Spp

FHa

b

c

a

ARRAA

KAAXmEI

1

orpIa(bo2wpc

FT

h0

Neuroscience Research 97 (2015) 7–12

Contents lists available at ScienceDirect

Neuroscience Research

jo ur nal homepage: www.elsev ier .com/ locate /neures

plicing defects in ABCD1 gene leading to both exon skipping andartial intron retention in X-linked adrenoleukodystrophy Tunisianatient

akhri Kallabia,∗, Ikhlass Hadj Salema, Amel Ben Chehidab, Ghada Ben Salaha,adhami Ben Turkiab, Neji Tebibb, Leila Keskesa, Hassen Kamouna,c

Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax, TunisiaService de Pédiatrie, Hôpital La Rabta de Tunis, TunisiaService de Génétique Médicale, Hôpital Hédi Chaker Sfax, Tunisia

r t i c l e i n f o

rticle history:eceived 10 December 2014eceived in revised form 12 March 2015ccepted 16 March 2015vailable online 31 March 2015

eywords:BCD1 gene

a b s t r a c t

X-linked adrenoleukodystrophy (X-ALD) affects the nervous system white matter and adrenal cor-tex secondary to mutations in the ABCD1 gene that encodes a peroxisomal membrane protein: theadrenoleukodystrophy protein. The disease is characterized by high concentrations of very long-chainfatty acids in plasma, adrenal, testicular and nervous tissues. Various types of mutations have been identi-fied in the ABCD1 gene: point mutations, insertions, and deletions. To date, more than 40 point mutationshave been reported at the splice junctions of the ABCD1 gene; only few functional studies have been per-formed to explore these types of mutations. In this study, we have identified de novo splice site mutation

drenal insufficiency-ALDRNA splicing

xon skippingntron retention

c.1780 + 2T>G in ABCD1 gene in an X-ALD Tunisian patient. Sequencing analysis of cDNA showed a minortranscript lacking exon 7 and a major transcript with a partial intron 7 retention due to activation of anew intronic cryptic splice site. Both outcomes lead to frameshifts with premature stop codon generationin exon 8 and intron 7 respectively. To the best of our knowledge, the current study demonstrates that asingle splicing mutation affects the ABCD1 transcripts and the ALDP protein function.

© 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

. Introduction

X-linked adrenoleukodystrophy (X-ALD; OMIM # 300100) isne of the most frequent monogenic inherited peroxisomal neu-odegenerative disorders. It affects the cerebral white matter,eripheral nerves, adrenal cortex and testis (Moser et al., 2002).

t is a serious and progressive genetic disorder characterized bybnormal accumulation of saturated very long chain fatty acidsVLCFA) in body fluids and affected tissues, most notably in therain and adrenal cortex due to an impaired �-oxidation in per-xisomes (Moser et al., 2002; Bezman et al., 2001; Ferrer et al.,010; Valianpour et al., 2003). Affected individuals may present

ith seven different clinical forms that are classified according tohenotypic expression and age at initial symptoms. Most frequentlinical phenotypes, accounting for 70–80% of the patients, include

∗ Corresponding author at: Laboratoire de Génétique Moléculaire Humaine,aculté de Médecine de Sfax, Avenue Magida Boulila, 3029 Sfax, Tunisia.el.: +216 74 24 18 88x159; fax: +216 74 46 14 03.

E-mail address: fakhrikallabi@yahoo.fr (F. Kallabi).

ttp://dx.doi.org/10.1016/j.neures.2015.03.005168-0102/© 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights res

severe progressive, inflammatory, demyelinating childhood cere-bral form (ccALD) and slowly progressive, noninflammatory, adultadrenomyeloneuropathy (AMN) affecting mainly peripheral nervesand spinal cord (Van Geel et al., 1997; Jardim et al., 2010; Kempet al., 2001). Other less frequently occurring phenotypes includeadolescent cerebral (AdolCALD), adult cerebral (acALD), olivopon-tocerebellar, addison-only and asymptomatic patients (Kemp et al.,2001). The biochemical diagnosis of X-ALD patients and carriers isbased on the elevated levels of C24:0 and C26:0 in plasma. However,in 0.1% of affected males, the plasma C26:0 level is at borderline ofthe healthy subjects and 15% of female heterozygotes have nor-mal levels of VLCFA (Valianpour et al., 2003; Moser et al., 1999;Igarashi et al., 1976). The diagnosis of X-ALD is based on the clini-cal manifestation, the cerebral magnetic resonance imaging (MRI),the elevated levels of: C24:0 and C26:0 and the ratios: C24:0/C22:0and C26:0/C22:0 but the molecular analysis is the only effectiveand reliable method to unambiguous determination of the genetic

status of X-ALD patients (Moser et al., 2007).

