An indel polymorphism in the hybrid incompatibility gene Lethal hybrid rescue of Drosophila is functionally relevant
Shamoni Maheshwari and Daniel A. Barbash
Dept. of Molecular Biology and Genetics
Cornell University
Ithaca, NY 14853
U.S.A.
Correspondence to:
Dr. Daniel A Barbash
Dept. of Molecular Biology and Genetics
Cornell University
Ithaca, NY 14853
ph: 607-254-5208
fx: 607-255-6523
Abstract
Genetics: Published Articles Ahead of Print, published on August 3, 2012 as 10.1534/genetics.112.141952
Copyright 2012.
2
Hybrid incompatibility (HI) genes are frequently observed to be rapidly evolving
under selection. This observation has led to the attractive conjecture that selection-
derived protein-sequence divergence is culpable for incompatibilities in hybrids. The
Drosophila simulans HI gene Lethal hybrid rescue (Lhr) is an intriguing case, because
despite having experienced rapid sequence evolution, its HI properties are a shared
function inherited from the ancestral state. Using an unusual D. simulans Lhr hybrid
rescue allele, Lhr2, we here identify a conserved stretch of 10 amino acids in the C-
terminus of LHR that is critical for causing hybrid incompatibility. Altering these 10
amino acids weakens or abolishes the ability of Lhr to suppress the hybrid rescue
alleles Lhr1 or Hmr1, respectively. Besides single amino acid substitutions, Lhr
orthologs differ by a 16 amino acid indel polymorphism, with the ancestral deletion state
fixed in D. melanogaster and the derived insertion state at very high frequency in D.
simulans. Lhr2 is a rare D. simulans allele that has the ancestral deletion state of the 16
amino acid polymorphism. Through a series of transgenic constructs we demonstrate
that the ancestral deletion state contributes to the rescue activity of Lhr2. This indel is
thus a polymorphism that can affect the HI function of Lhr.
Introduction
What evolutionary forces drive speciation? A significant step towards answering
this question has been the identification of hybrid incompatibility (HI) genes, that is,
genes with “incompatible substitutions” that cause breakdown in interspecific hybrids.
The next challenge is describing the evolutionary basis for the origin of such
“incompatible substitutions”. The classic Dobzhansky-Muller (D-M) model elegantly
3
explains how substitutions incompatible only in an interspecific context can evolve,
however it is agnostic on the nature of the intraspecific evolutionary forces that cause
them (Maheshwari and Barbash, 2011; Presgraves, 2010). The model is equally
consistent with incompatible substitutions evolving as functionally neutral mutations
drifting to fixation or as functionally advantageous mutations being driven to fixation by
natural selection.
It is therefore particularly intriguing that so many HI genes show high rates of
sequence divergence driven by positive selection. If this divergence corresponds to the
“incompatible substitutions” then there is a direct link between the phenotype under
selection and HI. This is very likely for the hybrid sterility gene OdsH, where the
signature of selection is concentrated within the DNA binding homeodomain, because
functional analysis of OdsH orthologs has implicated divergent DNA-binding activity in
hybrid incompatibility (Bayes and Malik, 2009; Ting et al., 1998). However, such a direct
link between sequence divergence and function remains to be established for other
rapidly evolving HI genes.
The HI gene Lhr poses an interesting paradox. Lhr causes F1 hybrid male
lethality in crosses between Drosophila melanogaster and D. simulans (Brideau et al.,
2006; Watanabe, 1979). The classic D-M model describes HI as the negative ectopic
interaction between two derived loci, thus setting up the expectation that selection-
driven divergence of Lhr led to “incompatible substitutions” in one of the hybridizing
lineages. Surprisingly, however in transgenic assays Lhr orthologs from both hybridizing
species cause hybrid dysfunction (Brideau and Barbash, 2011; Maheshwari and
Barbash, 2012). This argues against the expectation that the hybrid lethal activity of Lhr
4
is solely the outcome of selection-driven substitutions in its protein coding sequence
(CDS) specific to D. simulans. Moreover, our recent results argue that the divergent
hybrid lethal activities of Lhr orthologs can be largely attributed to their asymmetric
expression in the hybrid background (Maheshwari and Barbash, 2012). The D. simulans
Lhr allele is expressed two-fold higher than the melanogaster ortholog in the F1 hybrid.
