Dr. adhra al mawali - immunophenotyping and mrd of acute myeloid leukemia

Multiparameter Flow Cytometry Multiparameter Flow Cytometry Techniques for the Detection of Techniques for the Detection of

Leukaemia Associated Phenotypes and Leukaemia Associated Phenotypes and Minimal Residual Disease Monitoring In Minimal Residual Disease Monitoring In

Acute Myeloid LeukaemiaAcute Myeloid LeukaemiaAdhra Al-Mawali, PhDAdhra Al-Mawali, PhD

Director/ Centre of Studies and ResearchDirector/ Centre of Studies and ResearchMinistry of HealthMinistry of Health

Institute of Medical and Veterinary Science (SA pathology)Institute of Medical and Veterinary Science (SA pathology)Hanson Institute Hanson Institute

Divisions of Haematology and Human Immunology Divisions of Haematology and Human Immunology University of AdelaideUniversity of Adelaide

OutlineOutline Leukaemia Associated Phenotypes (LAPs) Leukaemia Associated Phenotypes (LAPs)

Correlation of LAPs with prognosis in AMLCorrelation of LAPs with prognosis in AML

Sensitivity & Specificity of Flow Cytometry.Sensitivity & Specificity of Flow Cytometry.

Minimal Residual Disease (MRD)Minimal Residual Disease (MRD)

Correlation of MRD presence with prognosis in AML.Correlation of MRD presence with prognosis in AML.

Novel Findings in Stem Cells and their use as a Novel Findings in Stem Cells and their use as a unique MRD single phenotype.unique MRD single phenotype.

BackgroundBackgroundAcute myeloid leukaemia (AML): Acute myeloid leukaemia (AML):

life threatening neoplasmlife threatening neoplasm uncontrolled proliferation of myeloblastsuncontrolled proliferation of myeloblasts AML comprises about 40% of leukemias in the Western world. AML comprises about 40% of leukemias in the Western world.

Approximately 6500 cases are diagnosed in adults in the US Approximately 6500 cases are diagnosed in adults in the US annually.annually.

~ 25% of all leukaemias in adults and in Oman around (34%) of all ~ 25% of all leukaemias in adults and in Oman around (34%) of all leukameias. (Leukaemia research. Vol 24(7) page 589-594.leukameias. (Leukaemia research. Vol 24(7) page 589-594.

Despite advances in therapy of AML- majority of patients Despite advances in therapy of AML- majority of patients relapse and die from disease. relapse and die from disease.

With modern chemotherapyWith modern chemotherapy CR achieved in up to 80% of younger adultsCR achieved in up to 80% of younger adults but long term survival rates are as low as 30%-40%.but long term survival rates are as low as 30%-40%.

Management of AML - a therapeutic challenge due to the Management of AML - a therapeutic challenge due to the presence of minimal residual disease (MRD) presence of minimal residual disease (MRD)

ImmunophenotypingImmunophenotypingAML - outcome predicted by clinical, morphological AML - outcome predicted by clinical, morphological and molecular markers.and molecular markers.

The immunophenotype of leukaemic cells provides The immunophenotype of leukaemic cells provides another parameteranother parameter

Role as a predictor of outcome:Role as a predictor of outcome: NOT CLEARLY DEFINED.NOT CLEARLY DEFINED.

ImmunophenotypingImmunophenotypingIdentification of cells based on the types of Identification of cells based on the types of antigens on the surface of the cell.antigens on the surface of the cell.

Used to diagnose leukaemia by comparing Used to diagnose leukaemia by comparing malignant cells to normal cells.malignant cells to normal cells.

Analysis by using flow cytometryAnalysis by using flow cytometry..

Flow CytometryFlow Cytometry

Flow CytometryFlow Cytometry

The The measurementmeasurement (meter)(meter) of a of a cellcell (cyto)(cyto) as as it it flowsflows past a laser light source. past a laser light source.

The science of antigen/marker investigation The science of antigen/marker investigation of individual cells.of individual cells.

Detection of antigens on cell Detection of antigens on cell surfacesurface

Leukaemia-associated Leukaemia-associated phenotypes (LAPs)phenotypes (LAPs)

Comparison of leukaemic with normal bone marrow cells has revealed 5 patterns of aberrant expressions:

(1) lineage infidelity(2) asynchronous antigen expression (3) antigen over-expression (4) aberrant light-scatter properties (5) absence of lineage specific antigens

Literature in LAPsLiterature in LAPs

Incidence of aberrant phenotypes in AML varies between Incidence of aberrant phenotypes in AML varies between studies.studies.

Few studies - some LAPs have an association with Few studies - some LAPs have an association with prognosis / response to treatment.prognosis / response to treatment.

No previous studies have addressed the prognostic No previous studies have addressed the prognostic impact of LAPs in relapse.impact of LAPs in relapse.

Literature in proportion of LAPsLiterature in proportion of LAPs

Year Study % of LAP2001 Bahia et al 88%

1993 Reading et al 85%

2003 Voskova et al 85%

1995 Macedo et al 73%

1996 Babusikova et al 42%

2002 Zhu H et al 30%

AimsAims

1.1. To determine the frequency of To determine the frequency of LAPsLAPs in AML at Royal in AML at Royal Adelaide Hospital-Australia.Adelaide Hospital-Australia.

2.2. To correlate the presence of To correlate the presence of LAPSLAPS with response to with response to induction chemotherapy and relapse. induction chemotherapy and relapse.

Methods & MaterialsMethods & MaterialsSelection criteria:Selection criteria:

1.1. 84 Fresh Bone marrow samples84 Fresh Bone marrow samples2.2. Consecutive Consecutive 3.3. Unselected Unselected 4.4. Newly diagnosedNewly diagnosed5.5. Untreated AML patients Untreated AML patients 6.6. Obtained at diagnosis.Obtained at diagnosis.7.7. Diagnosis was based on MCIDiagnosis was based on MCI

Statistical analysisStatistical analysisA log binomial model. A log binomial model. Outcomes of interest: Outcomes of interest: – response to treatment vs no response.response to treatment vs no response.– relapse vs no relapse.relapse vs no relapse.

LAP positive or LAP negative as a predictor. LAP positive or LAP negative as a predictor. Confounders identified:Confounders identified:– age at diagnosis, gender, cytogenetics risk group, de age at diagnosis, gender, cytogenetics risk group, de

novo or secondary AML , WBC count.novo or secondary AML , WBC count.

Both unadjusted and adjusted risk ratios.Both unadjusted and adjusted risk ratios.