X-ALD occurs due to alterations in the ATP-binding cassette,subfamily D, member 1 (ABCD1) gene localized at Xq28 encodingthe adrenoleukodystrophy protein (ALDP) (Boehm et al., 1999). If

erved.

8 ience R

totti

bihaiosfe

Aiem

2

ihcaTcawGs1

2

tapwfiedc93afwFtswCh

2

ctu

F. Kallabi et al. / Neurosc

he ALDP protein function is impaired, there is no peroxisomal �-xidation of VLCFAs, hence their accumulation in body fluids andissues leading either to neuroinflammation and demyelination inhe brain characterizing the ccALD form or to axonal degenerationn spinal cord in AMN form (Migeon et al., 1981; Mosser et al., 1993).

Currently, all over the world, 1585 distinct mutations have so fareen reported in ABCD1 gene as the cause of a wide spectrum of clin-

cal severity (http://www.x-ald.nl/). Many ABCD1 intronic variantsave been identified during diagnostic screening: they account forbout 3% of all variants listed at X-ALD database. For the majority ofntronic variations, the consequences on mRNA splicing have beennly inferred by in-silico analysis, whereas experimental demon-tration of their pathogenicity has been obtained by mRNA studiesor only few of them (Chiu et al., 2006; Shi et al., 2003; Guimarãest al., 2001, 2002).

In this study, we performed a molecular genetic analysis of theBCD1 gene in X-ALD Tunisian patient. The availability of RNA splic-

ng analysis from blood samples was exploited to demonstrate theffect of the c.1780 + 2T>G splicing mutation in ABCD1 gene onRNA splicing.

. Materials and methods

The patient is a 16-year old boy belonging to a Tunisian fam-ly. He was born from unrelated healthy parents. One additionalealthy sibling and the parents were also recruited. Informedonsent was obtained from patients and control individuals inccordance with the ethics committee of La Rabta Hospital (Tunis,unisia). The diagnosis of X-ALD was made on the basis of clini-al manifestation; cerebral magnetic resonance imaging (MRI) andccumulation of very long chain fatty acid (VLCFA). Blood samplesere collected from four family members and healthy individuals.enomic DNA was extracted from the whole blood following atandard phenol-chloroform method (Lewin and Stewart-Haynes,992).

.1. Mutation analysis of ABCD1 gene

The 10 exons and flanking intron region of the ABCD1 gene wereested for mutation in the X-ALD patient by sequence analysis. PCRmplification of all 10 ABCD1 fragments was performed using therimer sets as previously published (Boehm et al., 1999). All exonsere amplified in a thermal cycler (Applied Biosystem 2720) in anal volume of 50 �l containing 100 ng of genomic DNA, 0.2 �M ofach primer, 1x PCR buffer (Promega), 1.2 mM MgCl2, 0.2 mM eachNTP, and 1 U Taq DNA polymerase (Promega). The polymerasehain reaction conditions were as follows: initial denaturation at5 ◦C for 5 min followed by 35 cycles of denaturation at 95 ◦C for0 s, annealing at 63–71 ◦C (depending on the melting temper-tures of the primer pairs used) for 30 s and extension at 72 ◦Cor 45 s, and final extension at 72 ◦C for 10 min. Each PCR productas then purified by enzyme reaction (Exonuclease I; 20 units/�l;

ermentas), and directly sequenced using a Big-Dye di-deoxy-erminator cycle sequencing kit and an ABI-PRISM 3100 automatedequencer (Applied Biosystems). The BLAST homology searchesere performed using the programs available at the NCBI (Nationalenter for Biotechnology Information) website and compared theuman ABCD1 gene sequence with the wild-type sequence.