But it is still an open question whether divergence of the CDS might also be contributing
to the differential hybrid lethal effects of Lhr.
Lhr orthologs have ~50 fixed differences between D. melanogaster and D.
simulans scattered throughout a protein sequence of only ~330 residues. Additionally,
Lhr from each of the sibling species D. simulans, D. mauritiana and D. sechellia has a
16 amino acid (aa) insertion relative to the D. melanogaster ortholog. The insertion is
absent in outgroup species and is therefore identified as a derived state, specific to the
common ancestor of the sibling species. This 16 aa insertion is also interesting because
it may affect the structure of a predicted leucine zipper in the LHR protein, and had
been proposed as a candidate for mediating functional differences between the D.
melanogaster and D. simulans Lhr orthologs (Brideau et al., 2006).
The discovery of D. simulans Lhr2 motivated us to further explore the effect, if
any, of this 16 aa region on the hybrid lethal activity of Lhr orthologs. Lhr2 partially
suppresses hybrid male lethality, strongly suggesting that it is a loss-of-function allele.
Interestingly, Lhr2 lacks the 16 aa insertion found in most other D. simulans Lhr alleles.
However, the Lhr2 allele also has a complex deletion in its C-terminus within a
sequence of high conservation (Figure S1). Furthermore, it was not tested if Lhr2 is wild
type in expression level, which is critical because Lhr1 is strongly reduced in expression
5
(Brideau et al., 2006). Thus, even if the hybrid rescue property of the D. simulans Lhr2
strain is a function of the unusual CDS of the Lhr2 allele, it is unclear whether one or
both of the aforementioned 2 major mutations are responsible for its hybrid rescue
activity.
A population survey revealed that the ancestral non-insertion form is segregating
at a very low frequency in some D. simulans populations (Nolte et al., 2008). Nolte et.
al. (2008) tested 2 D. simulans strains in hybrid crosses that carried Lhr alleles lacking
the 16 aa insertion but wild type at the C-terminus. Neither of these strains produced
viable hybrid sons, leading them to conclude that the hybrid rescue property of the D.
simulans Lhr2 strain is not caused by the ancestral non-insertion form of the 16 aa
region, leaving the complex C-terminal mutation as the most likely candidate. However,
whether the presence or absence of this 16 aa region makes any contribution either to
functional differences between mel-Lhr and sim-Lhr, or to the hybrid rescue properties
of Lhr2, remains untested. Here we describe a series of transgenic assays to address
these questions.
Materials and Methods
Drosophila stocks and culturing: All crosses were done at room temperature
or at 18 ⁰C where explicitly stated. At least 2 replicates were done for each cross. Each
interspecific cross was initiated with ~15-20 1-day-old D. melanogaster virgin females
and ~30-40 3-4-day-old sibling-species males. Genetic markers, deficiencies, and
balancer chromosomes are described on FlyBase (McQuilton et al., 2012).
6
Nomenclature: The abbreviations mel-Lhr and sim-Lhr refer to the Lhr orthologs
from D. melanogaster and D. simulans, respectively. We refer generically to the 16 aa
region that is present in sim-Lhr and absent in mel-Lhr as the "16 aa indel". Because it
is a derived insertion in the D. simulans lineage but absent in the sim-Lhr2 allele, we
refer to it as the "16 aa deletion" in sim-Lhr2 and in mel-Lhr, and as the "16 aa insertion"
in sim-Lhr.
DNA constructs: PCR primers are listed in Table S1. To generate constructs for
transgenic experiments (Figure 1), first the wild type Lhr CDS in p{sim-Lhr} from
(Maheshwari and Barbash, 2012) was replaced by the Lhr2 CDS using a three-piece
fusion PCR strategy. The first and last PCR products, containing upstream and
downstream genomic regions, were amplified using p{sim-Lhr} as the template, with
primer pairs 691/938 and 941/664, respectively. The central PCR product containing the
Lhr2 CDS was amplified from D. simulans Lhr2 genomic DNA, with primer pair 939/940.
The three overlapping PCR products were then used as templates for the fusion PCR
using primers 691/664, cloned into the pCR-BluntII vector to create the plasmid p{sim-
Lhr2}, and sequenced completely.
