Upload
pooja1923
View
378
Download
2
Embed Size (px)
Citation preview
Screening of MDR1Gene Polymorphisms in Non Tribal Population
of Kerala Pooja GuptaMSc Project ThesisInternal Guide: Mrs K.Narayani, SRM Arts and Science College, ChennaiExternal Guide: Dr.Moinak Banerjee, Rajiv Gandhi Centre for Biotechnology, Trivandrum
Object ive & Scope
• To estimate the frequency distribution for three MDR1 SNPs(C3435T, G2677T, In07+139C/T polymorphisms)
• To study the linkage disequilibrium pattern in four non tribal communities of Kerala viz. Syrian Christians, Namboothiri, Ezhava and Nair caste groups.
• To understand the effect of variation on the pharmacokinetic profile of antiepileptic drugs
Epilepsy
• Epilepsy is the most prevalent chronic neurological disorder, characterized by recurrent unprovoked seizure affecting at least 50 million people worldwide.
• In many patients with epilepsy, seizures are well-controlled with currently available anti-epileptic drugs. But a substantial proportion (36%) of epilepsy patients do not respond to any of two to three first line AEDs.
• Individual patients with similar epilepsy syndromes who are taking similar, or even the same, doses of medication can have vastly different responses.
Pharmacoresistance in Epilepsy
• Pharmacokinetic Mechanism Transporter Hypothesis• Pharmacodynamic Mechanism Target Hypothesis
Course of an AED
Multidrug Transporters
• Increased expression or function of multidrug transporter proteins decreases the effective concentration of AEDs at their targets.
• Several genes encoding transmembrane proteins that function as drug efflux pumps have been characterised.
• Superfamily of adenosine triphosphate-binding cassette (ABC) proteins.
• A large number of human genes belonging to this superfamilyhave been identified, which have been systematically classified into seven subfamilies [ABCA, ABCB, ABCC, ABCD, ABCE ABCF and ABCG]. ATP-driven pumps
Common MDR transporters
P-gp Expression and Genotype
• P-glycoprotein is the gene product of MDR1 gene• P-gp was reported to be overexpressed in human epileptic brain tissue(BBB) which limits the
penetration of AED’s into the brain.
Structure of P-gp
Plan of Work
Methodology
Results
PRIMER
PRIMER SEQUENCE
AMPLIFIE D
PRODUCTSIZE
SNP
13MDR14MDR
AGGTTTCATTTTGGTGCCTG
GAACAAAAGGATGCACACGAC
299 In07+139 C/T
9MDR10MDR a
TGCAGGCTATAGGTTCCAGG
TTTAGTTTGACTCACCTTCCCG
224 Ex22 G2677T
11MDR12MDR
TGTTTTCAGCTGCTTGATGG
AAGGCATGTATGTTGGCCTC
197 Ex27 C3435T
Gradient PCR
In 07+139C/T Ex22 G2677T Ex27 C3435T
56.3ºC 53ºC 61.3ºC
RFLP Results
Genotypes obtained by RFLP
Linkage Disequilibrium Analysis
1- In07+139C/T2- Ex 2677G/T3- Ex 3435C/T In07+139C/T was found to be in strong linkage disequilibrium with Ex 2677G/T(D’=0.649,r²=0.387) but not in significant LD with Ex 3435C/T (D’=0.393,r²=0.12)
Summary and Conclusion• SNPs at ABCB1 gene loci showed a diversity of
allele, genotype frequencies, LDs amongst the four different populations and its similarities with other world populations.
• EZ caste group showed significant similarity with Mexican, CEU and TSI groups for ABCB1 gene polymorphisms. Also Ezhava and Nair caste groups were found to be closely related to each other.
• It can be concluded that different tribal communities of Kerala population show similarity with MEX, CEU, TSI, GIH and JPT.
Contd…..• Case-Control Matching-The pregenotyped
population samples could be used when needed as a comparator (i.e., control) group for association studies of adverse drug reactions.
• By LD plot it can be interpreted if the desired set of SNPs can be considered as a haplotype as it jointly influences the outcome of various diseases.
• Present study shows strong LD between G2677T and In07+139C/T.To establish it as a haplotype, further studies should be performed with other SNPs and results from cases and controls must be compared.
Contd…
• Genetic association studies have seen to be non replicated among different population due to different reasons, including population stratification.
• By studying the frequency distribution in different caste groups of Kerala, it can be concluded that there is no population stratification among the Kerala population and it can be considered to be a homogenous population with no striking allelic differences even among the different ethnic groups.