Upload
john-wilbanks
View
1.833
Download
2
Embed Size (px)
DESCRIPTION
Citation preview
life sciences infrastructure
john wilbanksvp for science @ creative commons
innovation summit11 january 2008
palo alto, ca
how to deliver drugs to cellsdisease mechanismstoxicity mechanisms
what we don’t know:
how to deliver drugs to cellsdisease mechanismstoxicity mechanisms
what we don’t know:
it’s a knowledge problem, and thus more money doesn’t translate to more drugs
the messaging doesn’t help
look, it’s a linear process!
drug discovery, development, and approval
$800,000,000-$1,ooo,000,000 per success
15-17 years
drug discovery, development, and approval
think of the total number of transactions
and how to disaggregate them outside the context ofa massive single corporate entity?
drug discovery, development, and approval
drug discovery, development, and approval
infrastructure needed: legal, technical, social, business
not: “open source biology” a la GPL
drug discovery, development, and approval
“open science” - commons-based, technologically enabled, lots of small transactions and collaborations
infrastructure to enable the emergence of open innovation systems in the life sciences
national systems are vastly unequal - the financial barriers to playing are so high - but that’s changing as the cost of life
sciences research drops
significant collaboration is needed to take life science innovation to the “next level” - reproducible drug discovery
collaborative innovation is a non-miraculous approach to increasing the odds of reproducible discovery
legal, technical, and policy elements are required to wrench life sciences into the network form of collaboration
Open Access Content
Open SourceKnowledge Management
Open AccessResearch Tools
innovation
moving to a digital infrastructure for publishing and using knowledge in science
or, why “paper” is the wrong metaphor
the impact of copyrights on innovation in scientific publishing:
http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf
legal infrastructure technical infrastructure
legal infrastructure technical infrastructure
social infrastructure: carrots and sticks
Open Access Content
Open SourceKnowledge Management
Open AccessResearch Tools
innovation
Alzheimer’sDisease
Huntington’sDisease
MultipleSclerosis
Autism
distinct “silos” of funded research
Alzheimer’sDisease
Huntington’sDisease
MultipleSclerosis
Autism
bilateral contracts and deals
Alzheimer’sDisease
Huntington’sDisease
MultipleSclerosis
Autism
“one to many” offers / networks
traits of legal protocols:
legally accuratesimple for scientists
low transaction costsfacilitate interoperability
business friendly
change requires a new legal infrastructure to encourage collaboration
ibridge
contractualreconstruction
of the research
exemption
Provider Lab
biobank
Recipient Lab
MTA
deposittracking
fulfillment
searching / ordering
takes a full e-commerce infrastructure
Open Access Content
Open SourceKnowledge Management
Open AccessResearch Tools
innovation
knowledge management
what you get
DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`
what you want
NeuronDBBAMS
Literature
Homologene
SWAN
Entrez Gene
Gene Ontology
Mammalian Phenotype
PDSPki
BrainPharm
AlzGene
Antibodies
PubChem
MESH
Reactome
Allen Brain Atlas
NeuronDB
BAMS
Literature
Homologene
SWAN
Entrez Gene
Gene Ontology
Mammalian Phenotype
PDSPki
BrainPharm
AlzGene
Antibodies
PubChem
MESH
Reactome
Allen Brain Atlas
prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>
prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>
prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>
select ?genename ?processnamewhere
{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D017966 .
?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article.
} graph <http://purl.org/commons/hcls/goa>
{ ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function.
?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as.
?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations>
{{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union
{?process rdfs:subClassOf go:GO_0007166 }} ?protein rdfs:subClassOf ?parent.
?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene.
