role
suggested for frataxin protein is that it is very essential in the formation of Iron sulfur cluster
(ISC). ISCs are cofactors for proteins involved in metabolic processes required for electron
transfer. Frataxin is one of the components of the ISC synthetic machinery that does its function
during early cycles in the process of assembling the iron moiety with other proteins of ISC
assembly. Results from microarray analysis of gene expression in human cells suggest that
several genes are involved in the ISC biosynthetic pathway, and many of them are frataxin-
dependent.
Tan et.al (2003) and Everett et al. (2004)
Wong et al. (1999) mentioned that Frataxin is also involved in the response of the cell to
oxidative stress. Fibroblasts from FRDA patients are hypersensitive to oxidant stress and are
susceptible to apoptosis. This could be prevented by either inhibitors of apoptosis or iron
chelators suggesting that frataxin play a role against iron accumulation and management of
oxidative stress. These studies suggest that lack of frataxin induces apoptosis and hence
promotes neurodegeneration. Frataxin also acts as mitochondrial iron store as suggested by the
study on yeast models in which Yfh1p keeps mitochondrial iron in a soluble, non toxic and
usable form. Detailed analysis of various functions performed by frataxin is underway in
different laboratories around the world. Understanding the functions as well as mechanism action
of frataxin will help in devising a treatment procedure in the management of FRDA.
-Park et al. (2003), Schmucker and Puccio (2010)
22
Figure 4-Molecular mechanism of GAA repeat expansion in FRDA
-Everett and Wood (2004), Schmucker and Puccio (2010)
2.4. Molecular Mechanisms of the GAA Expansion
Several studies are being carried out to understand the mechanism by which the GAA expansion
induces the down regulation of expression. Both in vitro and in vivo, and studies conducted have
proposed two non-exclusive models, i) non-B DNA conformation and ii) a heterochromatin
mediated gene silencing. In bacterial models, plasmids containing expanded GAA repeat shows a
triple helical structure that directly interferes with transcriptional elongation by forming triple
helix. In an in vitro study it was observed that plasmids containing pathogenic GAA expansions
showed a retarded electrophoretic profile in agarose gel. It is was suggested that the DNA with
23
GAA repeats can easily form intramolecular triple-helix structures as they contain only purines
(R) on one strand and pyrimidines (Y) on the other strand.
- Grabczyk. E and Usdin. K (2000)
Studies also suggest formation of a “sticky DNA” that have been shown to inhibit transcription
in vitro and in mammalian cells. All these proposals regarding formation of triple helix and
stabilization where better using DNA triplex-stabilizing conjugates, based on
benzoquinoquinoxaline. Recent studies have suggested a different model in which a
transcription-dependent RNA–DNA hybrid leads to transcriptional arrest, where these RNA–
DNA hybrid structures might later cause repeat instability in the cell. Some of the studies also
state that epigenetic mechanism may also suppress the expression of a nearby heterochromatin-
sensitive cell surface reporter gene. The evidences for these conclusions came from transgenic
mice where studies were carried out by placing a reporter gene closed to expanded GAA repeat.
Yet another mechanism by which transcriptional silencing of the heterochromatin could be
posttranslational modifications of histones, including changes in acetylation and methylation, as
well as DNA methylation. Much research is focused on studying the molecular mechanisms of
unstable GAA repeat expansion and yet exact mechanism remains unclear.
- Gottesfeld J.M. (2007), Schmucker and Puccio (2010)
2.5. Triplet repeat primed PCR (TP PCR):
As in normal PCR they can amplify only up to 100 triplet repeats approximately and it’s not
reliable completely, the concept of triplet repeat primed PCR first came from the works of
Warner et.al. in the year 1996. This method was developed for detecting triplet CAG repeats
whose expansion is associated with several neurodegenerative disorders including Myotonic
dystrophy, Huntington's disease, Spinocerebellar ataxia (SCA)type I and SCA type III, and
Dentatorubralpalludoluysian atrophy (DRPA).They used an improvised version of the normal
PCR technique using a fluorescently labeled locus specific primer flanking the CAG repeat
together with paired primers amplifying from multiple priming sites within the repeat (Figure-5).
Triplet repeat primed PCR (TP PCR) provides a better amplification of the triplet repeats on the
fluorescence trace leading to the rapid identification of large pathogenic repeats that cannot be
amplified using flanking primers used in normal PCR. In their experiment they tested about 183
24
people from Myotonic dystrophy families including unaffected subjects. Among them eighty five
clinically affected subjects whose genes showed expanded alleles on Southern blot analysis
were all identified by TP PCR accurately. This method is applicable for any human diseases
caused by triplet repeat expansions. Using normal flanking primers for such diseases allows
amplification only up to approximately 100 repeats but is unreliable above this size. The
Myotonic dystrophy CAG repeat shows expansion to give alleles of greater than 5 kb which
cannot be detected by normal as it fails to pick up a larger allele. This technique involves a
simple fluorescent PCR system that can rapidly identify but not size the largest alleles for any
disorder with pathogenic CAG repeat expansion. This approach will reduce the number of
Southern blot analysis which is a time consuming and labor intensive. However samples with
large CAG expansions identified by TP PCR still require Southern blotting if an accurate
estimation of size is needed.
2.6. PCR Design:
In normal PCR amplification, a pair of locus specific primers (P1, P2) that flank the variable
trinucleotide sequence. But in triplet repeat primed PCR (TP PCR assay) uses a specific flanking
fluorescently labeled primer (P1) along with a pair of primers (P3, P4) which have a common 5'
sequence tail. The schematic representation of working principle of TP PCR is shown in Figure-
5. The common 5' sequence or tail primer (P3) consists of a sequence which exhibits no
homology to any known human sequences. In the early amplification cycles, repeat specific 3'
terminus of P4 binds at multiple sites within CAG repeat alleles giving rise to a range of
products. The fluorescent locus specific primer (P1) helps in maintaining the specificity of the
binding. P4 primer is added in 10 time’s diluted quantity than P3 which ensures that primer P4
is exhausted in the early cycles of amplification. This reduces priming of P4 to already amplified
products in earlier cycles. The primer P3 then binds to the end of products formed from previous
amplification rounds. Complete extension of the larger sized products within the PCR product
mixture takes place smoothly due to the long extension time maintained in the reaction program.
25
DNA used for PCR amplification was isolated from venous blood leucocytes using extraction
protocols. Primer sequences used are shown below:
Table 2- Primer sequences used in TP PCR. -Warner et.al. (1996)
2.7. Primer Action:
PRIMER SEQUENCE
P1 - AGA AAG AAA TGG TTC TGT GAT CCC
P2 - GAA CGG GGC TCG AAG GGT CCT TGT AGC CG
P3R- TAC GCA TCC CAG TTT GAG ACG
P4CTG- TAC GCA TCC GAG TTT GAG ACG TGC TGC TGC TGC TGC T
P4CAG-TAC GCA TCC CAG TTT GAG ACG CAG CAG CAG CAG CAG CA
HDI- ATG AAG GCC FTC GAG TCC CTC AAG TCC TTC
DRPLA 2- TGCA CCA TCA CCA CCA GCA ACA GCA A
• INITIAL DENATURATION - 94°C- 4 MINS
• ADDITION OF TAQ
• DENATURATION - 94°C- 1 MIN
• ANNEALING - 60°C- 1 MIN 30
• EXTENSION - 72°C 2 MIN CYCLE
• FINAL EXTENSION -72°C 10 MINS
• STORAGE - 4 °C
Table 3-PCR condition- Warner et.al.
