Transcript
Page 1: Psyc 2301 chapter four powerpoint(2)

Chapter FourGenetics and Evolution

Page 2: Psyc 2301 chapter four powerpoint(2)

Exam One Results

• Your grade is posted on “My Grades” in e-campus

• Any questions???

Page 3: Psyc 2301 chapter four powerpoint(2)

Service Learning Opportunity

• Don’t forget that you can substitute one of your exam grades by participating in service learning

• Click on the “Service Learning” button in e-campus to learn more about getting enrolled

Page 4: Psyc 2301 chapter four powerpoint(2)

Natural Selection

Natural selection – introduced by Darwin in The Origin of Species in 1859

Features and the environment

Page 5: Psyc 2301 chapter four powerpoint(2)
Page 6: Psyc 2301 chapter four powerpoint(2)
Page 7: Psyc 2301 chapter four powerpoint(2)
Page 8: Psyc 2301 chapter four powerpoint(2)

Genetic Mechanisms Chromosomes, Genes, and DNA 30,000 genes

• http://youtu.be/uN82GLQYAUQ• Genes and environment Ques: Can you think of a disorder that may be affected by the environment for which you may have a genetic predisposition?

Page 9: Psyc 2301 chapter four powerpoint(2)

Skin pigmentation is one example of a continuous trait. (Nature vs. Nurture)

Page 10: Psyc 2301 chapter four powerpoint(2)

Two important terms...Phenotype: The outlook of an organism

Genotype: The genetic information written in DNA

ATGTTTCCACCTTCAGGTTCCACTGGGCTGATTCCCCCCTCCCACTTTCAAGCTCGGCCCCTTTCAACTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCAG

GCCAAGAATGGCTCCCACCTGGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA

Genotype

Phenotypes

Genotype

Page 11: Psyc 2301 chapter four powerpoint(2)

The Science of Sex Appeal VideoGroups: What factors make us attracted to others?

Get into groups and try to brainstorm at least 10 factors that affect attraction. What connections can be made to biological and environmental factors?

Smell• http://youtu.be/s_y8NTaPNQY

Facial Attractiveness• http://youtu.be/MVhKSzSpXMA

Walk• http://youtu.be/gwdlq95Tnqc

Page 12: Psyc 2301 chapter four powerpoint(2)

Mating PatternsDifferential parental investment theory Polygyny: One male with multiple females Polyandry: One female with multiple males

Monogamy: One male with one female Polygynandry: Multiple males with multiple

females

Page 13: Psyc 2301 chapter four powerpoint(2)

Color Blind Test

• Just a shortened form:

• http://colorvisiontesting.com/online%20test.htm

• An evolutionary advantage?

Page 14: Psyc 2301 chapter four powerpoint(2)

Genetic Mechanisms

Page 15: Psyc 2301 chapter four powerpoint(2)

Some of the reasons….• better health care (less serious illnesses that can delay or

damage brain development, less exposure to toxins such as lead, smog, food poisoning, etc.)

• better nutrition (better availability of fresh foods, proteins, fats, vitamins, minerals such as iron and iodine, etc. that are necessary to build and support the brain)

• higher levels of education

• higher cognitive stimulation by an increasingly complex environment

Page 16: Psyc 2301 chapter four powerpoint(2)

(Nature vs. Nurture Debate)

TWIN STUDIES Reared separately ~ Career choice, food preferences,

facial expressions, medical conditions, similar speech rhythms, etc.

Monozygotic (identical) ~ 80% concordance rate in their sense of happiness

Dizygotic (fraternal) ~ no concordance in their sense of happiness

Identical ~ if one has schizophrenia, the other has a 50% chance of developing the condition

Fraternal ~ 27% chance of developing the disorder

ADOPTION STUDIESIntelligence is more similar to their biological parents than

to their adoptive parents

Page 17: Psyc 2301 chapter four powerpoint(2)

Fallacies

Social Darwinism Deterministic fallacy

Page 18: Psyc 2301 chapter four powerpoint(2)

Homework• Read Chapter Five


Recommended