A triple-HA tag in-frame with the C-terminus of Lhr2 CDS was synthesized using
a two-piece fusion PCR strategy. Two overlapping PCR products were amplified using
p{sim-Lhr2} as the template, with primer pairs 882/728 and 729/664. Fusion PCR was
then performed using these products as the templates with primers 882/664, and the
resulting product was TOPO cloned into the pCR-BluntII vector. This intermediate
construct was digested with SacII and ApaI and the fragment released was subcloned
7
into p{simLhr2}, generating p{sim-Lhr2-HA}. The full insert was sequenced completely
and subcloned into the MCS of pCasper4\attB using NotI and KpnI restriction enzymes.
To synthesize the construct p{sim-Lhr2-HA + 16aa}, the 16 aa insertion was
inserted into the Lhr2 CDS using a two-piece fusion PCR strategy. The two overlapping
PCR products were amplified using p{sim-Lhr2-HA} as the template, with primer pairs
691/945 and 946/664. These fragments were used as templates for the fusion PCR with
primers 691/664, and the gel-purified product was TOPO cloned into the pCR-BluntII
vector and sequenced completely. The insert was then subcloned into pCasper4\attB
exactly as in p{sim-Lhr2-HA}. The construction of p{sim-Lhr2-HA +Cter}, where the
complex mutation in the C-terminus mutation in Lhr2 CDS was replaced by 10 residues
of wild type D. simulans Lhr sequence, was done as above using primer pairs 691/942
and 943/664.
For yeast two-hybrid experiments the Lhr2 CDS was amplified from genomic DNA
using primer pair 404/405 and cloned into pENTR-DTOPO (Invitrogen) according to the
manufacturer’s instructions, and verified by sequencing. The entry vector was
recombined with the destination vectors in a standard LR Clonase (Invitrogen)-mediated
reaction. The destination vectors used were pGADT7-AD and pGBKT7-DNA-BD (K.
Ravi Ram, A. Garfinkel, and M.F.Wolfner, Cornell University; personal communication).
Transgenic fly lines: ɸC31-mediated transformants of D. melanogaster were
performed by Genetic Services. The integration site used was M{3xP3-RFP.attP}ZH-
86Fb at cytological position 86Fb (Bischof et al., 2007). Site-specificity of integrations
were tested using the PCR assays described in (Maheshwari and Barbash, 2012).
8
Recombination mapping of the D. simulans Lhr2 rescue activity: The D.
simulans Lhr2 rescue strain was outcrossed to the non-rescuing D. simulans v strain.
From this seven independent recombination lines were established by backcrossing 8-
10 F1 daughters to 8-10 males from the D. simulans v strain. Sons from this cross were
used to set up three hybrid crosses. Each hybrid cross was set up with approximately
30 recombinant sons, aged for 3 days, and 20 0-1 day old virgin D. melanogaster w1118
females. Individual viable F1 hybrid sons, which by definition inherit the mutation
responsible for rescue, were PCR genotyped for their Lhr alleles. In order to determine
if hybrid sons inherited the wild type Lhr or the Lhr2 allele from the D. simulans father,
we used primer pairs 409/410 to PCR across the 16 aa indel. If sons inherit wild type D.
simulans Lhr we expect to see two bands, the smaller band corresponding to the
ancestral state in D. melanogaster Lhr and the larger size corresponding to the insertion
in wild type D. simulans Lhr; however if they inherit the Lhr2 alelle, we expect to see
only one band corresponding to the ancestral state.
RT-PCR, immunofluorescence and yeast two-hybrid: RT-PCR and
immunofluorescence were performed as previously described (Maheshwari and
Barbash, 2012). Yeast two-hybrid assays were performed as in Brideau and Barbash
(2011).
Sequence and phylogenetic analyses: We examined Lhr sequences from a
recent large-scale resequencing of D. melanogaster populations and found all 158
strains contain the 16 aa deletion (Mackay et al., 2012). We also searched the short
read archive from this project, using as the query a 100 bp sequence from mel-Lhr
flanking the site of the 16 aa indel. All 26 traces from 454 sequencing fully matched the
9
query. In combination with our previous polymorphism sampling of mel-Lhr (Brideau et
al., 2006), we conclude that D. melanogaster is fixed for the deletion form of the 16 aa
indel. The phylogenetic tree was built by MEGA 5.05 using the maximum parsimony
method (Tamura et al., 2011). The Lhr alleles used for the analysis are published in
Brideau et. al. (2006). For phylogenetic analysis the region corresponding to the C-
terminal mutation in Lhr2 was excluded from the alignment.
