Upload
liz-vera
View
50
Download
0
Embed Size (px)
DESCRIPTION
Citation preview
Chapter FourGenetics and Evolution
Exam One Results
• Your grade is posted on “My Grades” in e-campus
• Any questions???
Service Learning Opportunity
• Don’t forget that you can substitute one of your exam grades by participating in service learning
• Click on the “Service Learning” button in e-campus to learn more about getting enrolled
Natural Selection
Natural selection – introduced by Darwin in The Origin of Species in 1859
Features and the environment
Genetic Mechanisms Chromosomes, Genes, and DNA 30,000 genes
• http://youtu.be/uN82GLQYAUQ• Genes and environment Ques: Can you think of a disorder that may be affected by the environment for which you may have a genetic predisposition?
Skin pigmentation is one example of a continuous trait. (Nature vs. Nurture)
Two important terms...Phenotype: The outlook of an organism
Genotype: The genetic information written in DNA
ATGTTTCCACCTTCAGGTTCCACTGGGCTGATTCCCCCCTCCCACTTTCAAGCTCGGCCCCTTTCAACTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCAG
GCCAAGAATGGCTCCCACCTGGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA
Genotype
Phenotypes
Genotype
The Science of Sex Appeal VideoGroups: What factors make us attracted to others?
Get into groups and try to brainstorm at least 10 factors that affect attraction. What connections can be made to biological and environmental factors?
Smell• http://youtu.be/s_y8NTaPNQY
Facial Attractiveness• http://youtu.be/MVhKSzSpXMA
Walk• http://youtu.be/gwdlq95Tnqc
Mating PatternsDifferential parental investment theory Polygyny: One male with multiple females Polyandry: One female with multiple males
Monogamy: One male with one female Polygynandry: Multiple males with multiple
females
Color Blind Test
• Just a shortened form:
• http://colorvisiontesting.com/online%20test.htm
• An evolutionary advantage?
Genetic Mechanisms
Some of the reasons….• better health care (less serious illnesses that can delay or
damage brain development, less exposure to toxins such as lead, smog, food poisoning, etc.)
• better nutrition (better availability of fresh foods, proteins, fats, vitamins, minerals such as iron and iodine, etc. that are necessary to build and support the brain)
• higher levels of education
• higher cognitive stimulation by an increasingly complex environment
(Nature vs. Nurture Debate)
TWIN STUDIES Reared separately ~ Career choice, food preferences,
facial expressions, medical conditions, similar speech rhythms, etc.
Monozygotic (identical) ~ 80% concordance rate in their sense of happiness
Dizygotic (fraternal) ~ no concordance in their sense of happiness
Identical ~ if one has schizophrenia, the other has a 50% chance of developing the condition
Fraternal ~ 27% chance of developing the disorder
ADOPTION STUDIESIntelligence is more similar to their biological parents than
to their adoptive parents
Fallacies
Social Darwinism Deterministic fallacy
Homework• Read Chapter Five