.2. Bioinformatics prediction of splice consensus score

To evaluate the strength of the altered splice-site of.1780 + 2T>G mutation, splice site scores were predicted byhe Human Splicing Finder software (HSF V2.4 at http://www.md.be/HSF) (Desmet et al., 2009).

esearch 97 (2015) 7–12

2.3. RNA extraction and reverse transcriptase-polymerase chainreaction (RT-PCR) analysis

The functional effect of the c. 1780 + 2T>G mutation wasassessed by RT-PCR analysis of nuclear lymphocytes RNAsobtained from affected and control individuals. Total RNA wasisolated from 10 ml of blood samples using PureLinkTM Micro-to-Midi Total RNA Purification System (Invitrogen, Karlsruhe,Germany). Nucleic acids were quantified using the Nano DropND-1000 UV–Vis spectrophotometer. RT-PCR, covering the cod-ing sequence of exons 6–10, was performed for the patient carrierof splicing mutation c.1780 + 2T>G, using the following primers:5′ACGTACGGTGGTGTGCTCTA3′ (forward primer 69 pb down-stream of exon 6) and 5′ CATCGAACTGTAGCAAGTGT3′ (reverseprimer 12 pb upstream of exon 10), according to the manufac-turer’s recommendations of SuperScript Tm One-Step RT-PCR withplatinum® Taq kit (Invitrogen). The expected RT-PCR products of448 bp were separated and visualized under UV light by elec-trophoresis on 2% agarose gel stained with ethidium bromide.Direct sequencing of RT-PCR products was performed by standardconditions in both directions.

2.4. Estimation of expression levels of transcripts

To estimate the transcript expression levels of ABCD1 gene, sep-arate bands on the agarose gel were quantified using the Quantity1D analysis software. Band intensity is expressed in arbitrary units(intensity × area) calculated by the software.

3. Results

In this current study, we identified a Tunisian family with oneX-ALD affected male. The healthy parents were unrelated and orig-inated from South Tunisia. Clinical and biological data indicatedthat the initial presentation was adrenal insufficiency followed byneurological manifestations.

3.1. Clinical analysis of X-ALD patient

The 16-year old male patient was asymptomatic up to theage of 5 after which he presented clinical data suggesting melan-odermia and generalized hypotonia. He presented difficultiesin understanding spoken language, and hearing deficit. PlasmaVLCFAs levels of the patient showed C26:0 to be 3.78 �mol/L(normal level <1.31 �mol/L), C24:0 to be 46.44 �mol/L (nor-mal level: 11–39 �mol/L) and C22:0 to be 36 �mol/L (normallevel = 22–43 �mol/L).

The C26:0/C22:0 ratio was 0.105 (normal ratio = 0.002–0.018)and C24:0/C22:0 was 1.29 (normal ratio = 0.5–0.98). Hormonaldosages showed high plasmatic ACTH levels (1890 ng/L at 11 yearsold; normal level <48 ng/L), therefore glucocorticoid replacementtherapy was initiated for adrenal insufficiency. His neurologicalabilities have worsened with progressive impairment of cognitionand behavior. A brain magnetic resonance imaging (MRI) examrevealed a signal abnormality in the bilateral cerebral white matter,predominantly in the parieto-occipital region: low signal intensityin T1 (Fig. 1a) and high signal intensity in T2 (Fig. 1b). The patientwas categorized into ccALD phenotype.

3.2. De novo c.1780 + 2T>G mutation in the ABCD1 gene

The sequencing analysis of coding regions and intron–exon

boundaries of ABCD1 gene of the patient revealed de novo splic-ing site mutation T>G at the second nucleotide of intron 7(c.1780 + 2T>G) already described (Fig. 2). Using direct sequencing,the mutation was absent in the mother and the brother.

F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12 9

F atterb h temc

3

a(lwtucasst(ow

Fa

ig. 1. (A) T1-weighted MRI with contrast shows low signal intensity on the white milateral symmetrical, ill-defined high signal intensity on the white matter of botallosum, and brain stem.