ResultsResults

64% were LAP+ (95% CI, 0.53- 0.74) 64% were LAP+ (95% CI, 0.53- 0.74)

Aberrant phenotype No. of cases (%) Lineage infidelity

CD7 14 (26)

CD10 2 (4)

CD2* 1 (2)

CD4* 1 (2)

CD19 1 (2)

Total 19 (36)

Asynchronous antigen expression CD117+/CD15+ 7 (13)

CD34+/CD56+ 11 (21)

CD34+/CD15+ 7 (13)

CD34+/CD117+/CD15+ 4 (8)

Total 29 (55)

Lack of lineage specific antigen CD33+/CD13- 9 (17)

CD13+/CD33- 10 (19)

Total 19 (36)

Dual parameter contour plot histograms Dual parameter contour plot histograms of an AML patient with asynchronous of an AML patient with asynchronous

antigen expression and lineage antigen expression and lineage infidelityinfidelity

Al-Mawali A,. The presence of leukaemia-associated phenotypes is an independent predictor of induction failure in acute myeloid leukaemia. International Journal of Laboratory Hematology. 2009 Feb; 31(1):61-8.

Correlation of LAPs and response to Correlation of LAPs and response to induction chemotherapyinduction chemotherapy

Total no. of Patients = 84

Receive induction chemotherapy = 59

Did not receive induction chemotherapy = 25

LAP positive = 37 LAP negative = 21

Achieved CR=18

Did not achieve CR=19

Achieved CR=17

Did not achieve CR=4

P= 0.01

The presence of LAP is associated The presence of LAP is associated with a poor response to induction with a poor response to induction

therapytherapy The absence of LAPs strongly predictive The absence of LAPs strongly predictive for achievement of CR (P = 0.01) for achievement of CR (P = 0.01)

Presence of LAPs predicted for an Presence of LAPs predicted for an adverse outcome (P = 0.04) after adjusting adverse outcome (P = 0.04) after adjusting for confounders for confounders

Correlation of LAPs and relapseCorrelation of LAPs and relapse

Patients evaluated for relapse = 29

LAP positive = 17 LAP negative =12

Relapsed = 8 Remained in CR= 9 Relapsed = 1 Remained in CR= 11

P= 0.04

LAPs predict relapse of AMLLAPs predict relapse of AML

Absence of LAPs strongly predictive for remaining in Absence of LAPs strongly predictive for remaining in CR.CR.Only 1 patient LAP negative - had relapsedOnly 1 patient LAP negative - had relapsedLAP + were at higher risk of relapse with 47% having LAP + were at higher risk of relapse with 47% having relapsed and 53% remaining in CR.relapsed and 53% remaining in CR.Non of the confounders were statistically significant.Non of the confounders were statistically significant.The median follow-up for patients was 36 months The median follow-up for patients was 36 months (range: 2.5-45)(range: 2.5-45)

LAPs predict relapse of AMLLAPs predict relapse of AMLRelapse Free Survival

Complete remission duration (days)

1400

1200

1000

8006004002000

Cum

ulat

ive

Sur

viiv

al

1.0

.5

.0

LAP + (n=17)

LAP - (n=12)

P = 0.03

Al-Mawali A,. The presence of leukaemia-associated phenotypes is an independent predictor of induction failure in acute myeloid leukaemia. International Journal of Laboratory Hematology. 2009 Feb; 31(1):61-8.

64% of AML patients displayed LAPs.64% of AML patients displayed LAPs.LAPs are independent markers for predicting LAPs are independent markers for predicting response to induction chemotherapy. response to induction chemotherapy. LAPs are independent markers for predicting LAPs are independent markers for predicting relapse.relapse.

ConclusionsConclusions

SignificanceSignificance

LAPs may reflect inherent biological LAPs may reflect inherent biological characteristics of the malignancy.characteristics of the malignancy.

LAPs may reflect an underlying dysplastic LAPs may reflect an underlying dysplastic process predisposing to the malignancy.process predisposing to the malignancy.

What is Minimal Residual Disease?What is Minimal Residual Disease?

MRD describes the lowest level of disease detectable MRD describes the lowest level of disease detectable using available methods after chemotherapy.using available methods after chemotherapy.

MRD is a term used when there is evidence MRD is a term used when there is evidence (either (either immunophenotypic, molecular or cytogenetic)immunophenotypic, molecular or cytogenetic) that that leukaemic cells remain in the BM, but there are leukaemic cells remain in the BM, but there are insufficient cells to be detected by routine examination insufficient cells to be detected by routine examination under the microscope. under the microscope.

Minimal Residual Disease (MRD)Minimal Residual Disease (MRD)

Usefulness of MRD studiesUsefulness of MRD studies1.1. Facilitate the early detection of impending Facilitate the early detection of impending

relapse.relapse.

2.2. May result in risk-adapted therapies.May result in risk-adapted therapies.

3.3. May offer a short-term endpoint to assess the May offer a short-term endpoint to assess the effectiveness of new, targeted therapies.effectiveness of new, targeted therapies.

If the leukemic cell at diagnosis carries an antigenic or molecular marker that distinguishes it from its normal counterpart,

This marker can be used after chemotherapy to detect residual malignant cells in BM.

MRD detection in AMLMRD detection in AML MRD detection and quantification in childhood ALL- established & incorporated in paediatric ALL trials.

(Vidriales et al, Blood 2003, Coustan-Smith E et al, Blood 2000, van Dogen JJ et al, Lancet 1998)

Few studies reported on the clinical value of MRD detection in AML.

The information provided is still limited. (San Miguel JF, Blood 2001, Venditti A et al Blood 2000, Feller N et al leukaemia 2004)

Ideal approach for MRD Ideal approach for MRD detectiondetection

1.1. Applicable in most cases. Applicable in most cases. 2.2. Sensitive.Sensitive.3.3. Specific for neoplastic cell type.Specific for neoplastic cell type.4.4. Allow quantitation of tumour burden for Allow quantitation of tumour burden for

prognostic purposes.prognostic purposes. (Provan and Gribben 2005) (Provan and Gribben 2005)

Molecular HematologyMolecular Hematology

MRD detection MethodsMRD detection Methods1.1. Cell culture assaysCell culture assays

2.2. Cytogenetic analysisCytogenetic analysis

3.3. Fluorescence in situ hybridization techniques (FISH).Fluorescence in situ hybridization techniques (FISH).

4.4. Multiparameter Flow Cytometry (MFC)Multiparameter Flow Cytometry (MFC)

5.5. Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR)

MRD detection MethodsMRD detection MethodsMRD could be detected with high sensitivity:MRD could be detected with high sensitivity:

1.1. Multiparameter Flow Cytometry (MFC) Multiparameter Flow Cytometry (MFC)

is based on the premise that leukaemic cells display aberrant phenotypic is based on the premise that leukaemic cells display aberrant phenotypic features that allow their distinction from normal cells at diagnosis.features that allow their distinction from normal cells at diagnosis.