Results
D. simulans Lhr2 is mutant in its coding sequence: A cross between wild type
D. melanogaster females and D. simulans males produces only sterile daughters and
no sons. The genetic basis of male lethality appears to be fixed between the two
species, as crosses between many different wild type strains fail to produce hybrid sons
(Lachaise et al., 1986; Sturtevant, 1920). The only two exceptions are strains with
mutations in D. melanogaster Hmr or D. simulans Lhr (Hutter and Ashburner, 1987;
Watanabe, 1979).
Although we and others implicitly assumed in previous analyses that rescue in
the D. simulans Lhr2 strain is due to its unusual Lhr allele, this point has not been
established (Brideau et al., 2006; Nolte et al., 2008). We therefore first did a crude
mapping experiment to test whether the hybrid rescue function is associated with the
Lhr2 locus. We outcrossed D. simulans Lhr2 to wild type D. simulans and tested for
linkage between the Lhr2 locus and hybrid rescue. We genotyped by PCR 48 viable
hybrid sons, which by definition have inherited the rescue locus, and found that all of
them also inherited the Lhr2 allele from the D. simulans parent. This pattern of co-
10
segregation supports the hypothesis that the Lhr2 allele is responsible for suppressing
hybrid male lethality instead of an unrelated mutation segregating in the same genetic
background.
We next sequenced 4 kb of genomic DNA spanning the Lhr2 locus and found
only several SNPs but no insertions, deletions or rearrangements in its non-coding
regions, suggesting that the Lhr2 allele is unlikely to be mutant in its expression. Using
quantitative RT-PCR we determined that Lhr expression in D. simulans Lhr2 is not
significantly different from wild type (t-test, P = 0.2) (Figure 2A), demonstrating that the
hybrid rescue property of D. simulans Lhr2 is different from the original rescue allele
Lhr1, which is an expression mutant having nearly undetectable levels of Lhr. The Lhr2
CDS is unusual in two respects (Figures 1, S1). First, Lhr2 lacks the 16aa insertion that
is present in frequencies near fixation in other sim-Lhr alleles. Second, Lhr2 has a
complex mutation in a conserved sequence near its C-terminus, which includes a 12 bp
in-frame deletion and non-synonymous mutations causing unique substitutions in 6
adjacent aa's.
Considering that the D. simulans Lhr2 allele contains the melanogaster-like
ancestral state at the 16aa indel, it raised the possibility that Lhr2 is a recent
introgression of D. melanogaster Lhr into D. simulans. This was rejected, however, by
phylogenetic analysis that firmly groups Lhr2 with alleles from the sibling species (Figure
2B). Interestingly, Lhr2 appears to be a relatively old allele that clusters separately from
other sim-Lhr alleles.
To test conclusively whether the coding sequence of the Lhr2 allele is defective
for hybrid lethal activity, we used a transgenic assay to compare it with wild type sim-
11
Lhr. We used the ɸC31 site-specific integration system to generate a D. melanogaster
strain carrying a D. simulans Lhr2 transgene at the attP86Fb site on the third
chromosome (Figure 1). The Lhr2 CDS was C-terminally tagged with HA and placed
under the control of wild type D. simulans regulatory sequences (from strain w501), to
generate the ɸ{sim-Lhr2-HA} construct.
Hybrid lethal activity was assayed using the D. simulans Lhr1 complementation
test (Maheshwari and Barbash, 2012). D. melanogaster mothers heterozygous for an
experimental or control transgene were crossed to D. simulans Lhr1 fathers, Lhr1 being
a loss-of-function mutation that acts as a dominant suppressor of HI. If the transgene
has hybrid lethal activity it is expected to suppress rescue by the Lhr1 mutation. In the
control cross with ɸ{sim-Lhr-HA} no hybrid sons inheriting the transgene were
recovered (Table 1 cross 1). This full suppression of rescue is consistent with our
previous results (Maheshwari and Barbash, 2012). In contrast, ɸ{sim-Lhr2-HA} only
partially suppressed rescue, with viability in the range of 35-40% relative to the control
class (Table 1 cross 2). This assay demonstrates that the Lhr2 CDS has significantly
reduced ability to cause HI but it is not a null allele. This conclusion is consistent with
the observation that D. simulans Lhr1 rescues more strongly than D. simulans Lhr2.