.3. “in silico” HSF prediction

According to the splice site consensus sequence in mammals, Thymine nucleotide is located at position +2 of the donor siteMount, 1982). Indeed, in the wild-type ABCD1 allele Thymine isocated at position +2 of intron 7; however, in our patient, Thymine

as changed by Guanine (Fig. 2). To predict the effect of this muta-ion on splicing, we performed “in silico” analysis of the sequencesing the human splicing finder (HSF) software. Each splice site isharacterized by the consensus value and the consensus value vari-tion: � CV. By introducing the 3′ sequence of exon 7 and the 5′

equence of intron 7, HSF determines the predicted splice donorites with consensus value (0–100). Based on the HSF predictions,he altered sequence (GAG/ggagga) abolished the initial donor site

GAG/gtagga) eliciting an abnormal splicing process by activationf a new cryptic splice donor site (intron inclusion) or/and brokingild type site (exon skipping) (Tables 1 and 2).

ig. 2. Sequences in the region of the c.1780 + 2T>G splice mutation showing a control sun arrow.

lesion with contrast enhancement along the margins. (B) T2-weighted MRI showsporo-parietooccipital lobes, including the internal and external capsules, corpus

Analysis by “in silico” HSF software showed the presence of sev-eral potential 5′ consensus splicing sites within intron 7. In orderto determine the effect of the splicing site mutation, and the pos-sible activation of intronic cryptic sites, RT-PCR and sequencinganalysis of cDNA were performed using ABCD1 mRNA obtainedfrom lymphocytes. Using primers within exons 6 and 10, RT-PCRrevealed an amplified fragment of 448 bp in the control, whichcorresponds to the expected splicing product. In contrast, RT-PCRelectrophoretic profile of the patient showed two different bands:a minor aberrant transcript lacking exon 7 and a major aber-rant transcript included 103 bp of intron 7 (Fig. 3). The 3′ of thisretained sequence of intron 7 contains a splice donor site motif(CAG/GTGCCA) located 101 bp downstream of the native splice sitewithin intron 7, which becomes an activated cryptic splice site.

Our results confirm that the c.1780 + 2T>G mutation abolishes theconserved GU splice donor site at 5′ of intron 7, leading to the pro-duction of two splicing mutant transcripts. The aberrant splicing

bject, patient’s mother and the X-ALD patient. Nucleotide variation is indicated by

10 F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12

Table 1Potential donor splice site calculation in 3′ exon 7 and 5′ intron 7 (http://www.umd.be/HSF/4DACTION/input SSF).

Table 2HSF prediction of the c.1780 + 2T>G mutation on the splicing (http://www.umd.be/HSF/4DACTION/input SSF).

Fig. 3. (A) Sequence chromatograms of amplified cDNA products in the normal subject and X-ALD patient: exon 7 skipping and retention of 103 nucleotides of intron 7. (B)Gel electrophoresis of the RT-PCR amplification product of the region spanning exons 6–10 of the ABCD1 gene showing a single band in the control (lane 5) as well as in theunaffected parents (lanes 1 and 2) and brother (lane 4) at the expected size of 448 bp, two bands (551 bp) and (302 bp) in the X-ALD patient (lane 3). A negative control isshown (lane C). MW: a 100 bp DNA ladder.

F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12 11

F A) Nom lice si

gmti

3q

cfiosdps

4

tcgstGAemswt

on the pre-mRNA process and to identify all types of transcriptsproduced. Indeed, RNA analysis was performed by RT-PCR of anamplicon spanning exons 6–10 of ABCD1 gene. As shown by our

ig. 4. Ideogram of detected splicing consequences of the c.1780 + 2T>G mutation. (utation. (b.1) exon 7 skipping (b.2) intron 7 inclusion with activation of cryptic sp

enerates a translation frameshift and creation of a premature ter-ination codon (PTC): TGA at position +17 within exon 8 in the

ranscript with exon 7 skipping and TAA at the position +93 withinntron 7 in the transcript with partial intron retention (Fig. 4).

.4. Estimating of expression levels of ABCD1 transcripts byuantity 1D analysis software

To estimate the transcript expression levels of ABCD1 gene, theDNA amplified by RT-PCR was analyzed on agarose gel and quanti-ed using the Quantity 1D analysis software. The sum of the scoresf the two aberrant transcripts is almost equal to the normal tran-cript score. The expression level of the aberrant transcripts wasistributed as follows: ≈60% for the major aberrant transcript withartial intron 7 retention and ≈40% for the minor aberrant tran-cript with exon 7 skipping (Fig. 5).