The so called “Leukaemia associated phenotypes” (LAPs).The so called “Leukaemia associated phenotypes” (LAPs). sensitive 10sensitive 10-4-4-10-10-5-5

quantitativequantitative relatively cheaprelatively cheap Applicable to Applicable to 75-90% 75-90% of patients with AML. of patients with AML. Less specific than PCRLess specific than PCR

2.2. Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)

sensitive 10sensitive 10-4-4-10-10-6 -6

applicable only for patients who have molecular abnormalities ~ 30-40%.applicable only for patients who have molecular abnormalities ~ 30-40%.

MRD detection by MFCMRD detection by MFCLAPs are present on all leukemic cells or on a subset of them, but they are absent or very infrequent on normal BM cells.

Comparison of leukaemic with normal bone marrow cells has revealed 5 patterns of aberrant expressions:

(1) lineage infidelity or cross-lineage antigen expression(2) asynchronous antigen expression (3) antigen over-expression (4) aberrant light-scatter properties (5) absence of lineage specific antigens

AimsAimsTo assess the advantage of using 5-colour MFC to detect To assess the advantage of using 5-colour MFC to detect LAPs in AML at diagnosis.LAPs in AML at diagnosis.

To determine its utility in MRD detection.To determine its utility in MRD detection.

To achieve this we:To achieve this we:

1)1) Analysed the sensitivity of MFC Analysed the sensitivity of MFC

2)2) Assessed specificity by determining the immunophenotypic profiles of Assessed specificity by determining the immunophenotypic profiles of LAPs of AML versus regenerating and normal BMsLAPs of AML versus regenerating and normal BMs

3)3) Determined the incidence of these LAPs in a Determined the incidence of these LAPs in a series of series of 5454 consecutive, newly diagnosed AML patients. consecutive, newly diagnosed AML patients.

MethodsMethods

Five-colour MFCFive-colour MFC2 panels:2 panels:

– Screening panelScreening panel: : to identify AML from ALL patientsto identify AML from ALL patients

– Secondary panelSecondary panel: : to identify the aberrant phenotypes and to identify the aberrant phenotypes and track them for MRD studies.track them for MRD studies.

Screening PanelScreening PanelFITC PE PC-5

CD7 CD13 CD45

CD15 CD117 CD45

CD19 CD10 CD45

CD34 CD33 CD45

CD14 CD56 CD45

HLA-DR CD45

MPO CD45

TdT CD45

S NEG CD45

FITC PE ECD PC-5 PC-7

Control FITC Control PE CD45 Control PC-5 Control PC-7

CD2 CD56 CD45 CD34 CD117


CD14 CD11b CD45 CD34 CD117






CD38 CD123 CD45 CD34 CD117

Secondary PanelSecondary Panel

Establishment of a LAPEstablishment of a LAP1. Defining of AML blasts in the WBC compartment

No gate: WBC compartment is gated based on

CD45 expression and FSC (R1).

Gated on R1, Cell fragments and/or dead cells can be further excluded in SSC/FSC plot (R2) &

to ensure homogeneity of blast populations. 2. Backgating steps of cells showing CD34+CD117+CD45dim

Backgating on CD34+ cells Part of the AML blasts show CD34 expression

(R4). These CD34+ cells show a dim CD45 expression.

Backgating on CD117+ cells Part of the AML blasts show CD117

expression (R10). These CD117+ cells show a dim CD45 expression.

Backgating on CD7+ cells

Gated on R2+, showing CD7+ cells position on

CD45+ cells, some of these cells are T-Lymphocytes and some are in the blasts

population, Gate R6 including only cells in the blast population

3. LAP expression on AML Blasts

Gated on R6, showing cells coexpressing

CD34+CD7+, The CD34+ cells which show CD45 dim expression show CD7

expression, which defines the LAP

Gated on R6, showing cells co-expressing CD117+CD7+, The CD117+

cells which show CD45dim expression show CD7 expression, which defines the LAP

1) “1) “In VitroIn Vitro” Sensitivity of ” Sensitivity of MFCMFC

To determine the level of sensitivity of MFC for the detection of leukaemic cells when present at very low frequencies - 8 serial dilutional experiments were performed.

The dilutions covered a range from 50% to 0.001%.

At least one aberrant leukaemic cell among 104 and 105 normal haemopoietic cells could be detected.

Sensitivity of MFCSensitivity of MFC

A) 1:1 dilution 24% leukaemic cells (CD34+CD56+)

B) 1:10 dilution 3.4x10-1 leukaemic cells (CD34+CD56+)

C) 1:100 dilution 4.8x10-2 leukaemic cells (CD34+CD56+)

D) 1:1000 dilution 5.1x10-3

leukaemic cells (CD34+CD56+)

E) 1:10000 dilution 7.1x10-4 leukaemic cells (CD34+CD56+)

F) No dilution Normal BM 3.8x 10-5

(CD34+CD56+)

Assessment Of Linearity and reproducibility Of Sensitivity Experiments

1) Linearity 2) Reproducibility

Al-Mawali A, Incidence, Sensitivity and Specificity of Leukaemia Associated Phenotypes in Acute Myeloid Leukaemia Patients using Specific Five-Colour Multiparameter Flow Cytometry. American Journal of Clinical Pathology, 2008; 129(6): 934-45.

0.000

0.020

0.040

0.060

0.080

0.100

0.120

0.140

LAPs

Mea

n %

LA

Ps

Normal BM Regenerating BM

2) Specificity: LAPs expression in normal and regenerating bone marrow cells

LAPs are extremely rare in normal and regenerating BMs

• MFC analysis showed no differences in expression of these LAP characteristic cells in normal and regenerating BM (p = 0.2).