When crossed to D. melanogaster w1118 at room temperature the viability of hybrid
males with D. simulans Lhr1 is ~73% relative to hybrid females (51 F1 males and 70 F1
females), while with D. simulans Lhr2 it is ~49% (107 F1 males and 219 F1 females).
Lower levels of rescue with Lhr2 compared to Lhr1 were also observed in a previous
study (Barbash, 2010).
12
Assaying the function of the two major structural mutations in Lhr2: To
individually test the contribution of the complex C-terminal mutation and the 16aa
deletion to hybrid lethal activity, each was individually replaced in sim-Lhr2-HA with wild
type sequence to generate ɸ{sim-Lhr2-HA,+Cter} and ɸ{sim-Lhr2-HA,+16aa},
respectively (Figure 1). Initial experiments suggested that the presence or absence of
the C-terminal mutation has a much more significant impact on Lhr function compared
to the 16 aa indel. We therefore compared them to different references in our genetic
assays. For ɸ{sim-Lhr2-HA,+Cter}, where we reverted the C-terminal mutation to the
wild type sequence, we compared its activity to the wild type ɸ{sim-Lhr-HA} control and
found that it also fully suppresses rescue (Table 1, cross 3). This result demonstrates
that the conserved C-terminal region is essential for wild type Lhr function. Because
ɸ{sim-Lhr2-HA,+Cter} contains the ancestral deletion state of the 16 aa indel, this result
also demonstrates that the presence or absence of the 16 aa indel region in an
otherwise wild type sim-Lhr allele does not affect the ability of sim-Lhr to suppress
hybrid rescue by Lhr1.
For ɸ{sim-Lhr2-HA,+16aa}, where we added the 16 aa insertion to the Lhr2 allele,
a comparison to the construct ɸ{sim-Lhr2-HA} tests whether the 16 aa deletion has any
functional effect in the background of an allele that is partially impaired because it
carries the C-terminal deletion. In our Lhr1 complementation assay we detected a
significant difference in viability between the two genotypes of hybrid males (Table 1,
cross 2 vs. 4, two-tailed FET, P = 0.000). The relative viability of hybrid sons inheriting
ɸ{sim-Lhr2-HA,+16aa} was reduced to ~16% compared to ~35-41% for ɸ{sim-Lhr2-HA}.
13
This demonstrates that having the ancestral deletion state significantly contributes to
the hybrid rescue activity of Lhr2. This result thus shows that the polymorphic 16 aa
indel does affect Lhr function, at least in the presence of the second C-terminal
mutation.
In order to further explore the functional effects of the 16 aa indel, we turned to a
more sensitive genetic assay for Lhr function involving its interacting partner Hmr. We
have previously shown that in the background of the hypomorphic Hmr1 mutation, Lhr
orthologs exhibit significantly different degrees of hybrid lethality (Maheshwari and
Barbash, 2012). We therefore introduced each of our Lhr2 transgenes into an Hmr1
mutant background and tested the effect of the transgenes on hybrid male viability in
crosses to D. mauritiana (Table 2). D. mauritiana was chosen as the male parent
because in interspecific crosses between D. melanogaster females and sibling species
males, D. mauritiana hybrids show the highest viability (Hutter and Ashburner, 1987).
The crosses were also done at both room temperature and 18°C because hybrid
viability is temperature-dependent, with viability increasing at lower temperatures
(Hutter and Ashburner, 1987). Crosses with the wild type Lhr transgenes recapitulated
our previous experiments (Maheshwari and Barbash, 2012): Hmr1 hybrid sons carrying
sim-Lhr-HA were essentially inviable at room temperature while hybrid sons inheriting
mel-Lhr-HA had 32-44% viability (Table 2, crosses 1 and 2).