. Discussion

In the present work, we report one X-linked adrenoleukodys-rophy patient associated with de novo splicing mutation.1780 + 2T>G at the 5′ splice-site in intron 7 of the ABCD1ene. It affects the invariable intronic GU motif of the splice donorite of exon 7. To the best of our knowledge, this donor splice varia-ion was identified in one previous report as a milder mutation in aerman boy. The patient was affected by the ‘Addison-only’ form ofLD at the age of 18 from a carrier mother asymptomatic (Wicherst al., 1999). In our study, the X-ALD patient carries the same

utation (c.1780 + 2T>G) but De novo, his mother was healthy. He

howed both Addison disease and neurological dysfunction andas categorized into ccALD, the signs of the disease appeared from

he age of 5. Therefore, we note that the same mutation causes two

rmal ABCD1 splicing pattern. (B) Aberrant ABCD1 splicing induced by c.1780 + 2T>Gte.

different phenotypes at two different ages. Although the identifi-cation of the c.1780 + 2T>G mutation, no functional studies wereperformed on this mutation and its effect on splicing mechanism.Splice site mutations are involved in the production of aberranttranscripts by full skipping of one or more exons, retention ofintrons, formation of pseudo-exons, or activation of a cryptic splicesite (Berget, 1995). In our study, HSF predictions suggested that T>Gchange disrupted the recognition of the splice donor site of exon7 causing an abnormal splicing process. This finding motivated usto analyze the effect in vivo of the splicing mutation c.1780 + 2T>G

Fig. 5. Estimating diagram of expression levels of ABCD1 transcripts by Quantity1D analysis. Band intensity is expressed in arbitrary units (intensity × area) calcu-lated by the software. Normal transcript ABCD1: 9855.406; aberrant major transcriptABCD1: 5624.406; aberrant minor transcript ABCD1: 3903.187.

1 ience R

dwrwaiictt

ds(wspnimsatapcmeapi

ra(esTUda7

ddtwsptdOcp

A

at

R

A

2 F. Kallabi et al. / Neurosc

ata, two mutant transcripts were identified: one minor transcriptith exon 7 skipping and one major transcript with intron partial

etention resulting from the activation of cryptic splicing siteithin intron 7. These results confirm the “in silico” predictions

nalyzed by HSF. The RT-PCR electrophoresis gel showed anntense band corresponding to the major transcript and a lessntense band corresponding to the minor transcript. This findingan be explained by the difference in expression levels of the tworanscripts. In fact, the major transcript could be more expressedhan the minor transcript in the lymphocytes cells of patient.

In the X-ALD disease, many splice site mutations have beenescribed in ABCD1 gene. Indeed, Guimarães et al. reported aplice site mutation at the +1 position of donor site of exon 7c.1780 + 1G>A) in a Portuguese family but no functional studyas performed (Guimarães et al., 2002). In addition, a putative

plicing mutation c.1081 + 5G>C was identified in an Argentineanatient, the sequencing analysis of cDNA showed a loss of 588ucleotides encoding exons 2–5 (Amorosi et al., 2012). Many stud-

es have examined the effect of splicing mutations on pre-mRNAaturation in other genetic diseases. Similar to our findings, Nel-

on et al. reported a functional study on the ATRX gene in a patientffected by �-thalassemia-myelodysplastic syndrome and carryinghe IVS4 + 2T>C mutation. This substitution leads to two differentbnormal transcripts; the first one lacks exon 4 and the second oneresents a partial intron 4 retention due to the activation of a newryptic splice site. Both outcomes induced a frameshifts with pre-ature stop codon generation in exon 5 (Nelson et al., 2005). This

vidence regarding the frequent detection of alterations at the +1nd +2 sites are matching with the finding that GT at nucleotideositions +1 and +2 of splice donor sites is highly conserved (98%)

n human genes (Sahashi et al., 2007).Precise pre-mRNA splicing is catalyzed by the spliceosome that

ecognizes conserved sequences at the exon–intron boundariesnd branch point sites (Roca et al., 2005). The 5′ splicing site5′ss) is composed of nine partially conserved nucleotides at thexon–intron boundary, and base pairing to the 5′-terminus of U1nRNA occurs in this complex (Roca et al., 2005; Wilusz et al., 2001).he variation of donor site causes a nucleotide mismatch with1snRNA (Boldina et al., 2009). In our study, it seems reasonable toeduce that the generated dysfunctional mRNA splicing isoformsre the consequence of a disruption of conserved sequences at exon–intron 7 boundary recognized by the spliceosome.