0.000

0.020

0.040

0.060

0.080

0.100

0.120

CD56+CD2+ CD34+CD11b+ CD34+CD15+ CD34+CD56+ CD34+CD64+ CD34+CD65+ CD117+CD11b+ CD117+CD15+

Lymphoid associated antigens

Tota

l % o

f LA

PS

Normal BM Regenerating BM

0.000

0.020

0.040

0.060

0.080

0.100

0.120

CD56+CD2+

CD34+CD11b

+

CD34+CD15+

CD34+CD56+

CD34+CD64+

CD34+CD65+

CD117+

CD11b+

CD117+

CD15+

CD117+

CD56+

CD117+

CD64+

CD117+

CD65+

Asynchronous Antigen expression

Tota

l % o

f LA

PsNormal BM Regenerating BM

Al-Mawali A, Incidence, Sensitivity and Specificity of Leukaemia Associated Phenotypes in Acute Myeloid Leukaemia Patients using Specific Five-Colour Multiparameter Flow Cytometry. American Journal of Clinical Pathology, 2008; 129(6): 934-45.

Patient characteristicsPatient characteristicsPatient characteristics Total

No. patients 54 Male/ female 37/17 Age at diagnosis, mean, (range) 58(18-85) WBC count at diagnosis × 109 /L, median (range) 5.6(0.26-179) Haemoglobin at diagnosis g/L, median (range) 94(52-143) Platelets at diagnosis × 109 /L, median (range) 61(11-241) BM blasts % by morphology, median (range) 42(19-96) BM blasts % by MFC, median (range) 36(7-86) AML de novo/secondary n (%) 42(78) / 12(22) FAB classification, n (%) Mo 0 (0) M1 9 (17) M2 11 (21) M3 2 (4) M4 9 (17) M5 5 (9) M6 1 (2) M7 1 (2) Not classified 16 (30) Cytogenetic risk group 22, n (%) Favourable 9 (17) Intermediate 25 (46) Poor 17 (31) No metaphases 3 (6)

3) Incidence of LAPs in AML patients3) Incidence of LAPs in AML patients

0

2

4

6

8

10

12

14

One Tw o Three Four Five Six Seven Eight Nine Ten

Number of aberrant immunophenotypes

Num

ber o

f cas

es

Overall, 94% (n=51) of the AML patients displayed LAPs at diagnosis.

• Analysing the data using the standard panel used at our institution by three- colour staining, LAPs were only observed in 79.6 % ( p<0.05)

Frequencies of LAPs in AML patients (n = 51)Frequencies of LAPs in AML patients (n = 51)LAPs (LAPs=243) No. of

cases % Positive cells in AML BM (range)

Lineage infidelity (n=40)

CD34+CD2+ 5 26-92 CD34+CD7+ 12 11-88 CD34+CD10+ 1 22 CD34+CD19+ 2 24-65 CD117+CD2+ 5 13-91 CD117+CD7+ 11 18-90 CD117+CD10+ 1 17 CD117+CD19+ 2 15-53 CD34+GlycoA+ 0 0 CD117+GlycoA+ 1 30

Asynchronous Antigen expression (n=146)

CD34+CD11b+ 11 11-80 CD34+CD14+ 0 0 CD34+CD15+ 20 10-36 CD34+CD56+ 5 29-84 CD34+CD64+ 6 10-49 CD34+CD65+ 15 11-63 CD117+CD11B+ 10 12-62 CD117+CD14+ 0 0 CD117+CD15+ 25 10-55 CD117+CD56+ 6 11-80 CD117+CD64+ 9 11-70 CD117+CD65+ 22 10-62 CD33+CD15+ 2 80-94 CD33+CD64+ 5 18-97 CD33+CD65+ 5 10-99 CD33+CD11b+ 3 20-26 CD33+CD56+ 2 10-78 Antigen overexpression (n=43) HLA-DR++ 11 95-100 CD34++ 10 95-99 CD117++ 3 96-99 CD13++ 9 96-99 CD33++ 10 96-99

Lack of lineage specific antigen (n=14)

CD33++CD13- 5 93-99 CD33-CD13++ 9 25-98

Application of the extensive panel of monoclonal antibodies resulted in Application of the extensive panel of monoclonal antibodies resulted in the identification of 243 LAPs within the 51 LAP positive patients.the identification of 243 LAPs within the 51 LAP positive patients.

% LAPs in AML % positive cells in normal BM (n=10) Log difference % positive cells in

regenerating BM (n=5) Log difference LAPs No. of cases min max median min max median min max

CD34+CD2+ 5 26 92 0.001 4.41 4.96 0.004 3.81 4.36 CD34+CD7+ 12 11 88 0.002 3.74 4.64 0.004 3.49 4.39 CD34+CD10+ 1 22 22 0.012 3.26 3.26 0.035 2.79 2.79 CD34+CD19+ 2 24 65 0.002 4.08 4.51 0.003 3.96 4.39 CD117+CD2 5 13 91 0.003 3.64 4.48 0.003 3.70 4.54 CD117+CD7+ 11 18 90 0.003 3.78 4.48 0.006 3.48 4.18 CD117+CD10+ 1 17 17 0.001 4.23 4.23 0.003 3.75 3.75 CD117+CD19+ 2 15 53 0.002 3.88 4.42 0.004 3.63 4.18 CD34+GlycoA+ 0 0 0 0.000 NC§ NC§ 0.053 NC§ NC§ CD117+GlycoA+ 1 30 30 0.001 4.48 4.48 0.015 3.31 3.31 CD34+CD11b+ 11 11 80 0.002 3.74 4.60 0.002 3.74 4.60 CD34+CD14+ 0 0 0 0.000 NC§ NC§ 0.002 NC§ NC§ CD34+CD15+ 20 10 36 0.004 3.40 3.95 0.012 2.92 3.48 CD34+CD56+ 5 29 84 0.001 4.46 4.92 0.001 4.35 4.81 CD34+CD64+ 6 10 49 0.051 2.29 2.98 0.086 2.06 2.75 CD34+CD65+ 15 11 63 0.013 2.93 3.69 0.057 2.29 3.05 CD117+CD11B+ 10 12 62 0.002 3.78 4.49 0.001 4.08 4.79 CD117+CD14+ 0 0 0 0.000 NC§ NC§ 0.001 NC§ NC§ CD117+CD15+ 25 10 55 0.010 3.00 3.74 0.017 2.76 3.50 CD117+CD56+ 6 11 80 0.003 3.56 4.43 0.002 3.74 4.60 CD117+CD64+ 9 11 70 0.067 2.22 3.02 0.040 2.44 3.24 CD117+CD65+ 22 10 62 0.007 3.15 3.95 0.028 2.55 3.34 Median 11 62 0.002 3.74 4.43 0.004 3.48 4.18 Min 0 0 0 2.22 2.98 0.001 2.06 2.75 Max 30 92 0.067 4.48 4.96 0.086 4.35 4.81