(1996)
26
The Figure 5 A represents a normal PCR where two flanking primers P1 and P2 binds to the DNA and amplify the
region but when used in detection of large repeats it fails to give a reliable product. Figure 5 B and 5 C represents
TP PCR where primers fluorescently labeled primer P1 and repeat containing P4 primers are used which gives
products by amplifying the target repeat sequence from multiple priming sites. Now to these products formed,
primer P3 which has a sequence similar to the P4 tail sequence binds at one side and along with P1 it amplifies it
again resulting in specific amplification of the repeat sequence.
The normal PCR performed using two flanking primers failed to give a reliable result in patients
having large or pathogenic CAG repeats. In conventional technique CAG repeat gives reliable
amplification only up to alleles of approximately 100 CAG repeats but fails to amplify above this
size where as it clearly shows the disease when detected using Southern Blot. Using TP PCR
technique it was successfully able to amplify larger repeats and gave a clear characteristic ladder
with a three base pair periodicity when products are analyzed on laser fluorescence. Proper peaks
where obtained after capillary electrophoresis and the peaks height were highest for the largest
allele height diminishes gradually in the electropherogram.
Figure 5 -Primer action
27
2.8. Triplet Repeat primed PCR for Friedreich ataxia (FRDA)
The molecular diagnosis of the FRDA triplet expansion requires a different PCR protocols to
amplify normal and mutated alleles along with the help of Southern blot analysis to determine
the size of expansion accurately. This study was carried out by Ciotti et.al. in 2004. This study is
actually a modified version of the PCR technique developed by Warner et.al. in the year 1996.
Ciotti et.al. studied fifty-four cases were studied by TP PCR assay and all were re- evaluated by
the Southern blot hybridization. The TP PCR assay correctly diagnosed the FRDA status in all
54 individuals tested including homozygous expansions (9 individuals), heterozygous expansions
(20 individuals), and non-carriers (25 individuals). Results were cross checked with Southern
blot analysis and they showed 100% concordance with those obtained by TP PCR. This
technique was successfully able to detect larger repeats which were not possible by normal PCR
technique.
- Ciotti et.al. (2004)
They also reported that normal alleles for the diseases contain 5 to 60 repeats and in case of the
FRDA patients it varies from 66 to 1700 repeats. Both alleles show expansion in about 96% of
the patients studied, and 4% of patients are compound heterozygotes for a GAA expansion. The
diagnosis of FRDA in most cases becomes problematic as they show broad clinical variability.
The molecular diagnosis of FRDA are usually done by PCR amplification of the region
containing the GAA repeat, followed by agarose gel electrophoresis of the PCR products to
determine their size. However, in most of the cases where long expansions of GAA repeats
occur, the PCR results were found to be inaccurate and require Southern blot for confirmation of
the expansion size. Although, these artifacts may disappear on denaturing, gel purification and
re-electrophoresis, results may still suffer from inconsistency. Even though TP PCR is able to
amplify larger repeats, Southern blotting is still the gold standard technique to accurately
determine the exact number of repeats. Only disadvantage of Southern blot is that it is labor
intensive, time consuming and expensive also require larger amounts of DNA. Therefore when
appropriately standardized, TP PCR can be used as the first method to assess GAA expansion in
suspected cases.
28
2.8 a. Primers Used
Table 4-Primers used in TP PCR for FRDA
2.8 .c. PCR Condition:
Table 5-PCR condition of TP PCR done for FRDA
Table 4 and 5 represent the primer sequences and PCR condition employed by Ciotti et.al. Five
µl of each PCR product were run on capillary electrophoresis. The results were revalidated by
Southern blot. The principle of TP PCR is shown in the figure-6
P1-5’-GCTGGGATTACAGGCGCGCGA-3’ (21)
P3-5’- TACGCATCCCAGTTTGAGACG-3’ (21)
P4 5’-6-FAM TACGCATCCCAGTTTGAGACGGAAGAAGAAGAAGAAGAAGAA-3’.(42)
PCR CONDITION
• INITIAL DENATURATION -
95°C- 5MINS
• DENATURATION
-94°C-30 SEC
• ANNEALING -
60°C 30 SEC
• EXTENSION -
72°C 30 SEC
• FINAL EXTENSION -
72°C 10 MINS
• STORAGE -
4 °C
PCR REAGENTS
1.5mM MgCl2
10mM Tris
50mM KCl
200 μM dNTP
P1(0.8 μM)
P3-(0.8μM)
P4-(0.08μM)
PCR CONDITION
• INITIAL DENATURATION - 95°C-
5MINS
• DENATURATION -94°C-
30 SEC
• ANNEALING -60°C
30 SEC
• EXTENSION -72°C
30 SEC
• FINAL EXTENSION -72°C
10 MINS
• STORAGE - 4 °C
PCR REAGENTS
1.5mM MgCl2
10mM Tris
50mM KCl
200 μM dNTP
P1(0.8 μM)
P3-(0.8μM)
P4-(0.08μM)
PCR CONDITION
• INITIAL DENATURATION - 95°C-
5MINS
• DENATURATION -94°C-30
SEC
• ANNEALING -60°C 30
SEC
• EXTENSION -72°C 30
SEC
• FINAL EXTENSION -72°C 10
MINS
• STORAGE - 4 °C
PCR REAGENTS
1.5mM MgCl2
10mM Tris
50mM KCl
200 μM dNTP
P1(0.8 μM)
P3-(0.8μM)
P4-(0.08μM)
PCR CONDITION
• INITIAL DENATURATION - 95°C- 5MINS
• DENATURATION -94°C-30 SEC
• ANNEALING -60°C 30 SEC
• EXTENSION -72°C 30 SEC
• FINAL EXTENSION -72°C 10 MINS
• STORAGE - 4 °C
PCR REAGENTS
1.5mM MgCl2
10mM Tris
50mM KCl
200 μM dNTP
P1- (0.8 μM)
P3-(0.8μM)
P4-(0.08μM)
35 cycles
Reaction volume was 25 μl containing 200 ng genomic DNA - Ciotti et.al.
29
2.8. d .Primer Action
The Figure represents the primer action of TP PCR done for detecting GAA triplet repeat expansion in frataxin gene
for diagnosing Friedreich Ataxia disorder. Here initially P1 primer gets attached to one side of the target region to
be amplified where as at the other end the repeat containing P4 primer gets attached. These two primers together
amplify the repeat sequence as the P4 primer is 6 –FAM labeled the product formed is also fluorescently labeled.
Now the products formed by the two primers P1 and P4 again undergo amplification. The P1 act as primer for one
end of the product and P3 primer which has a sequence that does not have homology to any of the sequence present
in human genome but having sequence same as that of the P4 primer tail sequence, acts on the other end and
amplifies the product again this second round of amplification maintains the specificity in amplification for these
large pathogenic repeat sequences.
The numbers of GAA repeats of FRDA chromosomes were studied in individuals who were both
heterozygous and homozygous for the expansion. The study suggested that the size of pathogenic
expansion ranged from 130 to approximately 1200 repeats. They also made it clear that TP PCR
was successfully able to give results for all 54 individuals studied.
Figure 6-Primer action of
FRDA TP PCR
30
AIMS AND OBJECTIVES
31
3. Aims and Objectives of the Study:
1. Standardization of the improvised Triplet Repeat Primed PCR (TP-PCR) method for the
detection of triple nucleotide expansion in the first intron of FXN gene.
2. The validation of the method by conventional technique (Southern Blotting) as well as
sequencing with samples showing pathological expansion.