In splicing analysis, proteins are often undetected because ofegradation of aberrant transcripts by the nonsense-mediatedecay NMD (Maquat, 2004). About 78% of PTCs were located in morehan 50 nucleotides upstream of the last exon–exon junction, andere thus predicted to produce a marked proportion of NMD sub-

trates (Maquat, 2004). Based on this data and according to the PTCosition rule, we suggested that the resulting nonsense mRNA dueo exon 7 skipping and partial intron 7 retention will be probablyestroyed by the NMD process during the translation mechanism.ften, retention of internal introns decreases the expression of theorresponding mRNAs and targets them to degradation by the NMDathway (Jaillon et al., 2008; Farlow et al., 2010).

cknowledgements

We are indebted to the family for their invaluable cooperationnd for providing the blood samples. This research was funded byhe Tunisian Ministry of Higher Education and Scientific Research.

eferences

morosi, C.A., Myskova, H., Monti, M.R., Argarana, C.E., Morita, M., Kemp,S., de Kremer, R.D., Dvorakova, L., de Ramırez, A.M.O., 2012. X-Linked

esearch 97 (2015) 7–12

adrenoleukodystrophy: molecular and functional analysis of the ABCD1 genein Argentinean patients. PLoS ONE 7, e52635.

Berget, S.M., 1995. Exon recognition in vertebrate splicing. J. Biol. Chem. 270,2411–2414.

Bezman, L., Moser, A.B., Raymond, G.V., Rinaldo, P., Watkins, P.A., 2001.Adrenoleukodystrophy: incidence, new mutation rate, and results of extendedfamily screening. Ann. Neurol. 49, 512–517.

Boehm, C.D., Cutting, G.R., Lachtermacher, M.B., Moser, H.W., Chong, S.S., 1999.Accurate DNA-based diagnostic and carrier testing for X-linked adrenoleukodys-trophy. Mol. Genet. Metab. 66, 128–136.

Boldina, G., Ivashchenko, A., Regnier, M., 2009. Using profiles based on nucleotidehydrophobicity to define essential regions for splicing. Int. J. Biol. Sci. 5, 13–19.

Chiu, H.C., Liang, J.S., Wang, J.S., Lu, J.F., 2006. Mutational analyses of Tai-wanese kindred with X-linked adrenoleukodystrophy. Pediatr. Neurol. 35,250–256.

Desmet, F.O., Hamroun, D., Lalande, M., Collod-Béroud, G., Claustres, M., Béroud, C.,2009. Human splicing finder: an online bioinformatics tool to predict splicingsignals. Nucleic Acids Res. 37, e67.

Farlow, A., Meduri, E., Dolezal, M., Hua, L., Schlötterer, C., 2010. Nonsense mediateddecay enables intron gain in Drosophila. PLoS Genet. 6, e1000819.

Ferrer, I., Aubourg, P., Pujol, A., 2010. General aspects and neuropathology of X-linkedadrenoleukodystrophy. Brain Pathol. 20, 817–830.

Guimarães, C.P., Lemos, M., Menezes, I., Coelho, T., Sá-Miranda, C., Azevedo, J.E., 2001.Characterisation of two mutations in the ABCD1 gene leading to low levels ofnormal ALDP. Hum. Genet. 109, 616–622.

Guimarães, C.P., Lemos, M., Sá-Miranda, C., Azevedo, J.E., 2002. Molecular character-ization of 21 X-ALD Portuguese families: identification of eight novel mutationsin the ABCD1 gene. Mol. Genet. Metab. 76, 62–67.

Igarashi, M., Schaumburg, H.H., Powers, J., Kishmoto, Y., Kolodny, E., 1976. Fatty acidabnormality in adrenoleukodystrophy. J. Neurochem. 26, 851–860.

Jaillon, O., Bouhouche, K., Gout, J., Aury, J., Noel, B., 2008. Translational control ofintron splicing in eukaryotes. Nature 45, 1359–1362.

Jardim, L.B., da Silva, A.C., Blank, D., Villanueva, M.M., Renck, L., Costa, M.L., Vargas,C.R., Deon, M., Coelho, D.I., Vedolin, L., de Castro Jr., C.G., Gregianin, L., Bonfim, C.,Giugliani, R., 2010. X-linked adrenoleukodystrophy: clinical course and minimalincidence in South Brazil. Brain Dev. 32, 180–190.

