Upload
nasrulla-abutaleb
View
93
Download
0
Embed Size (px)
DESCRIPTION
Aging and aging effects on kidneys
Citation preview
Outline
Part 1:
• Epedimiology & Significance
• General Aging: Definition & Theories aging
Part 2:
• Application to kidney aging
• Morphological and Functional Changes
Growing general and CKD Population
• Improved survival & lower growth rates the relative
increase in the elderly population.
• Most growing pop. segment:
- US by 2030: 71 million Americans > 65 years or 20% of
the US population.
- EU by 2022:, 21% > 60 & 33% by 2050,
- China by 2040: 374 million or 24.8% of population!
Most growing CKD
segment:
USRDS prevalence
1995–2005 :
3627.5 to 5500.6
pmp (51% increase) in
the age 65–74 years
(73% increase in > 75,
but in <19: only
+16%:70.5 to 82.1)
CKD in the Elderly:Age-standardized rates for CKD 3–5
NEOERICA project
Walsh: Palliative Medicine
Despite
nephrologists:
Not unique to the
kidneys
BUT BUT…
Kidney aging
cause every organ
to age!
How Killer is the Aging Kidneys?
How Morbid is the Aging Kidneys?
USRDS Report 2011
CKD in the Elderly
Stage Description GFR
(ml/min/1.732)
US Prevalence
in Millions
1 Kidney damage and
normal or GFR
90 3.6*
2 Kidney damage and
Mild GFR
60-89 6.5*
3 Moderate GFR 30-59 15.5* (58%)
4 Severe GFR 15-29 0.7*
5 Kidney Failure usually
need dialysis
<15 0.5+
*Extrapolation in adults using NHANES 1999-2004, JAMA 16:180-8, 2007
+US Renal Data System 2008 Annual Data Report
lancet.com Vol 371 June 28, 2008
Concentrate on CKD stage 3.. What conclusions?
CKD patients mostly die with eGFR>50ml/minPREVEND: only 4% of CKD3 are 3b
Taiwan study
J Am Soc Nephrol 18: 1959–1965, 2007
Age- and sex-adjusted survival of CVD
according to the stages of CKD.
PREVEND study
It is MAU (as a marker not a
cause ! of CVD) not eGFR..
Losing GFR down to 30 ml/min
had no effect on occurrence of
CVD
How Killer is the Aging Kidneys?
How Morbid is the Aging Kidneys?
How Morbid is the Aging Kidneys?
• Aged kidneys prone for AKI & other diseases as CVD and
? Mortality
• CKD is a state of general inflammation & low antioxidants
reserve, high AGEs and ROS.. Kidney is a main organ for
oxidants excretions and metabolism
• So, accelerated aging of other organs (e.g. heart, brain,
eyes..) is expected
Aging
• Aging is a cumulative, universal, progressive, intrinsic,
and deleterious process (CUPID)
• The word senescence = "old man”
• Impaired response of body functions when the individual
is challenged
• Not “age-associated diseases,” though accentuated by
such diseases..
• Modulated by racial, hereditary, environmental, dietary
factors and availability of healthcare..
Theories to explain the aging
- Environmental:
- Genetic:
- Mixed theory: both genes and environmental damage contribute to
aging (not mutually exclusive) repetitive, exogenous injury to DNA over
time can modify the expression of genes involved in the aging process.
Cellular senescence organismal senescence
Exogenous or Environmental Theory
Nutritional Factors:Reduction in caloric intake: established benefits
Inverse relationship observed between metabolic rate and the average lifespan of
mammals.
End Products of Advanced Glycosylation:Glucose attached to proteins resulting in AGEs; modifying protein’s chemical
structure & function and by forming bridges with DNA, glycosylation also implicated
in the genomic changes contributing to aging.
Accumulation of Metabolic Waste Products:Accumulation of damaged macromolecules could contribute to cellular aging
(lipofuscin, glycosylated proteins and DNA, accumulation). Glycoside radicals oxidize
and form massive cross-links among proteins, lipids, and nucleic acids.
Genetic Theory: Programmed Aging
Many phenomena in animal lives are genetically programmed
Telomere Shortening
Sequential Inactivation of Reiterative GenesCellular aging is due to the existence of genes with several copies in different
locations on the genome.. cellular aging develop by the inactivation or injury of the
last ( but many proteins codified by a single gene).
