29
10/27/09 Lecture 3: Genes and Proteins 1 bio 1.0 Online bioscience course for grades 6-12 Fall 2009

Lecture 3 Genes And Proteins 10212009

  • Upload
    meminie

  • View
    346

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 1

bio 1.0

Online bioscience course for grades 6-12

Fall 2009

Page 2: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 2

bio 1.0

Class mechanics…

• Attend the online Office Hour on Tuesdays at 3 PM via tokbox-Discuss previous week’s video lecture• Online video lecture e-mailed every Wednesday-view lecture and prepare to discuss the following Tuesday• Comment on video lecture using website discussion board• Online Final Exam given 12/9/2009

Page 3: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 3

bio 1.0

Lecture 3: Genes and proteins

Page 4: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 4

bio 1.0

Take Homes:

I. What is a gene?II. Many genes code for proteinsIII. Genes are regulated IV. The proteins encoded by genes shape the cell and do its workV. How proteins work

Page 5: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 5

bio 1.0

What is a gene?:

• A gene is a discrete unit of heritable information• Genes are typically, but not always, encoded by DNA• Genes typically, but not always code for proteins• A protein gene is an “Open Reading Frame” (ORF) of codons (but only for prokayotes…sorta…)

Page 6: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 6

bio 1.0

Take Home I

Genes are DNA sequences that encode a heritable trait…

What is a gene?

Page 7: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 7

bio 1.0

http://en.wikipedia.org/wiki/Genetic_code

How the genetic code works I:

Page 8: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 8

bio 1.0

How the genetic code works II:

Transcribed strand

mRNA

Peptide (“protein”)

Page 9: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 9

bio 1.0

How the genetic code works III

Page 10: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 10

bio 1.0

Reading frames

Page 11: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 11

bio 1.0

Using a computer program to definea gene from a sequence:

http://www.ncbi.nlm.nih.gov/gorf/gorf.html

Page 12: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 12

bio 1.0

Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein…

http://www.screencast.com/t/gzxXnMwLWNI

Page 13: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 13

bio 1.0

>EXPERIMENTAL DNA SEQUENCE I

ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA

GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT

GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG

GGTGAAGGTGATGCTACATACGGAAAGCTTACC

CTTAAATTTATTTGCACTACTGGAAAACTACCT

GTTCCATGGCCAACACTTGTCACTACTTTCTCT

TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT

CATATGAAACGGCATGACTTTTTCAAGAGTGCC

ATGCCCGAAGGTTATGTACAGGAACGCACTATA

TCTTTCAAAGATGACGGGAACTACAAGACGCGT

GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT

AATCGTATCGAGTTAAAAGGTATTGATTTTAAA

GAAGATGGAAACATTCTCGGACACAAACTCGAG

TACAACTATAACTCACACAATGTATACATCACG

GCAGACAAACAAAAGAATGGAATCAAAGCTAAC

TTCAAAATTCGCCACAACATTGAAGATGGATCC

GTTCAACTAGCAGACCATTATCAACAAAATACT

CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC

AACCATTACCTGTCGACACAATCTGCCCTTTCG

AAAGATCCCAACGAAAAGCGTGACCACATGGTC

CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA

CATGGCATGGATGAGCTCTACAAAT

Test DNA Sequence:

Page 14: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 14

bio 1.0

So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence…

Page 15: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 15

bio 1.0

http://en.wikipedia.org/wiki/Green_fluorescent_protein

Page 16: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 16

bio 1.0

Cells “engineered” to express GFP:

Page 17: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 17

bio 1.0

Take Home II

Many genes encode for the amino acid sequence of proteins…

Many genes code for proteins

Page 18: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 18

bio 1.0

The lac Operon-an example of how bacterial genes are turned “on” and “off”…

http://www.youtube.com/watch?v=oBwtxdI1zvk

Page 19: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 19

bio 1.0

Take Home III

Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences…

Genes are regulated

Page 20: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 20

bio 1.0

Protein Functions in the Body

http://www.youtube.com/watch?v=T500B5yTy58

Page 21: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 21

bio 1.0

Take Home IV

Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins…

The proteins encoded by genes shape the cell and do its work…

Page 22: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 22

bio 1.0

Protein Functions in the Body: An example-ATP Synthase

http://www.youtube.com/watch?v=3y1dO4nNaKY

Page 23: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 23

bio 1.0

Looking at GFP at the molecular level…

Page 24: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 24

bio 1.0

Download and install CN3D:

http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml

Page 25: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 25

bio 1.0

A look at GFP structure with CN3D…

http://www.screencast.com/t/oCq2i3YcX

Page 26: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 26

bio 1.0

Take Home V

Proteins function according to their 3 Dimensional structures…

How proteins work…

Page 27: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 27

bio 1.0

Virtual experiment: making bacteria that glow green by giving them aGFP gene…

http://www.youtube.com/watch?v=Jyfi5e2JoYc&

http://www.youtube.com/watch?v=7zJ-Xe9rZh8

Page 28: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 28

bio 1.0

Next Week:

The bacterial world

How bacteria are structured and how they function…

Page 29: Lecture 3 Genes And Proteins 10212009

10/27/09 Lecture 3: Genes and Proteins 29

bio 1.0

instructorMark E Minie PhD

[email protected]