Flashcard Warm-up
Restriction enzymesEnzymes that will cut DNA at specific places.
This can be used to create DNA fingerprints or to insert genes through gene therapy.
My picture:My definition:
Gel ElectrophoresisTool used to create a DNA fingerprint
My picture:My definition:
Unit 9Biotechnology and Genomics
This is a DNA fingerprint.
This is NOT a DNA fingerprint.
DNA Fingerprint A unique band pattern of DNA fragments. Unique to every individual, unless you
have an identical twin
DNA Fingerprint
Gel Electrophoresis: › a tool used to
create a DNA fingerprint; separates pieces of DNA based on size (the number of
base pairs in each piece).
DNA Fingerprint Steps in DNA Fingerprinting
› Step 1: Restriction enzyme cleaves specific DNA sequence
› Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases
› Cleave: to Cut
DNA Fingerprinting Step 2: DNA loaded into a gel
electrophoresis.. Step 3: Bands are created as electricity
forces DNA fragments through the gel. Small pieces move further than larger pieces.
Running a gel
1 2
cut DNA with restriction enzymes
fragments of DNAseparate out based on size
3
Stain DNA› ethidium bromide
binds to DNA› fluoresces under
UV light
DNA Fingerprint Uses for DNA Fingerprinting:
› Violent Crimes – determines source of DNA left at a crime scene.
› Paternity - used to determine the father of a child
Uses: Evolutionary relationships
Comparing DNA samples from different organisms to measure evolutionary relationships
–
+
DNA
1 32 4 5 1 2 3 4 5
turtlesnakeratsquirrelfruitfly
Example
A DNA sample wasretrieved from a rape kit completed at the hospital. The policehave 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?
Ticket out the Door1. Why are restriction
enzymes important when making a DNA fingerprint?
2. What do the bands represent on a DNA fingerprint?
3. Using the fingerprint to the right who is a possible suspect for murder?
Flashcard Warm-up
Recombinant DNA/ Genetic
EngineeringTechnology that combines
DNA from two different organisms. One practical application of this process
is making human insulin for people with Diabetes.
Glo fish were the first genetically engineeredPet in 1993!A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmental toxins
Is the male in the fingerprint the father of the girl?
Can we mix genes from one creature to another?
YES!
We have been manipulating DNA for generations!
Artificial breeding or AKA artificial selection› creating new breeds of animals & new crop plants to
improve our food› A process in which humans consciously select for or
against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature
Breeding food plants
Evolution of modern corn (right) from ancestral teosinte (left).
Most practical application of GENETIC ENGINEERING…
Creating Insulin (a protein hormone) for people with Diabetes
Genetic Engineering Genetic Engineering: Modifications of DNA;
AKA Recombinant DNA› Transgenic Organism: an organism which
contains foreign DNA
A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.
Genetic Engineering
Process in creating Transgenic organism:› Step 1: Restriction
enzymes cleave DNA sequence at desired gene (ex. Insulin
Genetic Engineering Step 2 : The same
restriction enzyme is used to cleave the vector › Vector: The structure
used to carry the foreign DNA bacterial plasmids commonly used.
› Plasmid: Circular DNA found in bacteria
Genetic Engineering Step 3: Foreign DNA and Vector spliced
together› Splice: Combine
Genetic Engineering
Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein
Genetic Engineering
Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA
Grow bacteria…make more
growbacteria
harvest (purify)protein
transformedbacteria
plasmid
gene fromother organism
+
recombinantplasmid
vector
Why mix genes together?
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
Gene produces protein in different organism or different individual
aa aaaa aa aa aa aa aa aa aa
“new” protein from organismex: human insulin from bacteria
human insulin gene in bacteria
bacteria human insulin
How can bacteria read human DNA?
Bioethical Concerns for Genetic Engineering
Should we produce artificial proteins?
Allergic reactions (adding a peanut gene to a corn plant)
Environmental problems from creating transgenic organisms › (ex. Oil digesting bacteria)
GMO’s –What are they? GMO stands for
Genetically Modified Organisms
http://cls.casa.colostate.edu/transgeniccrops/animation.html
Before GMO’s cross-breeding was the answer
Flashcard Warm-upSteps in genetic Engineering/ Recombinant DNA
growbacteria
harvest (purify)protein
transformedbacteria
plasmid
gene fromother organism
+
recombinantplasmid
vector
Gene Therapy Defective genes are
identified and replaced with a functioning gene from another individual
Uses: replace missing of defective genes, Ex. Treating cystic fibrosis and hemophilia
Human Genome Project The Human Genome Project: is a
collaborative effort among scientists from around the world to map the genes of a human.› Uses: determine whether individuals may
carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines
Ticket out the Door1. Foreign DNA is spliced into what type of
organism?2. What is a most common use of
Recombinant DNA?3. Tobacco plant displays a bioluminescence
(glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly?
4. What was the purpose of the Human Genome Project?
Recombinant DNA Ticket IN the door.
1. Place the lettered steps in the correct order.
2. What organism usually acts as the host cell in the process of genetic engineering?
3. What is a plasmid? 4. What do hydrogen bonds hold together
in a DNA molecule?
C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin
D. The same restriction enzyme is used to cleave the vector
A. Foreign DNA and Vector spliced togetherB. The recombinant DNA is inserted into the host (bacteria cell).