Terminal DifferentiationGenes induced by successive cellular divisions, codify proteins that inhibit the
entrance to phase S of the cellular cycle or a reduced proteins capable of stimulating
cellular proliferation (fibronectin in fibroblasts, IL-1 in endothelial cells).
Physiological Basis
of Aging and Geriatrics
Mixed Theory
Oxidant–Antioxidant Balance:
• ROS damage macromolecules within cells. But antioxidants
do not modify the rate of aging.
• ROS production in mitochondria is less in species with
longer life spans: humans 70–100 years vs. 2–3 years in
mice.
• long-term caloric restriction (1 year) in rats decreased
(heart, liver, kidney and skeletal ms.) mitochondrial ROS
production by 50% also decreased the oxidative damage to
mitochondrial DNA, without affecting the oxidative damage
to nuclear DNA. So, lowering the production not adding
external antioxidants is the protection
Mutations
• Cause of many diseases, ageing, cancer:
A hallmark of ageing and cancer is the increase of
genomic instability with age due to increases in
mutations that are expressed at later age. Some
mutations cause apoptosis, aging effect or cancer (cells
cannot age and die)
• Structural or regulatory
The Human Genome
…GGCGGTGTTCCGGGCCATCACCATTGCGGG
CCGGATCAACTGCCCTGTGTACATCACCAAG
GTCATGAGCAAGAGTGCAGCCGACATCATCG
CTCTGGCCAGGAAGAAAGGGCCCCTAGTTTT
TGGAGAGCCCATTGCCGCCAGCCTGGGGACC
GATGGCACCCATTACTGGAGCAAGAACTGGG
CCAAGGCTGCGGCGTTCGTGACTTCCCCTCCSNP (single nucleotide polymorphism)
arranged in 23 pairs of chromosomes
Adenine (A)
Guanine (G)
Thymine (T)
Cytosine (C)
The 2009 Nobel Prize in Physiology or Medicine site
TTAGGG تاجTelomere Shortening
Telomeres and Telomerase
• Telomeres: repetitive DNA sequences at the ends of
all chromosomes (= 92): thousands of TTAGGG تاج
• Protect & separate chromosomes (critical for
structural integrity and accuracy of replication; also
serve as buffer zones for all cells: amoeba to man)
• Without telomeres, the ends of the chromosomes
would be "repaired” as breaks in DNA, leading to
chromosome fusion and massive genomic instability.
• Telomeric sequences shorten each time the DNA
replicates (by 50-200: ? 10K to 5K); when short
cellular senescence (growth arrest) occurs.
Telomerase: The 'Immortalizing' Enzyme
• Human cells are mortal (divide about ?50 X)
cellular clock for the aging & a mech. against cancer..
• Telomerase (reverse transcriptase, hTRT with RNA
template) synthesizes telomere sequences. Cells with
introduced telomerase are continuing to divide (> 250
generations). Telomerase is oncogenic !
• Premature cellular ageing – senescence was induced by
mutations in telomerase. Telomerase appears to be the
mechanism that stops the cellular clock of aging in cancer
cells.
Telomerase: The 'Immortalizing' Enzyme
• The ability of telomerase to maintain telomere length
in cancer cells was identified by Geron scientists in
lung, kidney, ovarian and other cancer cell lines.
• High telomerase activity also seen in germ cells,
stem cells, epidermal skin cells, follicular hair cells.
• The telomerase control gene has been mapped to
3p21 Elizabeth Jordan
The 2009 Nobel Prize in
Physiology or Medicine site
Summary of Telomere theory:
Tel
om
ere
len
gth
in
bp
(hu
ma
n b
loo
d c
ells
)
Telomere length declines in dividing cells as we age
8,000
1,500
3,000
0 35 65
Age in years
Tumor suppressor genes
• Cancer risk rises exponentially with age and accumulating
mutations and oncogenes
• Tumor suppressor genes cause damaged cells to die or
arrest growth (undergo apoptosis or senescence) as a
protective mechanism against cancer
• Two genes’ products known involved in this balance
between aging and cance: p53 & p16: both suppress
cancer at the cost of accelerated aging..
p53—“The Guardian of the Genome”
• Transcription factor: regulates expression of other genes In
humans is encoded by the TP53 gene
• One of the most commonly mutated genes in human
cancers; Regulates the cell cycle; cell proliferation,
apoptosis following damage to DNA, hypoxia, oxidative
stress, excessive mitogenic stimulation, or excessive
telomere shortening.