These markers represent a reasonable percentage of our These markers represent a reasonable percentage of our cohort: CD2 (9%) , CD56 (17%), CD7(28%), CD11b (14%) cohort: CD2 (9%) , CD56 (17%), CD7(28%), CD11b (14%)

and CD19 (4%)and CD19 (4%)24 (44%) of the cases express at least one of the most 24 (44%) of the cases express at least one of the most

sensitive LAPs: CD2, CD56,CD7, CD11b and CD7.sensitive LAPs: CD2, CD56,CD7, CD11b and CD7.Our data shows that CD2, CD56, CD7, CD19 and CD11b are the Our data shows that CD2, CD56, CD7, CD19 and CD11b are the

most useful markers for detection of MRDmost useful markers for detection of MRD

Most useful sensitive markers for Most useful sensitive markers for MRDMRD

ConclusionsConclusions LAPs can be detected in virtually all patients LAPs can be detected in virtually all patients

at diagnosis. at diagnosis. CD2, CD56 , CD11b, CD7 and CD19 are the CD2, CD56 , CD11b, CD7 and CD19 are the most sensitive immunophenotypes when most sensitive immunophenotypes when present in AML blasts.present in AML blasts.Sensitivity level of immunophenotyping Sensitivity level of immunophenotyping ranges between 10ranges between 10-4-4 and 10 and 10-5-5 . . The approach is highly reproducible.The approach is highly reproducible.

Detection Of MRD In AML Identifies Patients With Detection Of MRD In AML Identifies Patients With High Risk Of RelapseHigh Risk Of Relapse

Hypothesis:Hypothesis:

Presence of MRD post chemotherapy Presence of MRD post chemotherapy predicts worse prognosispredicts worse prognosis

AimsAimsTo determine the impact of MRD on clinical To determine the impact of MRD on clinical outcome.outcome.

To determine the optimal threshold value To determine the optimal threshold value (capable to split patients into 2 groups in terms of (capable to split patients into 2 groups in terms of residual leukaemic cells and relapse status).residual leukaemic cells and relapse status).

To establish what time point is better to predict To establish what time point is better to predict outcome, (i.e. post induction or post consolidation outcome, (i.e. post induction or post consolidation chemotherapy). chemotherapy).

Samples analysed by flow cytometry at diagnosis, n = 54 patients

Patients received chemotherapy, n = 31

Patients did not receive chemotherapy, n = 23

Old, n = 8

Old & secondary AML, n = 7

Patients died before chemotherapy, n = 3

Went back to their home state, n = 2

Secondary, n = 2

Patient refused chemotherapy , n = 1

Refractory to chemotherapy n = 4

Patients achieving CR n = 27 ( 87%)

Patients evaluable for MRD postinduction, n = 25

Patient died after induction, n = 1

LAP negative, n = 2 Patients didn’t receive consolidation, n = 2

Patients evaluable for MRD post consolidation I, II, III, IV & V, n = 22

AML samples analysed by MFC at diagnosisAML samples analysed by MFC at diagnosis

Pt. 1

MRD detection of a relapsing patient and of a patient still in remission

C)

D)

C)

D)

0.78% 0.42% 0.64%

0.12% 0.15% 0.13%

24%

0.09%

52%

32%

BM: AML at diagnosis after Induction after consolidation I after consolidation II Follow-up

Pt. 2

Al-Mawali A, Gillis D, Lewis ID. The use of Receiver Operating Characteristic analysis for detection of Minimal Residual Disease using Five-colour Multiparameter Flow Cytometry in Acute Myeloid Leukaemia Identifies Patients with High Risk of Relapse. Clinical Cytometry (Part B), 2009 Mar;76(2):91-101.

Establishing the optimal threshold value for MRDEstablishing the optimal threshold value for MRD++ vs vs MRDMRD--

100% - Specificity% Sensitivity%

0.000 11.111

0.000 22.222

0.000 33.333

9.090 44.444

9.090 55.555

18.181 55.555

18.181 66.666

18.181 77.777

27.272 88.888

36.363 88.888

45.454 88.888

54.545 88.888

63.636 88.888

72.727 100.000

81.818 100.000

90.909 100.000

Cutoff Sensitivity% Specificity% Likelihood ratio

<0.0650 44.440 90.910 4.89

<0.0750 55.560 90.910 6.11

<0.0850 55.560 81.820 3.06

<0.0950 66.670 81.820 3.67

<0.1150 77.780 81.820 4.28

<0.1450 88.890 72.730 3.26

<0.2600 88.890 63.640 2.44

<0.3750 88.890 54.550 1.96

<0.4000 88.890 45.450 1.63

<0.4200 88.890 36.360 1.40

<0.4550 100.000 27.270 1.38

<0.5000 100.000 18.180 1.22

<0.5400 100.000 9.091 1.10

Sens

itivi

ty


Establishing the optimal threshold that can split patients into 2 Establishing the optimal threshold that can split patients into 2

groups with residual leukaemic cells in terms of relapse statusgroups with residual leukaemic cells in terms of relapse status

Patients evaluable for Induction therapy, n=25

MRD- ≤ 0.15% MRD+ < 0.15%

18 patients (72%) 7 patients (28%)

Deceased = 2 (29%)

Relapsed = 5 (71%)

Median = 12.9 months (range 1.4-18.2)

Deceased = 1 (6%)

Relapsed = 8 (44%) Median = 24.7 months (range 9.5-51.1)

Remained in CR = 9 (50%)

Median = 18.5 months (range 1.8-25.1)


-

Detection of MRD in bone marrow post inductionDetection of MRD in bone marrow post induction

P = 0.048

Relapse free survival and Overall survival for patients with MRD Relapse free survival and Overall survival for patients with MRD post induction chemotherapypost induction chemotherapy

Post-Induction

0

0.2

0.4

0.6

0.8

1

1.2

0 200 400 600 800 1000Time (days)

Prop

rtion

Pro

gres

sion

-Fre

e≤1.5×10-3

n=17>1.5×10-3

n=7

RFS

p = 0.004

0

0.2

0.4

0.6

0.8

1

1.2

0 500 1000 1500 2000Time (days)

Cum

mul

ativ

e pr

oprti

on s

urvi

ving

≤1.5×10-3

n=17

>1.5×10-3

n=7

OS

p = 0.003

MRDMRD++ patients post induction chemotherapy had patients post induction chemotherapy had significantly shorter duration of RFS and OSsignificantly shorter duration of RFS and OS

Detection of MRD in bone marrow post consolidationDetection of MRD in bone marrow post consolidation