3.1. Work plan
1. DNA isolation from healthy blood sample (Phenol chloroform method)
2. Triplet repeat primed PCR
3. Capillary electrophoresis
4. Southern blot
32
MATERIALS AND METHODS
33
4. Materials and Methods:
4.1. DNA isolation from blood sample (Phenol Chloroform method):
DNA was isolated from white blood cells by phenol chloroform method. Informed consent
was obtained from human volunteers before drawing blood samples. Five ml blood was
collected in a tube containing EDTA as anti-coagulant. Red blood cells are pelleted by
centrifugation at 3000 rpm for15 minutes. Plasma is discarded and to the pellet, 10ml of RBC
lysis buffer was added, mixed and kept in 37oC in water bath for 15 minutes. The blood
lysate was centrifuged at 3000rpm for 15minutes. Supernatant was discarded and pellet
containing white cells was suspended in 5ml of RBC lysis buffer and again centrifuged at
3000rpm for 15 minutes. These steps were repeated till a clear white pellet was obtained. To
the pellet 500μl WBC lysis buffer was added, contents was transferred into a new microfuge
tube and mixed with 3μl Proteinase-K(10mg/ml stock), 2μl of 10mg/ml RNAase and 10μl
SDS (20%) solution was added and mixed gently and incubated at 37oC water bath over
night. After complete digestion of protein, equal volume (500μl) of phenol was added and
mixed for 20 minutes in rotospin. Then it was kept for centrifuge at 12000 rpm for 15
minutes at 4oC. Upper aqueous phase was removed which contains DNA with a wide bore
Pasteur pipette very slowly without disturbing the phenolic phase. To this aqueous phase,
equal volume (500μl) of chloroform-isoamyl alcohol (24:1) was added and mixed for 20
minutes in rotospin. Following this step again it was centrifuged at 12000 rpm for 15
minutes at 4oC
, the final aqueous phase was taken in a microfuge tube and added with 1/10
th
volume of 3M Sodium acetate and twice the volume of absolute alcohol and mixed gently. It
was kept at -80oC for 1-3 hours or -20
oC overnight for precipitation. Centrifugation was done
at 12000 rpm for 15minuted at 4oC. To the pellet, 500μl of 70% alcohol was added,
dislodged the pellet and centrifuged again at 12000 rpm for 15 minutes at 4oC, after this the
supernatant was discarded. The pellet is semi-dried by inverting the microfuge tube over a
tissue paper. The semi dried pellet was suspended in 20 μl of MiliQ water and kept at room
temperature for dissolving. After dissolving DNA concentration was estimated using
NanoDrop 1000 Spectrophotometer and stored it at -20oC until use.
34
4.2. REAGENTS:
RBC lysis buffer
WBC lysis buffer
Phenol
Chloroform-isoamyl alcohol (24:1)
3M Sodium acetate
NaCOOCH3
Absolute alcohol
Milli Q water
-Source and the details are explained in appendix
4.3. Triplet Repeat Primed PCR (TP PCR):
SL
NO
PRIMER
NAME
SEQUENCE MODIFICATIONS
1 P1-FRDA GCTGGGATTACAGGCGCGCGA 3(21) NIL
2 P3-FRDA TACGCATCCCAGTTTGAGACG-3(21) NIL
3 P4-FRDA 5-6-FAM
TACGCATCCCAGTTTGAGACGGAAGAAGAAGAAG
AAGAAGAA-3.(42)
5’ 6-FAM
Company name -Europhin mwg operon™
Table 6-Primer sequences and their modification-TP PCR FRDA
35
4.4. Expected Size of the PCR product:
As per calculation including the primer sequences the expected product size of the triplet
primed PCR is around 88bp for a person having 7 GAA repeats in the FXN gene
4.5. Primer concentrations used:
P1-FRDA- 5µM, 0.8µM, 25µM
P3-FRDA-5µM, 0.8µM, 50µM
P4-FRDA FAM LABELLED-5µM, 0.8µM, 4µM
4.5. PCR condition:
Figure 8-PCR condition TP PCR -FRDA
• INITIAL DENATURATION - 95°C- 5MINS
• DENATURATION -94°C-30 SEC
• ANNEALING -60°C 30 SEC
• EXTENSION -72°C 30 SEC
• FINAL EXTENSION -72°C 10 MINS
• STORAGE - 4 °C
35 cycles REACTION VOLUME - 25μL
Figure 7-Expected PCR product size TP PCR-FRDA
36
4.6. Other Reagents:
10X PCR Buffer
dNTP-(4mM) and dNTP-(200μM)
MgCl2 (50mM) and MgCl2 (1.5mM)
Tris-10mM
DMSO
TMAC (50mM)
4.7. Capillary electrophoresis:
Capillary electrophoresis (CE) is a technique where separation of ionic species takes place based
on their charge and frictional forces. In conventional electrophoresis developed in 1960s, the
electrically charged analytes move in a conductive liquid medium under the effect of an electric
field. Capillary electrophoresis shows more specificity and reliability in DNA analysis,
compared with other gel electrophoresis techniques. One of the great advantages of this
technique is that it requires only less of samples and less of labor which leads to fast and
consistent separation. It works under high voltages, which may generate electro osmotic and
electrophoretic flow of ionic species within the capillary. The system holds capillary tubes within
which the electrophoretic separation occurs. High electric field strengths of 500 V/cm and above
are applied in modern capillary electrophoresis it also comprises of a detector technology which
produces a detailed electropherogram. Due to its high precession, ease of use, and limited
amount of reagents required it is convenient and more reliable than other techniques available.
37
4.8. The electropherogram:
In a typical electropherogram the number along Y axis represent relative fluorescent units or
RFUs which are used to measure threshold values. Taller the peak, stronger is the fluorescence
signal. The number along X axis of the electropherogram represents DNA fragment length in
number of nucleotides.
Y axis
X axis
Figure 9 Electropherogram
38
RESULTS
39
6 7 8 9 10 11 12 13
14 15 16 17 18 19
20 21 22 23 24
5.1 Assessment of quality and quantity of DNA:
DNA isolated from white blood cells of healthy subjects were quantified by NanoDrop 1000
Spectrophotometer. The DNA concentration ranged from 150-200 ng /μl, 19 samples were isolated
and further analyzed for quality by running 1μl of it on a 1% agarose gel at 100 V for 10 minutes.
Typical agarose gel picture is shown in the Figure 10.a-c.
25 26 27 28 29 30
1 % gel
Lane1-5- 1A
Lane6, 7- 2A
Lane8, 9-3A
Lane10, 11-4A
Lane12, 13-5A
Lane14-6A
Lane15-7A
Lane16-8A
Lane17-9A
Lane18-10A
Lane19-11A
Lane20, 21-12A
Lane22, 23, 24-13A
Lane 25-14A
Lane 26-15A
Lane 27-16A
Lane 28 -17A
Lane 29- 18A
Lane30-19F
1 2 3 4 5
5
Figure 10.a Figure 10.b
Figure 10.c
Figure 10.d
Figure 10.e
Figure 10.a, Figure 10.b and Figure 10.c – Agarose gel electrophoresis (1%gel) of DNA isolated
from blood (Control Samples)
40
5.2 Primer dilutions:
Commercial primers obtained from Europhin mwg operon™ (sequences of P1, P3 and P4 are
shown in table 4) were dissolved in appropriate volumes of Milli Q water to obtain stock
concentration of 1mM. Aliquots of stock primers are diluted to various concentrations and run on
2% agarose gel to assess concentration as well as purity. A typical agarose gel picture is shown
in figure 11.a-d.