DNA repair proteins when DNA has sustained damage
• Homozygous p53 TGEM® Rats develop tumors at 3-4
months, and heterozygotes develop tumors at 9 months.
Bourdon et al. (2007) Brit. J. Cancer. 97: 277-282/Charles River site
Anette Melk
• p16INK4a staining in a
case of allograft
nephropathy. (A) Zero
biopsy from a 19-year-old
donor with no p16INK4a
staining. (B) One- year
follow-up biopsy
diagnosed with allograft
nephropathy showing
nuclear and cytoplasmic
staining for p16INK4a in
tubular cells. The amount
of nuclear staining is
compatible with what was
found in normal kidneys
from individuals in their
eighties.
Nephrol Dial Transplant (2003)
18: 2474–2478
Two cellular senescence in renal cells: ‘replicative senescence’ and ‘STASIS’. The
short dysfunctional telomeres will trigger a DNA damage response by activation of
p53. p53 leads to cell-cycle arrest via its main transactivational target p21CIP1/WAF1.
Environmental stresses leads to increase p16INK4a that activate ‘p16/Rb pathway’.
P16INK4a inhibits the activity of the cyclin-dependent kinases (CDKs) 4 and 6,
thereby leading to hypophosphorylation (hypo-P) of retinoblastoma (Rb) and
irreversible cell-cycle arrest (STASIS).
Nephrol Dial Transplant (2003) 18: 2474–2478
Hilary Cronin and Rose Anne Kenny
Part 2: The Aging Kidneys
Morphological and Functional Changes
Gross granularity
and pitting of the
external surface
Loss of Mass &
Loss of Function
But with preserved
homeostasis
Microscopic Changes:‘arterionephrosclerosis of aging’
A diagnosis of exclusion; biopsy (>55 years):
glomerulosclerosis (10% in <40 ! Or = (age/2)-10
IF/TA
• Vascular sclerosis: fibrointimal & medial sclerosis of cortical
arteries & arteriolosclerosis of interlobular/arcuate arteries.
• Cortical nephrons: ischemic changes (tuft lobulation,
mesangium, capillary collapse & obliteration. Hyaline
deposits in residual glomeruli).
• Peritubular capillary density decreased ( low proangiogenic
vascular endothelial growth factors)
• GBM & TBM thickening with reduction of vascular channels
& shunting of blood from afferent to efferent arterioles of the
juxtamedullary glomeruli with adequate blood flow to the
renal medulla.
Sharon Anderson
KI (2008) 74, 710–720
Global glomerulosclerosis
Moderate IF/TA
Arteriolar reveal hyalinosis
Brenner and Rector's The Kidney, 9th ed.
Arteriohyalinosis.
Fibrous intimal thickening
Tubular atrophy.
Lipofuscin pigment
Two markers: senescence-associated -galactosidase (SA– GAL) and accumulation of
lipofuscin granules.
Glomerulosclerosis
Brenner and Rector's The Kidney, 9th ed.
Interstitial fibrosis
combination of glomerulosclerosis,
TA & vascular changes
Artery of interlobular size showing
intimal thickening
J Pathol 2007; 211: 198–205
A normal glomerulus
Af. Arteriole.
Massive nonobstructive
hyaline deposit
Hypertrophic glomerulus with
massive dilatation of hilar capillary
Focal segmental
glomerulosclerosis
An ischemic glomerulus shows collapsing
capillary loops & small capillary lumens.
A hypertrophic glomerulus compensating for obsolete
glomeruli
J Pathol 2007; 211: 198–205
PATHOGENESIS OF RENAL
AGING”
Schema is complicated by
factors such as gender, eNOS
and inhibition, dietary factors &
the effect of aging-associated
genes such as klotho.
KI (2008) 74, 710–720
PATHOGENESIS OF RENAL AGING”The ‘arterionephrosclerosis of aging’
eNOS expression ?triggering inflammation ( & so focal
glomerulosclerosis and TA)
levels of the cell cycle inhibitor p16INK4a with age,
glomerulosclerosis, and IFTA
• Also, critical telomere shortening.