Patients evaluable post consolidation therapy, n = 22

MRD- ≤0.15% MRD+ <0.15%

13 patients (59%) 9 patients (41%)

Relapsed= 8 (89%)Median = 15.5 months (range 5.7-51.1)

Deceased = 2 (15%)

Relapsed = 3 (23%)Median = 24.5 months (range 18.2-31.8)

Remained in CR= 8 (62%)Median = 13.6 months (range 1.8-25.1)


P = 0.009


Relapse free survival and Overall survival for patients Relapse free survival and Overall survival for patients with MRD post consolidation chemotherapywith MRD post consolidation chemotherapy

Post-Consolidation

0

0.2

0.4

0.6

0.8

1

1.2

0 200 400 600 800 1000Time (days)

Prop

ortio

n pr

ogre

ssio

n-fre

e≤1.5×10-3

n=13

>1.5×10-3

n=9

RFS

p = 0.064

Post-Consolidation

0

0.2

0.4

0.6

0.8

1

1.2

0 500 1000 1500 2000Time (days)

Cum

ulat

ive

prop

ortio

n su

rviv

ing

≤1.5×10-3

n=15

>1.5×10-3

n=9

OS

p = 0.988

MRDMRD++ patients post consolidation chemotherapy had patients post consolidation chemotherapy had shorter duration of RFS but not OSshorter duration of RFS but not OS

Prognostic determinants in multivariate Prognostic determinants in multivariate analysisanalysis

Post-Ind MRDPost-Ind MRD++ status was found to be an independent status was found to be an independent variable significantly associated with:variable significantly associated with:

a higher frequency of relapse (a higher frequency of relapse (PP = 0.048) = 0.048)

a shorter duration of RFS (a shorter duration of RFS (P P = 0.04) with an estimated = 0.04) with an estimated hazard ratio of 4.7 (95% CI, 1.1-20.5). hazard ratio of 4.7 (95% CI, 1.1-20.5).

a shorter duration of OS (a shorter duration of OS (P P = 0.03) with an estimated = 0.03) with an estimated hazard ratio of 5.2 (95% CI, 1.2- 22.2). hazard ratio of 5.2 (95% CI, 1.2- 22.2).

ConclusionsConclusions Implementation of five-colour flow cytometry significantly improves the

MFC-based MRD quantification.

The threshold of MRD level of 0.15% is valid in discriminating risk categories in adult AML.

Patients in morphological CR who have detectable MRD remaining after induction chemotherapy have a worse prognosis.

Post induction MRD assessment is critical to predict disease outcome.

AML patients in whom MRD is not detectable after induction treatment and who remain MRD negative at the end of post-consolidation chemotherapy have superior RFS and OS.

Future applications of MRD Future applications of MRD studiesstudies

MRD may in future provide the biological basis for MRD may in future provide the biological basis for therapeutic decision making.therapeutic decision making.

MRD detection may allow specific treatment to be MRD detection may allow specific treatment to be tailored to the needs of the individual patient. tailored to the needs of the individual patient.

These data need to be confirmed in prospective trials These data need to be confirmed in prospective trials involving large numbers of patients, uniformly treated involving large numbers of patients, uniformly treated and monitored within well-defined protocols.and monitored within well-defined protocols.

Questions remained Questions remained unanswered?unanswered?

1) Can MRD assessment identify high-risk patients within both the standard-risk and good-risk groups, who require additional or more intensive therapy regimens?

2) Can MRD assessment identify those at very low risk of relapse, who might be candidates for reduction of treatment?

3) Can we establish a single standard marker for MRD؟؟ and at a stem cell level?

Immunoprofiling Of AML Immunoprofiling Of AML Stem Cells With CD123 (IL-3 Stem Cells With CD123 (IL-3 αα Receptor) Marks FLT3/ITD Receptor) Marks FLT3/ITD

Positive ClonesPositive Clones

http://www.pbase.com/winn777/bbc_battling_bass

Leukaemic Stem Cells and Leukaemic Stem Cells and MRDMRD

AML is generally regarded as a stem cell disease. In CD34-positive AML, the stem cell has been recognized as CD38-negative [Bonnet D, Dick JE, NAT Med 1997].

LSCs survive chemotherapy and grow out to cause the presence of MRD, which leads to relapse of the disease.If so, stem cell characteristics at diagnosis should show a correlation with MRD frequency after chemotherapy, which indeed was found for the frequency of the CD34+CD38– population at diagnosis (van Rhenen A et al , Clin Cancer research 2005)

In order for any AML therapy to be curative, it needs to be In order for any AML therapy to be curative, it needs to be effective effective against the cells that propagate and sustain against the cells that propagate and sustain the diseasethe disease, the so called Leukaemic stem cells (LSCs). , the so called Leukaemic stem cells (LSCs).

Leukaemic stem cells and MRDLeukaemic stem cells and MRDThe identification of immunophenotypical characteristics specific for the malignant CD34+CD38– cells at diagnosis would offer opportunities to study the stem cell compartment after chemotherapy.

This information would enable not only identification of patients at risk of relapse, but also could then help to identify new targets for therapy.

CD123 is one of the possible markers.

CD123 is expressed on most AML blasts and on the leukemic CD34+CD38– subpopulation at diagnosis.

Many LAPs were found to be prominently present on the AML stem cell compartment but not on the steady state and regenerating normal BM CD34+CD38– counterpart. [van Rhenen A, ASH abstract 2006].

Leukaemic stem cellsLeukaemic stem cellsInternal tandem duplication (ITD) mutations of the Internal tandem duplication (ITD) mutations of the FLT3FLT3 gene are the most frequent molecular abnormality in gene are the most frequent molecular abnormality in AML. AML.

While the normal FLT3 receptor is expressed in early While the normal FLT3 receptor is expressed in early haemopoietic progenitor cells, it has haemopoietic progenitor cells, it has not been not been determined whether FLT3/ITD mutations are present at determined whether FLT3/ITD mutations are present at the LSC level. the LSC level.

HypothesisHypothesis

FLT3/ITD mutation is present at leukaemic FLT3/ITD mutation is present at leukaemic stem cell level and not secondary event in stem cell level and not secondary event in leukaemogenesis & it is confined to leukaemogenesis & it is confined to CD34+CD38- fraction that possess IL-3 α CD34+CD38- fraction that possess IL-3 α receptor (CD123) in AML. receptor (CD123) in AML.

AimsAimsTo investigate whether or not FLT3/ITD are present at To investigate whether or not FLT3/ITD are present at LSC level. LSC level.