Kemp, S., Pujol, A., Waterham, H.R., van Geel, B.M., Boehm, C.D., Raymond, G.V.,Cutting, G.R., Wanders, R.J., Moser, H.W., 2001. ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: role in diagnosis and clinicalcorrelations. Hum. Mutat. 18, 499–515.

Lewin, H.A., Stewart-Haynes, J.A., 1992. A simple method for DNA extraction fromleukocytes for use in PCR. Biotechniques 13, 522–524.

Maquat, L.E., 2004. Nonsense-mediated mRNA decay: splicing, translation andmRNP dynamics. Nat. Rev. Mol. Cell Biol. 5, 89–99.

Migeon, B.R., Moser, H.W., Moser, A.B., Axelman, J., Sillence, D., 1981.Adrenoleukodystrophy: evidence for X linkage, inactivation, and selection favor-ing the mutant allele in heterozygous cells. Proc. Natl. Acad. Sci. 78, 5066–5070.

Mount, S.M., 1982. A catalogue of splice junction sequences. Nucleic Acids Res. 10,459–472.

Moser, A.B., Kreite, N., Bezman, L., Lu, S., Raymond, G.V., 1999. Plasma very longchain fatty acids in 3000 peroxisome disease patients and 29,000 controls. Ann.Neurol. 45, 100–110.

Moser, H.W., Mahmood, A., Raymon, R.V., 2007. X-linked adrenoleukodystrophy.Nat. Clin. Pract. Neurol. 3, 140–151.

Moser, H.W., Smith, K.D., Watkins, P.A., Powers, J., Moser, A.B., Seriver, C.R., Beaudet,A.L., Sly, W.S., Valle, D., 2002. X-Linked adrenoleukodystrophy, the metabolicand molecular bases of inherited disease. J. Genet. 8, 3257–3301.

Mosser, J., Douar, A.M., Sarde, C.O., Kioschis, P., Feil, R., Moser, H., Poustka, A.M.,Mandel, J.L., Aubourg, P., 1993. Putative X-linked adrenoleukodystrophy geneshares unexpected homology with ABC transporters. Nature 361, 726–730.

Nelson, M.E., Thurmes, P.J., Hoyer, J.D., Steensma, D.P., 2005. A novel 5′ ATRX muta-tion with splicing consequences in acquired alpha thalassemia-myelodysplasticsyndrome. Haematologica 90, 1463–1470.

Roca, X., Sachidanandam, R., Krainer, A.R., 2005. Determinants of the inherentstrength of human 5′ splice sites. RNA 11, 683–698.

Sahashi, K., Masuda, A., Matsuura, T., Shinmi, J., Zhang, Z., Takeshima, Y., Matsuo,M., Sobue, G., Ohno, K., 2007. In vitro and in silico analysis reveals an efficientalgorithm to predict the splicing consequences of mutations at the 5′ splice sites.Nucleic Acids Res. 35, 5995–6003.

Shi, X.R., Chen, Y.C., Xie, W.H., Huang, M.F., Hou, X.J., Wang, N., 2003. Analysis onmutation of adrenoleukodystrophy gene in exon 1 and exon 5. Zhonghua. Yi.Xue. Yi. Chuan. Xue. Za. Zhi. 20, 43–45.

Valianpour, F., Selhorst, J.J., van Lint, L.E., van Gennip, A.H., Wanders, R.J., 2003.Analysis of very long-chain fatty acids using electrospray ionization mass spec-trometry. Mol. Genet. Metab. 79, 189–196.

Van Geel, B.M., Assies, J., Wanders, R.J.A., Barth, P.G., 1997. X-linked adrenoleukodys-trophy: clinical presentation, diagnosis and therapy. J. Neurol. Neurosurg.Psychiatry 63, 4–14.

Wichers, M., Köhler, W., Brennemann, W., Boese, V., Sokolowski, P., Bidlingmaier, F.,

Ludwig, M., 1999. X-linked adrenomyeloneuropathy associated with 14 novelALD-gene mutations: no correlation between type of mutation and age of onset.Hum. Genet. 105, 116–119.

Wilusz, C.J., Wang, W., Peltz, S.W., 2001. Curbing the nonsense: the activation andregulation of mRNA surveillance. Genes Dev. 15, 2781–2785.