Factors that mediate fibrosis as AT II, TGF-β, AGEs,
oxidative stress, inflammation, and lipids, NO, Klotho,
vitamin D, the vitamin D receptor are evident in kidneys of
aging animals
PATHOGENESIS OF RENAL AGING”
Angiotensin II
• ATII glom. & tub. growth, NO synthesis, growth
factor induction, oxidative stress, inflammation,
apoptosis, and matrix proteins ( collagen-1 gene &
matrix metalloproteinase-1 gene).
• ATII downregulate Klotho gene expression (reversed
by losartan)!
• Hemodynamic effects of ATII maintain FP (eff. art.
Vasoconstriction).
• The arterial changes hypoxia/ischemia
upregulation of hypoxia-induced genes such as HIF,
VEGF, glucose transporter-1, and EPO (rat kidney
studies).
PATHOGENESIS OF RENAL AGING
Angiotensin II
• ATII stimulate profibrotic cytokines, TGF-β & collagen
IV & mediate NO inhibition & transcription of the
proinflammatory MCP-1 & PAI-1 levels ( proteolysis
and fibrinolysi)
• ACEI-treated (or ARBs) aged mice have in
glomerular area, mesangial area, and
glomerulosclerosis compared with untreated mice;
mediated by prevention of age-related in oxidative
stress & AGEs, in eNOS and Klotho.
AGEs & RAGE in the aging process
- AGEs are modifications of proteins, lipids, peptides, amino
acids and nucleic acids by carbohydrates ⁄ reducing sugars
structure & functional: enzymatic function, ligand binding..
- AGEs are formed during ageing as a physiological process,
but are enhanced in chronic diseases such as DM, CKD,
atherosclerosis, Alzheimer’s dis.
- AGEs and RAGE promote nuclear factor-k B activation and
expression of inflammatory genes in the aging kidney.
- Evidence for a direct role of AGE in causing kidney damage
is supported by many animal studies.
Glycation and crosslinking
implicated in progressive
diseases of aging:
vascular diseases (such as
atherosclerosis, systolic
hypertension, pulmonary
hypertension, and poor
capillary circulation), erectile
dysfunction, kidney disease,
stiffness of joints and skin,
arthritis, cataracts,
retinopathy, neuropathy,
Alzheimer's Dementia,
impaired wound healing,
urinary incontinence,
complications of diabetes,
and cardiomyopathies (such
as diastolic dysfunction, left
ventricular hypertrophy, and
congestive heart failure)
Red
uci
ng A
gen
ts
DT
T, B
ME
Lymphocytes in
culture, add
reducing agents
to medium:
(break disulfide
bonds)
senescent
cells divide
again
AGEs & RAGE in the aging process
• AGE intracellular generation of ROS (reciprocal process)
ROS activate signaling pathways as protein kinase C
leading to proinflammatory and profibrotic effects
• The kidney plays an important role in the clearance and
metabolism of AGEs and serum AGE concentrations
increase in chronic renal insufficiency, partly by an increase
in oxidative and carbonyl stress.
• AGE deposition in the kidney is associated with increased
MM, increased BM thickening, increased vascular
permeability, and induction of PDGF and TGF-β, resulting
in glomerulosclerosis and tubulointerstitial fibrosis.
Cascade of events in
cellular injury produced
by AGE
Clin J Am Soc Nephrol 1: 1293–1299, 2006
Effect of a low-glycotoxin diet on glomeruli and renal function in mice: (A)
with diet containing normal high levels of AGEs (RegAGE), and (B) after low-
AGE diet (LowAGE) (n = 6 per group). C, Fractional mesangial volume. D,
TGF-β levels. E, Collagen type IV) messenger RNA (mRNA) levels. F, uACR Am J Pathol 170[6]:1893-1902, 2007. Brenner and Rector's The Kidney, 9th ed.
• Renal biopsy from a patient with diabetic nephropathy stained for
imidazolone. There is a strong deposition of AGEs in the tubules as
well as in the glomerular mesangial area and in endothelial cells
• European Journal of Clinical Investigation Vol 40
Studies on AGE Content in Foods
J Am Diet Assoc. 2010;110:911-916
Oxidative stress:
• Predominant cellular free radicals (normal products of
metabolism) are: superoxide (O2-), hydroxyl (OH-), nitrogen
dioxide (NO2), hydrogen peroxide (H2O2)
• Damage to mitochondria DNA, protein processing and
cellular metabolism leading to: Loss of cellular phenotype,
necrosis, apoptosis
• vitamin E–enriched diet fed to aged rats, markers of
oxidative stress, RPF and GFR, & glomerulosclerosis.