Lane1-P1 100μM
Lane2-P1 10μM
Lane3-P1 0.8μM
Lane4-P3 100 μM
Lane5-P310 μM
Lane6-P3 0.8μM
Lane7-P4 100μM
Lane8-P4 10μM
Lane9-P4 0.8μM
Lane10-P4 0.08μM
Lane 11-P1 5μM (4μl)
Lane 12-P3 5μM (4μl)
Lane 13-P4 5μM (4μl)
Lane 14-P1 25μM (1μl)
Lane 15-P3 50μM (1μl)
Lane 16-P4 0.8μM (1μl)
Lane 17-P1 25μM (1μl)
Lane 18-P3 50μM (1.5μl)
Lane 19-P4 4 μM (2μl)
1 2 3 4 5 6 7 8 9 10
10 12
11 12 13
17 18 19
14 15 16
Figure 11.a
Figure 11.b
Figure 11.c
Figure 11.d
Figure 11.a -d: Agarose gel electrophoresis (1%gel) of primers of different concentration
41
5.3. TP PCR Results:
1 2 3 4
PCR MIX
MQ water Lane 1-DNA sample -3A
10X PCR Buffer Lane 2- Negative Control
dNTP (4mM) Lane 3-D NA sample -10A
P1 (5μM) Lane 4-Negative Control
P3-(5μM)
P4-(5μM)
DNA (150ng)
Homemade Taq pol
25 μl reaction
1 2 3 4
PCR MIX
MQ water Lane 1- DNA sample - 3A (Comm Taq)
10X PCR Buffer Lane 2- Negative Control (Comm Taq)
dNTP (4mM) Lane 3- DNA 10A (HM Taq)
P1 (5μM) Lane 4 - Negative Control (HM Taq)
P3-(5μM)
P4-(5μM)
DNA (150ng)
Commercial Taq pol
25 μl reaction
Figure 12- Agarose gel picture of TP PCR products (1.8 % gel)
Figure 13- Agarose gel picture of TP PCR products (1.8 % gel)
42
Electrophoresis picture of a typical PCR product is shown in figure 12, in this the two test
samples and their equivalent controls showed similar product bands which was unexpected. We
suspected the Taq Polymerase which was prepared in house could be responsible for the
unexpected product bands in negative controls.
We ran PCR reaction using the commercial Taq Polymerase obtained from (AmpliTaq ®) and
the electrophoresis pattern is shown in fig -13, for comparison of the PCR products , the previous
trial were run on the adjacent lanes ( Lane 3 and 4). Use of commercial Taq Polymerase for the
PCR reaction abolished the spurious bands which appeared in the negative controls. Hence forth
all PCR reactions were performed with commercial Taq Polymerase.
1 2 3 4 5 6 7 8 9
Lane 1, 6- 100 bp ladder
Lane 2, 7 DNA sample-12A
Lane 4, 8 –DNA sample -13A
Lane 3, 5 and 9-Negative controls
Reaction mixture contained primers (P1, P2 and P3) of 5μM concentration
was used in Lane 2-5.
Lanes 7- 9 had primers (P1, P2 and P3) of 2μM concentration
100bp 100 bp
Figure 14- Agarose gel picture of TP PCR products (1.8 % gel)
43
In figure 14 electrophoresis patterns of two sets of TP PCR reaction mixtures differing in primer
concentrations are shown. As expected their product bands are less intense when reaction
mixture has 2μM primer concentration as compared to that of 5μM. Aliquots of the PCR product
obtained with 5μM primer concentration were analyzed on capillary electrophoreisis by Applied
Biosystems 3130 Genetic Analyzer.
The electropherogram of PCR products are shown in fig 15 and 16. Product peak at 88 bp and
148 bp (shown with arrows) correspond to 7 GAA and 27 repeats present in the DNA. The peak
at 42 bp could be accounted by unused primer P4.
Capillary electrophoresis results:
Figure 16-Capillary electrophoresis results
88bp
148 bp
88bp 148 bp
Figure 15 –Capillary electrophoresis results
Figure 15 and 16 represents the capillary electropherogram for the Lane 4 and Lane 2 TP PCR products of
Figure 14 respectively.
Sample -13A
Sample-12A
44
To improve the quantity of the target product and minimize background signals we modified the
proportions of the three primers (as shown in the legend of fig-17). Seven DNA samples were
subjected to TP PCR with modified primer concentrations and electrophoresis pattern is shown
in fig-17. Compared to the previous runs the modified primer concentrations appeared to produce
better quality and quantity of PCR products. Among these runs one of them (Lane 6-Sample
no.3A) has been analyzed by capillary electrophoresis. The electropherogram of PCR product is
shown in fig 18. Product peak at 97 bp and 160 bp (shown with arrows) correspond to 10 GAA
and 31 repeats present in the DNA. Even though the product appeared better in agarose gel
electrophoresis, capillary electrophoresis revealed relatively lesser intensity of the products
compared to earlier trials. The difference in repeats in length could be because of the variation in
the individuals.
Lane 1-100 bp Ladder
Lane 2- DNA sample- 4A
Lane 3- DNA sample -10A
Lane 4- DNA sample -16A
Lane 5- DNA sample -2A
Lane 6- DNA sample -3A
Lane 7 –DNA sample -5A
Lane 8 Negative Control
PCR MIX (25µl reaction)
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
TMAC (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
DNA (150ng)-2 μl
Commercial Taq pol-0.25μl
97 bp 160 bp
Figure 17- Agarose gel picture of TP PCR products (1.8 % gel)
Figure 18-Capillary electrophoresis results
Figure 18 represents the electropherogram obtained after capillary
electrophoresis of the PCR product Lane 6 of figure 17.
Sample number: 3A
45
In next trials (fig 19) TP PCR reaction was carried out with additional reagent TMAC (50mM)
which has been shown to increase the product band intensity. The electrophoresis picture did not
show any perceptible improvement in the quality of PCR products. To check any improvement
in the product signal, capillary electrophoresis of one of the reaction mixture products was
carried out and the pattern is shown in fig-19. Product peak at 97 bp and 160 bp (shown with
arrows) correspond to 10 GAA and 31 repeats present in the DNA. Capillary electrophoresis
showed lesser peak heights compared to earlier trials (in comparison with fig 15-16).
1 2 3 4 5 6 7
Lane 1-100 bp ladder
Lane 2-DNA sample 3A
Lane 3-DNA sample-10A
Lane 4-DNA sample - 16A
Lane 5-DNA sample - 4A
Lane 6- DNA sample -5A
PCR MIX
MQ water
10X PCR Buffer
dNTP(4mM)
MgCl2 (50mM)
TMAC (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
DNA (150ng)
Commercial Taq pol
25 μl reaction
Figure 19 – Agarose gel picture of TP PCR products (1.8 % gel)
Figure 20-Capillary electrophoresis results, represents the
electropherogram obtained after capillary electrophoresis of the
PCR product Lane 2 of figure 19.
Sample -3A
97 bp
167bp
100 bp
46
To check for the consistency of results a few trials (fig 21-22) of TP PCR reaction was carried
out with the same reaction mix with different DNA samples. The agarose gel picture showed
similar results for most of the DNA samples.
1 2 3 4
1 2 3 4
PCR MIX
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
DNA (150ng)
Commercial Taq pol
25 µl reaction
PCR MIX
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
DNA (150ng)
Commercial Taq pol-0.25μl
25 µl reaction
Lane 1-100BP Ladder
Lane 2-DNA sample 12A
Lane 3-DNA sample 17A
Lane 4- Negative Control
Lane 1-100bp ladder
Lane 2- DNA sample 13A
Lane 3-DNA sample 14 A
Lane 4- Negative control
100bp
100bp
Figure -21
Figure-22
Figure 21 -22 Agarose gel picture of TP PCR products (1.8 % gel)
47
Figure 24.a and Figure 24.b represents the capillary electrophoresis result from TP PCR product of Lane 3 and
Lane 2 of Figure 23 respectively.
