33
Flashcard Warm-up Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy. My picture: My definition: Gel Electrophoresis Tool used to create a DNA fingerprint My picture: My definition:

Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Embed Size (px)

Citation preview

Page 1: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Flashcard Warm-up

Restriction enzymesEnzymes that will cut DNA at specific places.

This can be used to create DNA fingerprints or to insert genes through gene therapy.

My picture:My definition:

Gel ElectrophoresisTool used to create a DNA fingerprint

My picture:My definition:

Page 2: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Unit 9Biotechnology and Genomics

This is a DNA fingerprint.

This is NOT a DNA fingerprint.

Page 3: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

DNA Fingerprint A unique band pattern of DNA fragments. Unique to every individual, unless you

have an identical twin

Page 4: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

DNA Fingerprint

Gel Electrophoresis: › a tool used to

create a DNA fingerprint; separates pieces of DNA based on size (the number of

base pairs in each piece).

Page 5: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

DNA Fingerprint Steps in DNA Fingerprinting

› Step 1: Restriction enzyme cleaves specific DNA sequence

› Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases

› Cleave: to Cut

Page 6: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

DNA Fingerprinting Step 2: DNA loaded into a gel

electrophoresis.. Step 3: Bands are created as electricity

forces DNA fragments through the gel. Small pieces move further than larger pieces.

Page 7: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based on size

3

Stain DNA› ethidium bromide

binds to DNA› fluoresces under

UV light

Page 8: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

DNA Fingerprint Uses for DNA Fingerprinting:

› Violent Crimes – determines source of DNA left at a crime scene.

› Paternity - used to determine the father of a child

Page 9: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Uses: Evolutionary relationships

Comparing DNA samples from different organisms to measure evolutionary relationships

+

DNA

1 32 4 5 1 2 3 4 5

turtlesnakeratsquirrelfruitfly

Page 10: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Example

A DNA sample wasretrieved from a rape kit completed at the hospital. The policehave 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?

Page 11: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Ticket out the Door1. Why are restriction

enzymes important when making a DNA fingerprint?

2. What do the bands represent on a DNA fingerprint?

3. Using the fingerprint to the right who is a possible suspect for murder?

Page 12: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Flashcard Warm-up

Recombinant DNA/ Genetic

EngineeringTechnology that combines

DNA from two different organisms. One practical application of this process

is making human insulin for people with Diabetes.

Glo fish were the first genetically engineeredPet in 1993!A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmental toxins

Page 13: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Is the male in the fingerprint the father of the girl?

Page 14: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Can we mix genes from one creature to another?

YES!

Page 15: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

We have been manipulating DNA for generations!

Artificial breeding or AKA artificial selection› creating new breeds of animals & new crop plants to

improve our food› A process in which humans consciously select for or

against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature

Page 16: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

Page 17: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Most practical application of GENETIC ENGINEERING…

Creating Insulin (a protein hormone) for people with Diabetes

Page 18: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering Genetic Engineering: Modifications of DNA;

AKA Recombinant DNA› Transgenic Organism: an organism which

contains foreign DNA

A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.

Page 19: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering

Process in creating Transgenic organism:› Step 1: Restriction

enzymes cleave DNA sequence at desired gene (ex. Insulin

Page 20: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering Step 2 : The same

restriction enzyme is used to cleave the vector › Vector: The structure

used to carry the foreign DNA bacterial plasmids commonly used.

› Plasmid: Circular DNA found in bacteria

Page 21: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering Step 3: Foreign DNA and Vector spliced

together› Splice: Combine

Page 22: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering

Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein

Page 23: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Genetic Engineering

Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA

Page 24: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Page 25: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organismex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Page 26: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Bioethical Concerns for Genetic Engineering

Should we produce artificial proteins?

Allergic reactions (adding a peanut gene to a corn plant)

Environmental problems from creating transgenic organisms › (ex. Oil digesting bacteria)

Page 27: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

GMO’s –What are they? GMO stands for

Genetically Modified Organisms

http://cls.casa.colostate.edu/transgeniccrops/animation.html

Page 28: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Before GMO’s cross-breeding was the answer

Page 29: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Flashcard Warm-upSteps in genetic Engineering/ Recombinant DNA

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Page 30: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Gene Therapy Defective genes are

identified and replaced with a functioning gene from another individual

Uses: replace missing of defective genes, Ex. Treating cystic fibrosis and hemophilia

Page 31: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Human Genome Project The Human Genome Project: is a

collaborative effort among scientists from around the world to map the genes of a human.› Uses: determine whether individuals may

carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines

Page 32: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Ticket out the Door1. Foreign DNA is spliced into what type of

organism?2. What is a most common use of

Recombinant DNA?3. Tobacco plant displays a bioluminescence

(glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly?

4. What was the purpose of the Human Genome Project?

Page 33: Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy

Recombinant DNA Ticket IN the door.

1. Place the lettered steps in the correct order.

2. What organism usually acts as the host cell in the process of genetic engineering?

3. What is a plasmid? 4. What do hydrogen bonds hold together

in a DNA molecule?

C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin

D. The same restriction enzyme is used to cleave the vector

A. Foreign DNA and Vector spliced togetherB. The recombinant DNA is inserted into the host (bacteria cell).