• Studies indicate that ACEI can increase antioxidant enzyme
activity and block TGF-β ?induction by ROS.
Calorie Restriction
• CR (25% to 45% reduction) assoc. with extended life of
animals & age-related proteinuria & glomerulosclerosis
in rats
• CR in rhesus monkeys age-related diseases: insulin res.,
atherosclerosis, DM, cancer, CVD, and brain atrophy, and
immune dysfunction
• CR studies in humans: similar beneficial effects on health
(longevity unknown)
CR reduces aging-related proteinuria in male rats; severe food
restriction (12.5 Kcal/day) initiated at a young age abolishes the steep
rise in protein excretion with aging.
Physiological Basis of Aging and Geriatrics
Calorie Restriction: Potential mechanisms
(1) body fat content,
(2) metabolic rate,
(3) oxidative stress: What about CR+high AGEs?
(4) inflammation,
(5) modulation of mitochondrial function,
(6) activity of sirtuins in most tissues, including the
kidney,
(7) AMP–activated protein kinase (AMPK) signaling,
and
(8) mTOR and S6K1 (ribosomal protein S6 kinase1)
signaling.
Sirtuin mediates histone deacetylase activity. This
deacetylation controls the activity of various proteins
and genes that regulate cell survival, differentiation,
metabolism, DNA repair, inflammation, and longevity.
Several studies have shown that SIRT1 activity is
increased in most tissues, including the kidney, in
response to CR.
Sirtuins
• SIRT1 knockout mice are resistant to the effects of a
calorie-restricted diet. Mice treated with resveratrol, the
synthetic activator of SIRT1, also display the transcriptional
aspects of CR, including protection against age-related
renal disease
• SIRT1 activity controls the activity of various proteins and
genes that regulate cell survival, differentiation, metabolism,
DNA repair, inflammation, and longevity.
• Recent studies indicate a complex regulation of metabolic
pathways in response to CR that integrates the effects of
CR on insulin release, AMPK, SIRT1, and FOXO
activation as well as inhibition of mTOR175-177.
Interestingly these metabolic effects are similar to the
effects of exercise and fasting, which also regulate
AMPK, SIRT1, PPAR γ ?coactivator 1α ?(PGC-1α), and
FOXO activity
The Klotho gene • Expressed in distal tubules; present in the circulation and
urine; supressed by ROS
• Associated c suppression of premature aging and
arteriosclerosis, p. tubular phosphate re-absorption
• Suppresses phosphate reabsorption by directly binding to FGF receptors, Inhibits 1-alpha 25 hydroxylase & so
decreases calcitriol levels
• Both FGF23 and klotho ablated mice develop extensive vascular and soft tissue calcification
7-week-old normal mouse (left) and a klotho mouse, an animal model that shows multiple phenotypes resembling human aging
• FGF23+Klotho act with PTH to reduce iP re-absorption. But,
FGF23+Klotho inhibit calcitriol synthesis (PTH stimulates). FGF23
is inactive in absence of klotho.
• In ESRD, inhibition of tubular iP re-absorption by both PTH and
FGF23+ Klotho becomes ineffective. PTH secretion leads to
excessive iP release from bone with hyperphosphataemia. Nephrol Dial Transplant (2007) 22: 1524–1526
Factors that mediate and moderate age-related
glomerulosclerosis and tubulointerstitial fibrosis.
Brenner and Rector's The Kidney, 9th ed.
J Am Soc Nephrol 21: 1436–1439, 2010
• `Aging induces cell
senescence. Stresses,
as oxidative stress &
mitochondrial injury
induce SIPS through the
p16/retinoblastoma
pathway or ARF/p53
pathway. Senescent
cells have arrested
growth secrete altered
levels of growth factors
and therefore have
increased sensitivity to
injury and decreased
repair after injury.
Clin Geriatr Med 25 (2009) 331–358
• Age‐associated
decrease in GFR
is due to
reduction in RPF
and in Kf (UF
coef)
Age and ERPF
(ml/min) & GFR of
males and females:
Absolute ERPF fall
of 87/ decade in
males vs.11 ml/min
per decade, (P 1⁄4
0.0039).