PCR MIX
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
Commercial Taq pol
DNA-4 μl
Lane1-100bp Ladder
Lane2- Suspected FRDA Sample
Lane3- DNA Sample 15A
Lane4- DNA Sample –14A
Lane 5- Negative Control
100bp 167bp
Figure 24.a
Figure 24.b
Figure 23 Agarose gel picture of TP PCR products (1.8 %)
gel)
Sample 15A
(control)
Suspected FRDA case
1 2 3 4 5
5
48
TP PCR reactions were carried out with the same reaction mix as that of fig 21 and 22 with DNA
from suspected FRDA patient and two other control samples. The electrophoresis picture did not
show much difference in the PCR products for these samples. To check any difference in product
signal and size, capillary electrophoresis was carried out and the pattern is shown in fig-24.a and
24.b. In both the samples, the peaks at 100 bp and 167 bp corresponding to 11 and 33 GAA
repeats respectively were visible.
Annealing temperature: We tried to check the optimum annealing temperature in the PCR
reaction by setting up a gradient of annealing temperature ranging from 56°C - 64°C keeping all
the other conditions constant. The gel picture is shown in fig-25 and the products of two reaction
corresponding to annealing temperature ( lane 3) 58°C and( Lane 4) 60°C were run on capillary
electrophoresis and is shown in fig 26.a and 26.b respectively. The electropherogram showed
peaks at 94 and 157 bp corresponding to 9 and 30 repeats respectively. Irrespective of two
degree difference in annealing temperature the signal strength does not show significance
difference.
PCR MIX
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
DNA (150ng)
Commercial Taq pol
DNA sample-18A
Lane 1-100bp ladder
Lane 2- 56 °C
Lane 3- 58°C
Lane 4- 60°C
Lane 5-62°C
Lane 6-64°C
Lane 7-66°C
Lane 8-Negative control
Figure 25- Agarose gel
picture of TP PCR products
(1.8 % gel)
100bp
25μl reaction
49
Figure 26.a and Figure 26.b represents the capillary electrophoresis result from TP PCR product of Lane 3 and
Lane 4 of Figure 25.
To improve product quantity, primer concentration of P4 was modified to 4μM as shown in the
legend of figure 27. Compared to the previous runs the modified primer concentrations resulted
in better PCR product bands in agarose gel electrophoresis. Among these reaction mixtures
(Lane 2 Sample no.3A) has been analyzed by capillary electrophoresis. The electropherogram of
PCR product is shown in fig 28. Product peak at 100bp and 167 bp (shown with arrows)
correspond to 11 GAA and 33 repeats present in the DNA. Even though the product appeared
better in agarose gel electrophoresis, capillary electrophoresis revealed relatively weaker signal
compared to earlier trials (fig-24 a-b).
94 bp 157 bp
DNA sample-18A
DNA sample-18A
50
1 2 3 4 5
Figure 28-Capillary electrophoresis results
100bp 167bp
Figure 28-- Agarose gel picture of TP
PCR products (1.8 % gel)
Figure 28 represents the capillary electrophoresis result from TP PCR product of Lane 3 of Figure 27.
PCR MIX
MQ water-
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(4μM)
Comm Taq pol-0.25μl
Lane 1-100bp Ladder
Lane 2- DNA sample-3A
Lane 3- DNA sample 6A
Lane 4- DNA sample -18 A
Lane 5-Negative Control
51
5.4 .Additional Modifications Done:
Normally in our laboratory PCR reaction recipes we add additional 2 μl of 50mM of MgCl2 in
addition to the Mg++
ions present in the PCR buffer mix. To check whether addition of extra
amount of MgCl2 has an effect in the TP PCR assay we modified the PCR mixes to address this
question. TP PCR was run with and without extra MgCl2 added to the reaction mixture. The
result is shown in figure 29. When extra MgCl2 was not added in the reaction mix, there was no
amplification of the PCR product (compare lane 2 and 3 in fig 29) suggesting that extra MgCl2 is
essential for amplification of the target.
100 bp
Lane 1-100BP Ladder
Lane 2-DNA 17 A without Mgcl2
Lane 3-DNA 18A with Mgcl2
Lane 4-Negative Control
PCR MIX
MQ water
10X PCR Buffer
dNTP (4mM)
MgCl2 (50mM)
P1 (25μM)
P3-(50μM)
P4-(0.8μM)
Comm Taq pol
25 µl reaction
1 2 3 4
Figure 29- Agarose gel picture of TP PCR products (1.8 % gel)
52
DISCUSSION
53
Friedreich ataxia (FRDA) (OMIM 229300) is most common among hereditary ataxia with an
autosomal recessive pattern of inheritance. Estimated prevalence in Caucasian population is about
1 in 50,000 with a carrier frequency of 1 in 90. It has been found to show onset of symptoms at the
age of 5-15 which progressively worsens as years pass. Molecular analysis of the DNA from
affected individuals has revealed it to be a disease due to expansion of trinucleotide GAA repeat
in the first intron of a gene located in on chromosome 9q13; this gene has been referred to as
frataxin, (also known as FA; X25; CyaY; FARR; FRDA). Analysis of the gene from normal and
FRDA patients revealed that GAA repeat length ranging from 5-60 in healthy subjects and repeats
varied from 66 to 1700 in FRDA patients.
GAA repeat expansion was also associated with decreased expression of the gene (Campuzano
et.al. 1996). DNA analysis of suspected cases of ataxia is extremely important to confirm the
clinical diagnosis as well as detection of carrier status. Molecular analysis based on PCR
amplification of segment of DNA containing GAA repeat and agarose gel electrophoresis often
failed to determine the extent of amplification precisely, particularly when alleles had expansions
of varying lengths. To solve this ambiguity, triplet repeat primed PCR (TP PCR) has been adopted
by Ciotti et.al (2004). We have made an attempt to standardize the TP PCR method keeping in
mind a long term goal of studying the occurrence of the disease in this part of India. - Ciotti et.al
(2004).
The purpose our study was standardizing the protocol developed by Ciotti et.al (2004) to detect
GAA triplet repeats in suspected FRDA patients by Triplet repeat primed PCR. Similar condition
and reaction mixtures were used as that proposed by Ciotti et.al.in standardizing the protocol.
DNA samples required for the study was isolated from white blood cells of healthy subjects and
were quantified by NanoDrop 1000 Spectrophotometer. The DNA concentration ranged from 150-
200 ng /μl, 19 samples were isolated and further analyzed for quality by running 1μl of it on a 1%
agarose gel at 100 V for 10 minutes. Agarose gel pictures are shown in the Figure (10 a-c). The
primers required for the TP PCR reaction was commercially obtained from Europhin mwg
operon™ (sequences of P1, P3 and P4 are shown in table 4) and were dissolved in appropriate
volumes of Milli Q water to obtain a stock concentration of 1mM. Aliquots of stock primers are
diluted to various concentrations and run on 2% agarose gel to assess concentration as well as
54
purity. An agarose gel picture representing the primer dilutions are shown in figure 11.a-d. The
primer action in TP PCR is explained shown in fig 6.