} graph <http://purl.org/commons/hcls/gene>
{ ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416>
{ ?process rdfs:label ?processname}}
Mesh: Pyramidal Neurons
Pubmed: Journal Articles
Entrez Gene: Genes
GO: Signal Transduction
running code
DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway
this functionality is not infrastructure for anyone outside of pharma, and it’s
artisanally created inside pharma
Many of the genes are indeed related to Alzheimer’s Disease through gamma
secretase (presenilin) activity
DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`
http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E%0Aprefix%20rdfs%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2000%2F01%2Frdf-schema%23%3E%0Aprefix%20owl%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2002%2F07%2Fowl%23%3E%0Aprefix%20mesh%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Frecord%2Fmesh%2F%3E%0Aprefix%20sc%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fscience%2Fowl%2Fsciencecommons%2F%3E%0Aprefix%20ro%3A%20%3Chttp%3A%2F%2Fwww.obofoundry.org%2Fro%2Fro.owl%23%3E%0A%0Aselect%20%3Fgenename%20%3Fprocessname%0Awhere%0A%7B%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fpubmesh%3E%0A%20%20%20%20%20%7B%20%3Fpaper%20%3Fp%20mesh%3AD017966%20.%0A%20%20%20%20%20%20%20%3Farticle%20sc%3Aidentified_by_pmid%20%3Fpaper.%0A%20%20%20%20%20%20%20%3Fgene%20sc%3Adescribes_gene_or_gene_product_mentioned_by%20%3Farticle.%0A%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgoa%3E%0A%20%20%20%20%20%7B%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fres.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AonProperty%20ro%3Ahas_function.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AsomeValuesFrom%20%3Fres2.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AonProperty%20ro%3Arealized_as.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AsomeValuesFrom%20%3Fprocess.%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%2Fclassrelations%3E%0A%20%20%20%20%20%7B%7B%3Fprocess%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2Fobo%23part_of%3E%20go%3AGO_0007166%7D%0A%20%20%20%20%20%20%20union%0A%20%20%20%20%20%20%7B%3Fprocess%20rdfs%3AsubClassOf%20go%3AGO_0007166%20%7D%7D%0A%20%20%20%20%20%20%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fparent.%0A%20%20%20%20%20%20%20%3Fparent%20owl%3AequivalentClass%20%3Fres3.%0A%20%20%20%20%20%20%20%3Fres3%20owl%3AhasValue%20%3Fgene.%0A%20%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgene%3E%0A%20%20%20%20%20%7B%20%3Fgene%20rdfs%3Alabel%20%3Fgenename%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%3E%0A%20%20%20%20%20%7B%20%3Fprocess%20rdfs%3Alabel%20%3Fprocessname%7D%0A%7D&format=&maxrows=50
prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>
prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>
prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>
select ?genename ?processnamewhere
{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D009369 . ?article sc:identified_by_pmid ?paper.
?gene sc:describes_gene_or_gene_product_mentioned_by ?article. }
graph <http://purl.org/commons/hcls/goa> { ?protein rdfs:subClassOf ?res.
?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2.
?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process.
graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166}
union {?process rdfs:subClassOf go:GO_0006610 }}
?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3.
?res3 owl:hasValue ?gene. }
graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename }
graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname}
}
“view source” effect: beneficial output of releasing control
the cost of doing this has dropped to the point that a non profit can do it and give it away
infrastructure we need:
API to the public domain“one-click” for research
default rule: the right to hack (tools, data, papers)non-artisanal contract culture
if we are successful:
more eyes creating more knowledgeless funding of redundant research
use what is known to drive rates of innovation
china, brazil, EU: innovation law (bayh-dole variants)OECD GBRCN
US massive investment in bio-it at NCBI, NIH“post-national” in many ways
collaborative incentives, tax credits, letting scientists patent, private r&d resources, “credit database,” etc.
costs are dropping, and a lot of countries have a chip on their shoulder: drug prices, developed world focus
the biology “peace dividend”:
we know a lot less about evolved systems like human bodies than we need, but the technologies we have built for studying those systems are going to drive
innovation we can’t even imagine
atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa
if we can’t deal with the data we create in a classic drug discovery context, how will we deal with the
data that comes from new sources and user-generated biology?
retail: $79.95 + shippingages ten and up
DNA Discovery Explorer Kit
thank you
[email protected]://sciencecommons.org
funded by: Kauffman Foundation, MacArthur Foundation, Omidyar Network, HighQ