The fall in GFR of
8.7/decade in
males vs.1.4 in
females (P 1⁄4
0.0074).
The fall in relative
ERPF of 90 per
decade 13 in
Females per
decade, P 1⁄4
0.0008)Nephrol Dial Transplant (2006) 21: 2577–2582
the relationship between age and the FF (%) of
males and females.Nephrol Dial Transplant (2006) 21: 2577–2582
Influence of age at
donation on change
in natriuretic
response to acute
saline load in kidney
donors after
uninephrectomy.
Red circles indicates
normotensive; blue
circles indicates de
novo hypertensive.
Age and H conc. & Bicarb:
lower net acid excretion in
elderly, Plasma bicarbonate
and blood pH change as GFR
changes with age. Plasma
chloride reciprocally increases,
as seen in renal tubular
acidosis or early renal disease.
Decreased ammonium
excretion is noted with aging.
Brenner and Rector's The Kidney,
9th ed.
Sharon Anderson
Sharon Anderson
Urinary Concentration
• Investigations suggest that both volume and osmotic
stimulation of AVP remain intact with age, with
osmoreceptor sensitivity for AVP actually enhanced in the
elderly. Impaired intrarenal AVP response suggested. aged
rats have Na- K-2CL cotransporter and decreased cortical
abundance of epithelial sodium channel. Although restricted
water intake increased the abundance of both NCCK2 and
Na-Cl cotransporter in aging rats, the response remains
significantly blunted. Taken together, these findings imply
that aging can impact both ascending limb solute transport
and collecting tubule water transport.
AKI• Incidence 6.8% to 36%.
• Pre-renal, Renal, and Postrenal
• The leading cause was volume depletion, followed by
nephrotoxic drugs, obstructive uropathy, shock (sepsis
and cardiac), and a combination of several factors. In the
elderly, the combination of several causes is very
common, making up about 20–25% of the AKI in this
population in some studies
The recovery is less frequent and slower
The Most Common Renal Pathology in an Acute
Geriatric Unit
AKI• Incidence 6.8% to 36%,
mortality rate to 50–60% as in other age groups..
• Pre-renal, Renal & Postrenal
• Combination of several causes
is very common (20–25%)
• The recovery is less frequent
and slower
The Most Common Renal Pathology in an Acute
Geriatric Unit
Urinary Tract Infection
• Most common cause of bacterial sepsis in older adults.
60% recurrence after an initial UTI.
• Factors: low pH, micturition dysfunction, obstruction, cell-
medicated immunity, UT abnormalities, and hormonally
dependent changes in vaginal pH, immune system
changes, immobility, comorbidities (DM, cancer, chronic
renal failure)..
• Atypical symptoms such as altered mental status, newly
developed incontinence, urinary retention, or functional
deterioration may be the way of presentation.
• UTIs more easily result in bacteremia, decreased functional
status, and death. (? systemic antimicrobial Rx)
Obstructive Uropathy
• Prostate disease is by far the main cause of low
obstructive uropath in men. Other diseases: Lithiasis,
bladder tumors, neurogenic bladder, and abdominal and
pelvic tumors.
• initially reversible but can lead to irreversible renal failure.
Obviously, therapy will depend on etiology.
• Nephostomy and/or the placement of a vesico-ureteral or
suprapubic catheter an indispensable initial therapy, prior
to finding a permanent solution when possible.
http://lenol66.files.wordpress.com
one trait that :
Optimism
• One trait:
• Surrender happily
to the Creator’s
will
• Thank You
• For You All
• The genome: 3 billion nucleotide
bases (A, C, T, and G). . over
150,000 book pages (The writer?!)..
Disease is often caused by one
letter in 150,000 pages different!
• Around 30,000- genes encoding
more than 100,000 proteins (alternative splicing)
• Almost all (99.9%) bases are
exactly the same in all people.
• Unknown functions for > 50% of
discovered genes.