The TP PCR reaction for these control samples carried out with the PCR condition as mentioned in
fig-8. Initial results showed similar product bands in equivalent negative controls. We suspected
the Taq Polymerase which was prepared in house could be responsible for the unexpected product
bands in negative controls. After coming across this problem, we started using the commercial Taq
Polymerase obtained from (AmpliTaq®) and the electrophoresis pattern is shown in fig -13, for
comparison of the PCR products of the previous trial were run on the adjacent lanes ( Lane 3 and
4). Use of commercial Taq Polymerase for the PCR reaction was able to prevent the appearance of
unexpected which appeared in the negative controls. Hence forth all PCR reactions were
performed with commercial Taq Polymerase.
As our first attempt in correction, we checked the amplification by using different concentrations
of primers, electrophoresis pattern of two sets of TP PCR reaction mixtures differing in primer
concentrations is shown in figure 14. Product bands appeared less intense when reaction mixture
had 2μM primer concentration as compared to that of 5μM. The electropherogram of these PCR
products are shown in fig 15 and 16. Product peak at 88 bp and 148 bp (shown with arrows)
correspond to 7 GAA and 27 repeats present in the DNA. The peak at 42 bp could be accounted by
unused primer P4.
As the signal strength was less in the electropherogram we then decided to improve the quantity of
the target product and minimize background noise by varying PCR reaction conditions or
composition in different trial runs. The concentrations and proportions of P1, P2 and P3 were
modified and results are shown in the legend of fig-17). Seven DNA samples were subjected to TP
PCR with modified primer concentrations and electrophoresis pattern is shown in fig-17.
Compared to the previous runs the modified primer concentrations appeared to produce better
quality and quantity of PCR products. One of them (Lane 6-Sample no.3A) has been analyzed by
capillary electrophoresis. The electropherogram of PCR product is shown in fig 18. Product peak
at 97 bp and 160 bp (shown with arrows) correspond to 10 GAA and 31 repeats present in the
DNA. Even though the product appeared better in agarose gel electrophoresis, capillary
electrophoresis revealed relatively lesser intensity of the products compared to earlier trials. The
difference in repeats in length could be because of the variation in the individuals.
55
Then our trials of TP PCR reaction was aimed at checking for the need of additional reagents like
TMAC (50mM) which has been shown to increase the product band intensity. The electrophoresis
picture did not show any perceptible improvement in the quality of PCR products. To check any
improvement in the product signal, capillary electrophoresis of one of the reaction mixture
products was carried out and the pattern is shown in fig-19. Product peak at 97 bp and 160 bp
(shown with arrows) correspond to 10 GAA and 31 repeats present in the DNA. Capillary
electrophoresis showed lesser peak heights compared to earlier trials.( in comparison with fig 15-
16).To check consistency of the results a few trials (fig 21-22) of TP PCR reaction was carried out
with the same reaction mix with different DNA samples. The agarose gel picture showed similar
results for most of the DNA samples.TP PCR reactions were carried out with the same reaction
mix as that of fig 21 and 22 with DNA from suspected FRDA patient and two other control
samples. The agarose gel pattern picture did not show much difference in the PCR products for
these samples. To check any the difference in product signal and size, capillary electrophoresis
was carried out and the pattern is shown in fig-24.a and 24.b. In both the samples, the peaks at 100
bp and 167 bp corresponding to 11 and 33 GAA repeats respectively were visible.
As annealing temperature plays an important role in amplification reaction in a PCR, we tried to
check the optimum annealing temperature in the PCR reaction by setting up a gradient of
annealing temperature ranging from 56°C - 64°C keeping all the other conditions constant. The gel
picture is shown in fig-25 and the products of two reaction corresponding to annealing temperature
( lane 3) 58°C and( Lane 4) 60°C were run on capillary electrophoresis and is shown in fig 26.a
and 26.b respectively. The electropherogram showed peaks at 94 and 157 bp corresponding to 9
and 30 repeats respectively. Irrespective of two degree difference in annealing temperature the
signal strength does not show significance difference.
In order to improve product quantity, primer concentration of P4 was modified to 4μM and the
volumes of primers added to the reaction mix were increased as shown in the legend of figure 27.
Compared to the previous runs the modified primer concentrations resulted in better PCR product
bands in agarose gel electrophoresis. Among these reaction mixtures (Lane 2 Sample no.3A) has
been analyzed by capillary electrophoresis. The electropherogram of PCR product is shown in fig
28. Product peak at 100bp and 167 bp (shown with arrows) correspond to 11 GAA and 33 repeats
56
present in the DNA. Even though the product appeared better in agarose gel electrophoresis,
capillary electrophoresis revealed relatively weaker signal compared to earlier trials (fig-24 a-b).
The effect of additional MgCl2 on the amplification of PCR products was also checked. We have
been adding 2 μl of 50mM in addition to the Mg++ ions present in the PCR buffer mix. To check
whether addition of extra amount of MgCl2 has an effect in the TP PCR assay we modified the
PCR mixes to address this question. TP PCR was run with and without extra MgCl2 added to the
reaction mixture and the results is shown in figure 29. When extra MgCl2 was not included in the
reaction mix, there was no amplification of the PCR product (compare lane 2 and 3 in fig 29)
suggesting that extra MgCl2 is essential for amplification of the target.
57
CONCLUSION
58
7.1. Conclusion
We have attempted to standardize Triplet repeat primed PCR based molecular method to quantify
GAA repeats in DNA samples obtained from control subjects as described by Ciotti et.al (2004).
About 29 samples of DNA were isolated from control individuals and the TP PCR assay was
carried out followed by the capillary electrophoresis of the products. The electropherogram were
analyzed, in most of the cases the peaks in the electropherogram falls under the normal repeat
levels which is expected to be present in control individuals. However the quantity of the
product formed in the TP PCR reaction appears to be much less as compared to
electropherograms seen in the work of Ciotti et.al. We have attempted modifying some of the TP
PCR reaction condition to improve product signal. This methods need to be further modified to
improve the product and signal yield and then tested for its validity with Southern blotting
method taking samples from both control subjects and confirmed cases of GAA expansion.
59
REFERENCES
60
References
1. Adler K, Moore J, Filippov G et.al. (2010) A Novel Assay for Evaluating Fragile X Locus
Repeats, The Journal of Molecular DiagnostiC (13): 614–620.
2. Antonarakis S, Beckmann J (2006) Mendelian disorders deserve more attention, Nature
Reviews Genetics (7):277–282.
3. Babcock M, DeSilva D, Oaks R, et.al. (1997) Regulation of mitochondrial iron
accumulation by Yfh1p, a putative homolog of frataxin, Science (276):1709–1712.
4. Badano J L, Katsanis N (2002) Beyond Mendel: An evolving view of human genetic
disease transmission, Nature Reviews Genetics (3):779–789.
5. Baralle M, Pastor T, Bussani E et.al.(2008) Influence of Friedreich Ataxia GAA
Noncoding Repeat Expansions on Pre-mRNA Processing, American Journal of Human
Genetics (83):77–88.
6. Bartlett J M, Stirling D (2003) A Short History of the Polymerase Chain Reaction, PCR
Protocols (226):1385/1-59259-384-4:3.
7. Cagnoli C, Michielotto C, Matsuura T et.al.(2004) Detection of Large Pathogenic
Expansions in FRDA1, SCA10, and SCA12 Genes Using a Simple Fluorescent Repeat-
Primed PCR Assay, Journal of Molecular Diagnostics(6):96-99.
8. Campuzano V, Montermini L, Molto M D et.al. (1996) Friedreich’s ataxia: autosomal
recessive disease caused by an intronic GAA triplet repeat expansion, Science (271):1423-
1427.
9. Campuzano V, Montermini L, Lutz Y et.al. (1997) Frataxin is reduced in Friedreich ataxia
patients and is associated with mitochondria membranes, Human Molecular Genetics (6):
771–1780.