To demonstrate whether or not FLT3/ITD mutation is To demonstrate whether or not FLT3/ITD mutation is confined to the population of LSC as defined by confined to the population of LSC as defined by CD34CD34++/CD38/CD38--/CD123/CD123++ and not CD34 and not CD34++/CD38/CD38--/CD123/CD123-- cells. cells.

ResultsResultsExpression of IL-3 α receptor (CD123) in AML blast cellsExpression of IL-3 α receptor (CD123) in AML blast cells

CCD123 expression was found in the majority of AML patients D123 expression was found in the majority of AML patients 32/34 (94%) , median expression = 86%, (range, 20-99%)32/34 (94%) , median expression = 86%, (range, 20-99%)

Expression of IL-3 α receptor in leukaemic stem cellsExpression of IL-3 α receptor in leukaemic stem cells

CD123 was strongly expressed in the CD34+CD38- cells (98 ± 3% positive) from 28 (87.5%) of 32 primary specimens.

Expression of IL-3 α receptor in normal bone marrow CD34+CD38- fraction

Five normal BMs were tested for the expression of CD123 on

CD34+CD38- cells and they were all CD123 negative

Patient characteristics Total (%) No. patients 34 Male/female 24/10 Age at diagnosis, y, mean (range) 63 (23-86) % blasts at diagnosis (morphology) 41.5 (20-96) % blasts at diagnosis (Flow) 42.5 (9-86) WBC count at diagnosis, 109/L, median (range) 4.5 (0.71-179) De novo/Secondary AML 27 (79) / 7 (21) FAB classification, n (%) M0 0 (0) M1 8 (24) M2 10 (29) M3 1 (3) M4 2 (6) M5 4 (12) M6 1 (3) M7 0 (0) Not classified 8 (24) Cytogenetic risk group, n (%) Favourable 2 (6) Intermediate 19 (56) Poor 12 (35) No metaphases 1 (3) FLT3/ITD, n (%) Present 10 (29) Absent 15 (44) Not analysed 9 (26) CD123 Present 32 (94%) Absent 2 (6%)

Gating strategy used to identify CD34+CD38-CD123+ cellsGating strategy used to identify CD34+CD38-CD123+ cells

Gated on CD34+ cells: to identify a population homogenous for CD34+ cells

Ungated: to identify CD34+ cells and so the blast population on CD45/SSC log density plot

Gated on CD34+ cells to identify the blast population based on CD45 dim and low SS

1) Identification of the blast population

Density plot: Gated on CD34+ homogenous cells

Density plot: Gated on CD34+CD38- cells to identify a population homogenous for the scatter

Gated on CD34+CD38- homogenous cells to identify a population homogenous

Density plot: Gated on CD34+CD38- homogenous cells

2) Further Analysis

Sorting AML stem cellsSorting AML stem cellsTo determine expression of FLT3/ITD in AML stem cells, highly purified To determine expression of FLT3/ITD in AML stem cells, highly purified (purity >95%) CD34(purity >95%) CD34++/CD38/CD38--/CD123/CD123++ and CD34 and CD34++/CD38/CD38--/CD123/CD123-- cells were cells were examined for FLT3/ITD mutation in examined for FLT3/ITD mutation in 7 patients with FLT3/ITD positive AML7 patients with FLT3/ITD positive AML

Sample No.

Total Unsorted cells

CD34% Unsorted cells

%CD123 Unsorted cells

Total CD34+/CD38-/CD123+ cells from the sorter

Total CD34+/CD38-/CD123-

cells from the sorter Sequencing FLT3/ITD

1 10X106 96 86 150 1606 ND

2 18X106 89 99 76000 418 ND

3 12X106 91 86 12674 148396 78 bp 4 27X106 73Ж 93 1839 16 33 bp

5 30X106 10 64 559 164 ND

6 17X106 15 99 300,000 69 ND

7 40X106 79 68 640 3602 ND

Detection of Flt3/ITD in the purified Detection of Flt3/ITD in the purified AML stem cellsAML stem cells

Genomic DNA from unsorted and sorted cells was Genomic DNA from unsorted and sorted cells was isolated and PCR was performed using primers isolated and PCR was performed using primers flanking exons 14 and 15 of the flanking exons 14 and 15 of the FLT3FLT3 gene. gene.

IIn the n the 7 positive FLT3/ITD7 positive FLT3/ITD samples analysed, the samples analysed, the mutation was clearly present in the LSC-enriched mutation was clearly present in the LSC-enriched fractionfraction CD34 CD34++/CD38/CD38--/CD123/CD123++ confirming that confirming that FLT3/ITD mutation arises at the stem cell levelFLT3/ITD mutation arises at the stem cell level..

Interestingly, CD34Interestingly, CD34++/CD38/CD38--/CD123/CD123-- cells in 6 cells in 6 patients were FLT3/ITD negativepatients were FLT3/ITD negative..

FLT3/ITD

FLT3/WT

(A)

M 1 2 3 1 2 3 1 2 3 1 2 3 - No DNA + M

Patients 1 Patient 2 Patient 3 Patient 4

+ - -

+ - + - + Positive control (B) Patient 3: (33bp): catcccccc gatttcagagaatatgaatatgat Patient 4: (78bp): gtacaggtgaccggctcctcagataatgagtacttctacgttgatttcagagaatatgaatatgatctcaaatgggag

M 1 2 3 1 2 3 1 2 3 + - No DNA M

Patients 5 Patients 6 Patients 7 M Molecular marker Puc19 1 CD34+/CD38 -/CD123 -

2 CD34+/CD38 -/CD123 + 3 Unsorted sample at diagnosis - Negative control + Positive control (B) Patient 3: (33bp): catcccccc gatttcagagaatatgaatatgat Patient 4: (78bp): gtacaggtgaccggctcctcagataatgagta cttctacgttgatttcagagaatatgaatatgatctcaaatgggag

Detection of FLT3/ITD in the sorted Detection of FLT3/ITD in the sorted AML stem cellsAML stem cells

Conclusions:Conclusions:

1. We demonstrate FLT3/ITD mutations are found in a fraction of cells defined as CD34+CD38-CD123+.

2. There was evidence to suggest that the FLT3/ITD mutations were present within purified enriched LSC defined by CD123 and absent within stem cells without CD123.

The FLT3/ITD mutations in the CD34+/CD38-/CD123+ cells were sequenced in 2 patients (patient 3 and 4) to confirm that they represented the identical mutations present in the sorted and unsorted original samples.