• 0.1% (100-99.9) difference makes
humans differences. Human
genome is contain 10 million SNPs
Introduction: The Human Genome
Guttmacher A and Collins F. N Engl J Med 2002;347:1512-1520
Alternative Splicing
Types of Mutations that lead to Cancer
• Mutations to proto-oncogenes --> leading to oncogenes, or insertions of oncogenes (genes involved in cell growth and development; growth factors, growth factor receptors etc)
• Mutations to tumor suppressor genes (e.g. Trp53; Genes whose products block abnormal growth)
• Mutations to DNA repair genes (mismatch repair etc)
• Telomere shortening leading to chromosome instability and gene deletions
Genetic Theory: Programmed Aging
Many phenomena in animal lives are genetically programmed. the CLK-1
gene, which contributes to the synthesis of co-enzyme Q (ubiquinone) in the
mitochondrial respiratory chain. Overexpression of CLK-1 increases the rate
of oxidative phosphorylation and reduces life expectancy.
Sequential Inactivation of Reiterative Genes
cellular aging is due to the existence of genes with several copies in different
locations on the genome.. cellular aging develop by the inactivation or injury
of the last ( but many proteins codified by a single gene).
Telomere Shortening
Terminal Differentiationgenes induced by successive cellular divisions, codify proteins that inhibit the
entrance to phase S of the cellular cycle or a reduced proteins capable of stimulating
cellular proliferation (fibronectin in fibroblasts, IL-1 in endothelial cells).
Mixed Theory
Oxidant–Antioxidant Balance:
• ROS damage macromolecules within cells. But antioxidants
do not modify the rate of aging.
• ROS production is mainly in mitochondria (90% of O2
consumption and least DNA repair mechanisms) has
inverse relation among species longevity
• Long-term caloric restriction (1 year) in rats
decreased(heart, liver, kidney and skeletal ms.)
mitochondrial ROS production by 50% also decreased the
oxidative damage to mitochondrial DNA, without affecting
the oxidative damage to nuclear DNA. So, lowering the
production not adding external antioxidants is the protection
• Oxygen free radicals generated as a function of metabolic
rate cause cumulative oxidative damage, resulting in
structural degeneration, functional decline, and age-related
p16
• Cyclin-dependent kinase inhibitor 2A, (CDKN2A,
p16Ink4A) also known as multiple tumor suppressor 1
(MTS-1), is a tumor suppressor protein, that in humans is
encoded by the CDKN2A gene.[1][2][3] P16 plays an
important role in regulating the cell cycle, and mutations in
p16 increase the risk of developing a variety of cancers,
notably melanoma.
PATHOGENESIS OF RENAL
AGING”
It is not clearly understood (?role
of cumulative toxins & Diseases
effects).
Replicative senescence and
oxidative stress are the major
identified factors.
These factors & renal diseases
ultimately lead to renal arterial
sclerosis hypoxic/ischemic ilieu
aging-related glom. sclerosis,
IF/TA RAAS hypertension
renal ischemia cycles. Schema is
complicated by factors such as
gender, eNOS and inhibition,
dietary factors & the effect of
aging-associated genes such as
klotho.
KI (2008) 74, 710–720
For review only
The ‘arterionephrosclerosis of aging’
• Altered endothelial nitric oxide synthase (eNOS)
expression may be the trigger for the inflammation (
& so focal glomerulosclerosis and TA)
• increased levels of the cell cycle inhibitor p16INK4a
with age, glomerulosclerosis, and IFTA
• Also, critical telomere shortening.
• Alterations in the activity of factors that mediate
renal fibrosis, such as AT II, TGF-β, NO, AGEs,
oxidative stress, inflammation, and lipids, as well
factors that prevent fibrosis, such as Klotho, vitamin
D, the vitamin D receptor, and the farnesoid X
receptor (FXR), are also evident in kidneys of aging
animals
Examples of biological
relevant AGE structures
Eur J Clin Invest 2010; 40 (8): 742–755.
The Nobel Prize in Physiology or
Medicine 2009 jointly to
Elizabeth H. Blackburn, Carol W. Greider and Jack
W. Szostak
for the discovery of
"how chromosomes are protected by telomeres and
the enzyme telomerase”
Clin J Am Soc Nephrol 5: 936–942, 2010
Cell senescence in rat kidneys in vivo increases with growth and
age despite lack of telomere shortening.
• Expression of mRNA for
p16INK4a, a characteristic
senescence gene in vitro, was
undetectable in most young rats
but rose 27 fold during growth
and a further 72-fold during
aging.
• Kidney International, Vol. 63 (2003), pp.
2134–2143