10. Chial H (2008) Mendelian genetics: Patterns of inheritance and single-gene disorders,
Nature Education (1):17 (http://www.nature.com/scitable/topicpage/rare-genetic-disorders-
learning-about-genetic-disease-979).
11. Ciotti P, Maria E D et.al. (2004) Triplet Repeat Primed PCR (TP PCR) in Molecular
Diagnostic Testing for Friedreich Ataxia, Journal of Molecular Diagnostics (6):285-289.
12. Cosse M, Schmitt M, Campuzano V et.al. (1997) Evolution of the Friedreich’s ataxia
trinucleotide repeat expansion: founder effect and permutations, Proceedings of the
National Academy of Sciences USA (94):7452-7457.
61
13. Everett C M, Wood N W (2004) Trinucleotide repeats and diseases, Brain (127):2385-
2405.
14. Filla A, Michele G, Cavalcanti F et.al(1996) The Relationship between Trinucleotide
(GAA) Repeat Length and Clinical Features in Friedreich Ataxia, The American Journal of
Human Genetics (59):554-560.
15. Gottesfeld J M (2007) Small molecules affecting transcription in Friedreich ataxia,
Pharmacology & Therapeutics (116):236–248.
16. Grabczyk E, Usdin K (2000) Alleviating transcript insufficiency caused by Friedreich’s
ataxia triplet repeats, Nucleic Acids Research (28):4930–4937.
17. Griffiths A J F, Miller J H et.al. (2000) Introduction to genetic analysis (7th edition), W. H.
Freeman & Co: 45-47.
18. Holloway T P, Rowley S M et.al. (2011) Detection of interruptions in the GAA
trinucleotide repeat expansion, BioTechniques (50):182-186.
19. Karthikeyan G, Santos J H, Graziewicz M A et.al. (2003) Reduction in frataxin causes
progressive accumulation of mitochondrial damage, Human Molecular Genetics (12):
3331-3342.
20. Kingston. H M (2002) Abc of clinical genetics, Bmj Books : 1-2
21. Klockgether T (2011) Update on degenerative ataxias, Current Opinion in Neurology (4):
339-345.
22. Krasilnikova M, Kireeva M, Petrovic V et.al. (2007) Effects of Friedreich’s ataxia
(GAA)n(TTC)n repeats on RNA synthesis and stability, Nucleic Acids Research( 35):
1075-1084.
23. Lamont P J, Davis M B, Wood N W (1997) Identification and sizing of the GAA
trinucleotide repeat expansion of Friedreich’s ataxia in 56 patients, Clinical and genetic
correlates, Brain (120): 673-680.
24. Marmolin D (2011) Friedreich's ataxia: Past, present and future, Brain (67): 311-330.
25. Medline plus (U.S. National Library of Medicine ,National Institutes of Health)
26. Montermini L, Andermann E, Labuda M et.al. (1997) The Friedreich ataxia GAA triplet
repeat: permutation and normal alleles, Human Molecular Genetics (6):1261-1266.
27. Park S, Gakh O, Mooney S. M et.al. (2002)The ferroxidase activity of yeast frataxin,
Journal of Biochemistry. (277):38589-38595.
62
28. Patel I, Isaya G (2001) Friedreich Ataxia: From GAA Triplet–Repeat Expansion to
Frataxin Deficiency, American Journal of Human Genetics (69):15-24.
29. Pianese L, Cavalcanti F, DeMichele G et.al. (1997) the effect of parental gender on the
GAA dynamic mutation in the FRDA gene, American Journal of Human Genetics (60):
460-463.
30. Sadic S F, Sah S, Chen L et.al.(2010) A Novel FMR1 PCR Method for the Routine
Detection of Low Abundance Expanded Alleles and Full Mutations in Fragile X
Syndrome, Clinical Chemistry (56): 399-408.
31. Saluto A, Brussino A, Tassone F et.al. (2005) An Enhanced Polymerase Chain Reaction
Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1
Gene, Journal of Molecular Diagnostics (7):605-612.
32. Schmitt M, Warner J, Barron L et.al (2000) Detection of large (GAA) n repeat expansions
by fluorescent PCR, European Journal of Human Genetics (8):1022-1026 .
33. Schmucker S and Puccio H (2010) Understanding the molecular mechanisms of
Friedreich’s ataxia to develop therapeutic Approaches, Human Molecular Genetics (19)
:103-110
34. Schols L, Amoiridis G, Przuntek H et.al.(1997) Friedreich’s ataxia Revision of the
phenotype according to molecular genetics, Brain (120): 2131-2140.
35. Singh I, Faruq M, Mukherjee O et.al. (2010) North and South Indian Populations Share a
Common Ancestral Origin of Friedreich’s Ataxia but Vary in Age of GAA Repeat
Expansion, Annals of Human Genetics (74):202–210.
36. Southern E M (1975) Detection of specific sequences among DNA fragments separated by
gel electrophoresis, Journal of Molecular Biology (98): 503-517.
37. Tan G, Napoli E, Taroni F et.al. (2003) Decreased expression of genes involved in sulfur
amino acid metabolism in frataxin-deficient cells, Human Molecular Genetics (12):1699-
711.
38. Thierbach R, Drewes G, Fusser M et.al. (2010) The Friedreich’s ataxia protein frataxin
modulates DNA base excision repair in prokaryotes and mammals, Biochemical Journal
(432):165-172.
39. Timchenko L T, Caskey C T (1997)Trinucleotide repeat disorders in humans: discussions
of mechanisms and medical issues, The FASEB Journal(14):1589-1597.
63
40. Warner J P, Barron L H et.al. (1996) A general method for the detection of large CAG
repeat expansion by fluorescent PCR, Journal of Medical Genetics (33):1022-1026.
41. Wilson R B, Roof D M (1997) Respiratory deficiency due to loss of mitochondrial DNA
in yeast lacking the frataxin homologue, Nature Genetics(16): 352–357.
42. Zuhlke C H, Dalski A, Habeck M et.al.(2004) Extension of the mutation spectrum in
Friedreich’s ataxia: detection of an exon deletion and novel missense mutations, European
Journal of Human Genetics(12):979–982.
64
SYNOPSIS
65
PROJECT SYNOPSIS
DEVELOPMENT OF MOLECULAR DIAGONOSTIC PROCEDURE TO DETECTINHERITED
DISORDERS
SUBMITTED BY
Mohthash Musambil
111702018
MSc. Medical Biotechnology
Manipal Life Sciences Centre
Project Guide:
Dr. P. Gopalakrishna Bhat
Synopsis submitted to:
Division of Biotechnology
Manipal Life Sciences Centre
Manipal University, Manipal-576104
Karnataka, India.
66
INTRODUCTION
Genetic Disorder: Genetic Disorders are illness caused by defects in the gene and transmitted
from parents to off springs, runs in families, also referred to as familial diseases. In most of the
disease symptoms may appear at birth, after birth within few weeks, in infancy, childhood or at
adolescent, later in life. During the last century several thousand genetic/inherited diseases have
been defined characterized and molecular defect have been identified. Genetic diseases are
classified as inherited disorder which means that the mutated gene or groups of genes are
transmitted through the family. Among them inherited diseases due to defect in single gene that
is specific to the disease form an important group. Over 4000 human diseases are categorized as
disorders with single gene defects. The specific genes responsible for many of these single gene
disorders have been detected; characterized and specific diagnostic tests have been developed. A
subgroup of these disorders affect the development and functions of brain and cause poor quality
of life of the person affected as well as heavy burden to the family.
. - Kingston, (2002).