FLT3/ITD

FLT3/WT

SummarySummary

We presented evidence that FLT3/ITD mutation is present at We presented evidence that FLT3/ITD mutation is present at LSC level and may be a primary and not secondary event in LSC level and may be a primary and not secondary event in leukaemogenesis. leukaemogenesis.

Our findings demonstrated that FLT3/ITD mutation was Our findings demonstrated that FLT3/ITD mutation was confined to a population of CD34confined to a population of CD34++CD38CD38--CD123CD123++ but not but not CD34CD34++CD38CD38--CD123CD123-- cells in the 7 AML patients. cells in the 7 AML patients.

We have shown that the oncogenic events of FLT3/ITD We have shown that the oncogenic events of FLT3/ITD happen at cell stage possessing the alpha chain of the IL-3 happen at cell stage possessing the alpha chain of the IL-3 receptor receptor

This novel finding This novel finding provideprovidess a a rationale for treatment involving rationale for treatment involving

CD123-targeting antibodies CD123-targeting antibodies combined with intracellular combined with intracellular FLT3 FLT3 inhibitors directed against AML inhibitors directed against AML

stem cells stem cells

Future DirectionFuture DirectionTargeting IL-3 alpha (CD123) receptor may be a novel promising Targeting IL-3 alpha (CD123) receptor may be a novel promising treatment approach in patients with CD123treatment approach in patients with CD123++ AML. AML.

This concept is based on the notion that in most patients with AML, This concept is based on the notion that in most patients with AML, myeloblasts express CD123 as we shown in our study.myeloblasts express CD123 as we shown in our study.

It may be of great importance to detect MRD stem cells after chemotherapy using CD34+CD38–CD123+, besides detecting MRD using the whole blast compartment which may further improve the clinical significance of these studies and may reveal the most relevant target-cell population for the design of new therapies.

Evidence for this role comes from the observation that AML stem cell parameters offer prognostic information additional to MRD frequency assessment.

Ideally, engraftment of these cells in NOD/SCID mice Ideally, engraftment of these cells in NOD/SCID mice should be the best evidence. This approach was not should be the best evidence. This approach was not able to be carried out due to technical reasons. able to be carried out due to technical reasons.

What is Next from There?What is Next from There?

Working on a new project!Working on a new project!

TITLE OF PROJECT:TITLE OF PROJECT:

Evaluation of the Role of CD34+CD38-Evaluation of the Role of CD34+CD38-CD123+ Cells as a Marker of Minimal CD123+ Cells as a Marker of Minimal Residual Disease in Acute Myeloid Residual Disease in Acute Myeloid

Leukaemia.Leukaemia.

HypothesisHypothesis

CD34+CD38-CD123+ can be detected in CD34+CD38-CD123+ can be detected in the majority of AML patients at diagnosis.the majority of AML patients at diagnosis.

CD34+CD38-CD123+ can be used as a CD34+CD38-CD123+ can be used as a marker of MRD post chemotherapy and marker of MRD post chemotherapy and persistence of CD34+CD38-CD123+ cells persistence of CD34+CD38-CD123+ cells will predict relapse of AML.will predict relapse of AML.

Aims of ProjectAims of ProjectTo determine the incidence of To determine the incidence of CD34+CD38-CD123+CD34+CD38-CD123+ cells in newly diagnosed AML. cells in newly diagnosed AML.

To determine the sensitivity and specificity of To determine the sensitivity and specificity of CD34+CD38-CD123+ CD34+CD38-CD123+ as a unique marker of as a unique marker of leukaemic cells.leukaemic cells.

To determine whether monitoring of To determine whether monitoring of CD34+CD38-CD34+CD38-CD123+ CD123+ cells post chemotherapy can be applied as an cells post chemotherapy can be applied as an MRD strategy. MRD strategy.

If successful, the results from this study will haveIf successful, the results from this study will have an an immediate impact on patient managementimmediate impact on patient management : :

1.1. More patients will be screened using this approach.More patients will be screened using this approach.2.2. A significant number of patients at risk of relapse will be A significant number of patients at risk of relapse will be

identified & offered alternate therapeutic strategies such as identified & offered alternate therapeutic strategies such as haemopoietic stem cell transplantation or novel therapies. haemopoietic stem cell transplantation or novel therapies.

3.3. A much smaller number of monoclonal antibodies, resulting A much smaller number of monoclonal antibodies, resulting in relatively simple data interpretation and therefore dropping in relatively simple data interpretation and therefore dropping down the cost of monoclonal antibodies. down the cost of monoclonal antibodies.

4.4. If this proves to be the case then it offers a relatively simple If this proves to be the case then it offers a relatively simple method for determining relapse risk of patients with AML method for determining relapse risk of patients with AML who then can be offered potential life saving therapeutic who then can be offered potential life saving therapeutic strategies.strategies.

5.5. We will aim to include such approaches in future multi-centre We will aim to include such approaches in future multi-centre studies evaluating new approaches in AML treatment.studies evaluating new approaches in AML treatment.

Significance of ProjectSignificance of Project

AcknowledgementAcknowledgementss

AustraliaAustraliaSupervisorsSupervisorsDr Ian LewisDr Ian LewisDr David GillisDr David Gillis

Division of HaematologyDivision of HaematologyProf. Dario Campana from USA, St.Jude UniversityProf. Dario Campana from USA, St.Jude UniversityProf Bik ToProf Bik ToDr Marion RobertsDr Marion RobertsDr Noemi HorvathDr Noemi HorvathDr. Sonia YoungDr. Sonia YoungKate PilkingtonKate PilkingtonSandy MacintyreSandy MacintyreAlan BishopAlan Bishop

Division of ImmunologyDivision of Immunology Prof. Angel LopezProf. Angel LopezDr. Pravin HissariaDr. Pravin HissariaDr. Jason PowellDr. Jason PowellDr. Daniel ThomasDr. Daniel ThomasJoy MundyJoy MundyRos FosterRos FosterAnne-Marie KennedyAnne-Marie Kennedy

University of AdelaideUniversity of AdelaideHelen Foster

Nancy Briggs

OmanOmanMOHMOH: : HE Dr Ahmed Al SaidiHE Dr Ahmed Al SaidiThe Reserch Council –Oman (funding the The Reserch Council –Oman (funding the project)project)All my colleagues in Haematology deptAll my colleagues in Haematology dept

QuestioQuestions Are ns Are WelcoWelcomed!med!

Health & Medicine

Dr. adhra al mawali - immunophenotyping and mrd of acute myeloid leukemia