Trinucleotide repeats and Neurodegenerative diseases:
A group of neurogenerative disorders have been found to be associated with significant
expansion in number of trinucleotide repeats. And these types of diseases were found to be
associated with expansion in trinucleotide repeats beyond a threshold number. The first triplet
repeat disorder to be identified was fragile X syndrome caused due to expansion of trinucleotide
repeats CGG. Neurodegenerative trinucleotide repeat diseases are broadly classified into two
categories:
1) A Polyglutamine repeat disorder in which the CAG repeats in the coding segment of the
gene is translated in to polyglutamine.
2) Trinucleotide repeat is present in untranslated region of the gene, and has more varied
molecular mechanisms, including gene repression.
The common neurodegenerative trinucleotide repeat diseases are summarized below:
Translated (polyQ) triplet repeat diseases Untranslated triplet repeat diseases
Disease Triplet repeat sequence
Huntington’s disease(HD) CAG
Dentatorubralpallidoluysianatrophy CAG
Spinocerebellar ataxia(SCA)1,2,3,6,7,17 CAG
Kennedy’disease CAG
Disease Triplet repeat sequence
Spinocerebellar ataxia-8 CTG
Spinocerebellar ataxia 12 CAG
Friedreich ataxia- (FRDA) GAA
Myotonic Dystrophy CTG
Fragile X syndrome CGG
Everett (2004)
67
Friedreich Ataxia:
Friedreich ataxia (FRDA) is an inherited disease that causes progressive damage to the nervous
system, resulting in symptoms like gait disturbance, heart diseases, diabetes and even speech
problems affecting one in 1 in 50,000 people among Caucasian population. It is due to the
degeneration of nerve tissue in the spinal cord; sensory neurons essential for directing muscle
movement of the arms and legs. The spinal cord becomes thinner and nerve cells lose some of
their myelin sheath . This disease was named after the German physician Nikolaus Friedreich,
who described it in the 1860.
Genetics:
This disorder is caused due to expansion of GAA repeats in the first intron of frataxin (FXN)
gene present on chromosome 9q13. The majority of individuals with this disease have
homozygous GAA trinucleotide repeat sequence in the first intron of FXN gene. The others are
heterozygous for the GAA expansion and point mutation. The presence of 60 to 1300 GAA
repeat expansion in the FXN gene results in inhibition of the gene expression which in turn
results in an insufficient amount of mitochondrial protein frataxin. Healthy persons are
characterized by 7–22 GAA repetitions, while patients carry 200–900 GAA repeats in this locus.
Studies have reported that frataxin protein is involved in many important function of cell such as
it act as iron transporter, iron-binding protein, Fe-S cluster assembler, oxphos stimulator, and
mitochondrial antioxidant. These mutations do not result in the production of abnormal frataxin
proteins. Instead, they cause gene silencing and decrease in the quantity of the gene expressed
through induction of heterochromatin structures. – Klockgether (2011), Holloway et.al. (2011)
Diagnosis:
Evaluations of patients with FRDA are made by a physical examinations and tests to assess
sensory and motor functions of nervous system. Some of tests used are CT or CAT scan, an
MRI, and EMG. After finding that expansion of triplet nucleotide (GAA) associated with FRDA
(Friedreichic Ataxia) in 1996, there was a rapid development in molecular diagnosis procedures
for detecting triple nucleotide expansion by a gene test. The FXN gene is responsible for
directing the production of the frataxin protein, which is needed for the body to function
properly. Levels of frataxin in the spinal cord and brain are much lower than normal in
individuals with FRDA. So it is very important to test the FXN gene in blood cells since this
diagnosis test does not estimate protein. All these tests also helped to frame out prenatal
diagnostic procedures for detecting the disease in early onset itself.
68
Lack of precision and accuracy of tandem repeat size among individuals by conventional PCR
amplification procedure lead to improvisation of the method for the detection of triple nucleotide
repeat polymorphism by PCR (TP-PCR) in which more than two primers are used that separates
and amplifies the pathogenic trinucleotide repeats with high specificity which is not possible
using normal flanking primers.
- Marmolino (2011), Holloway. et.al. (2011)
AIMS AND OBJECTIVES OF THE STUDY:
3. Standardization of the improvised Triplet Repeat Primed PCR (TP-PCR) method for the
detection of triple nucleotide expansion in the first intron of FXN gene.
4. The validation of the method by conventional technique (Southern Blotting) as well as
sequencing.
MATERIALS AND METHODS:
1. DNA isolation from blood sample (Phenol Chloroform method)
2. TRIPLET REPEAT PRIMED PCR (TP PCR):
The TP-PCR assay (Ciotti et.al. (2004) ) uses a specific flanking primer along with a pair of
primers which are identical in their 5'sequence region and one of them having 5’ FAM labeling,
7 GAA repeats at the 3’ end. TP PCR gives a highly resolved ladder with fluorescence labeling
which helps in the identification of large pathogenic trinucleotide repeats in the genome which
cannot be amplified using normal flanking primers. -Warner et.al (1996)
69
REFERENCES:
Ciotti. P, Maria E. D et.al. (2004) Triplet Repeat Primed PCR (TP PCR) in Molecular
Diagnostic Testing for Friedreich Ataxia, Journal of Molecular Diagnostics (6) : 4
Everett C. M, Wood. N. W (2004) Trinucleotide repeats and diseases, Brain (127) : 2385–2405
Holloway. T. P, Rowley. S. M et.al. (2011) Detection of interruptions in the GAA trinucleotide
repeat expansion, BioTechniques (50) :182-186
Kingston. H. M (2002) Abc of clinical genetics, Bmj Books:1-2
Klockgether. T (2011) Update on degenerative ataxias, Current Opinion in Neurology 24 (4) :
339–45
Marmolino. D. (2011) Friedreich's ataxia: Past, present and future, Brain 67 (1–2): 311–330
Medline plus (U.S. National Library of Medicine ,National Institutes of Health)
Warner. J. P, Barron L. H et.al. (1996) A general method for the detection of large CAG
repeat expansion by fluorescent PCR, JMed Genet (33) : 1022-1026
70
APPENDIX
71
10.1 Reagents Used:
RBC Lysis Buffer
NH4Cl - 8.26g, EDTA - 0.036g, Tris - 1.1g made upto 1000ml with distilled water, pH - 7.4|
WBC Lysis Buffer
1M Tris - 1ml, 1M NaCl - 40ml, 0.5M EDTA, Made upto 100ml with distilled water.
Proteinase K (10mg/ml):
10 mg of Proteinase K powder is dissolved in 1 ml of distilled water obtain concentration of
10 mg/ml.
20% SDS
Dissolve 20g SDS in 100mL of sterile Milli Q water.
dNTPs solution
4µl each of dATP, dGTP, dCTP and dTTP (100mM stock) were dissolved in 84µl of sterile
Milli Q water to make working solution (4mM of each dNTPs).
10X PCR Buffer
1M KCl - 10ml, 1.5M Tris - 1.33gm, 1M MgCl2 - 300µl, 100X Triton - 200µl. Make up the
volume with sterile Milli Q water and Syringe Filter.
70% Ethanol:
70 ml of absolute alcohol is mixed with 30 ml of distilled water.
Chloroform: Isoamyl Alcohol (24:1):
48 ml of chloroform and 2 ml of isoamyl alcohol is mixed to make 50 ml in desired the ratio.
72
RNase (10mg/ml):
10 mg of RNase powder is dissolved in 1 ml of distilled water to obtain a concentration of 10
mg/ml. It is boiled for 10 minutes so as to remove any residual DNase activity.
.
Recommended