Surprisingly, hybrid sons carrying the ɸ{sim-Lhr2-HA} transgene were fully viable
at 18°C relative to their control brothers, and had substantially higher viability relative to
control brothers at room temperature (138.8-144.3%, Table 2, cross 3). Lhr2 is therefore
acting as a null allele or even an antimorph in this Hmr1 interaction assay. Reverting the
14
C-terminal mutation to the wild type sequence fully restored hybrid lethal effects to wild
type levels, with hybrid viability not significantly different than the wild-type ɸ{sim-Lhr-
HA} transgene (Table 2, cross 2 vs 4, two-tailed FET, P = 1.0 at both room temperature
and 18°C). These results demonstrate that the C-terminal region is critical for the strong
loss-of-function/antimorphic activity of Lhr2 in this assay.
We then compared the ɸ{sim-Lhr2-HA} allele to ɸ{sim-Lhr2-HA,+16aa}, which
differ only by the presence or absence of the 16 aa indel. We found that although hybrid
sons inheriting ɸ{sim-Lhr2-HA,+16aa} have viabilities comparable to the control class,
the relative viabilities of hybrid sons inheriting this transgene are less than that for the
ɸ{sim-Lhr2-HA} transgene. This reduction in viability is significant at 18°C (Table 2,
cross 3 vs. 5, two-tailed FET, P = 0.022). These results again show that the 16aa indel
does have a detectable effect on Lhr function in the background of the C-terminal
mutation.
The molecular properties of the LHR2 protein: We next asked whether the
LHR2 mutant protein is altered for molecular functions of LHR. LHR localizes to specific
regions of heterochromatin through interaction with Heterochromatin Protein1 (HP1)
(Brideau and Barbash, 2011; Brideau et al., 2006; Greil et al., 2007). We therefore
asked whether the reduced hybrid lethal activity of Lhr2 was reflecting a defect in
heterochromatin association. We performed yeast two-hybrid assays and found that the
interaction between LHR2 and HP1 was indistinguishable from the wild type control
(Figure 3A). Consistent with this result, LHR2-HA localized to heterochromatin in vivo
and immuno-FISH experiments showed co-localization with the dodeca satellite in a
manner indistinguishable from wild type LHR (Maheshwari and Barbash, 2012),
15
providing further support for wild type association with heterochromatin (Figure 3B). We
conclude that the reduced hybrid lethal activity of Lhr2 is not because localization to
heterochromatin is defective.
Discussion
The C-terminal mutation in Lhr2 identifies a region critical for Lhr function:
In this study we demonstrate conclusively that Lhr2 is a mutant allele of the Lhr hybrid
lethality gene and further show that its mutant properties are due to changes in its CDS.
Lhr2 is a weaker mutant allele than Lhr1 in its hybrid rescue ability and in transgenic
assays sim-Lhr2 complements Lhr1 more weakly than does a wild type sim-Lhr allele
(Table 1). By these criteria, Lhr2 would appear to be hypomorphic. In contrast, results
from the Hmr1 interaction assay suggest that Lhr2 has no wild type activity or is even
antimorphic (Table 2).
We therefore devised modified Lhr2 alleles to individually assay specific regions
for effects on hybrid lethal activity (Figure 1). We find that a highly conserved stretch of
10 residues in the C-terminus of Lhr is critical for wild type levels of hybrid lethal activity
in both genetic assays. This conclusion is consistent with the observations of Nolte et al.
(2008) who found wild type hybrid lethal activity for two D. simulans Lhr alleles that have
the deletion state for the 16 aa indel but are wild type for the C-terminal mutation.
Because this region is highly similar between mel-Lhr and sim-Lhr, this result also
supports published results that Lhr orthologs from both species can cause
incompatibility (Brideau and Barbash, 2011; Maheshwari and Barbash, 2012). Our data
here suggest that the C-terminal region is especially critical for interactions with Hmr
16
because ɸ{sim-Lhr2-HA} has no wild type activity for complementing Hmr1 (Table 2,
cross 3), but whether this reflects a direct physical interaction remains unknown. The
Lhr1 complementation assay is perhaps more straightforward to interpret since one is
asking whether different Lhr alleles complement a loss-of-function allele of Lhr. Since
only half of the hybrid sons inheriting the ɸ{sim-Lhr2-HA} transgene are viable (Table 1
cross 2), it is clear that the C-terminal deletion does not fully account for the hybrid
lethal activity of wild type Lhr. Therefore additional regions of the LHR protein must also
contribute to its incompatibility properties.
An effect of the 16aa indel polymorphism on hybrid lethal activity was excluded
by Nolte et al. (2008) using a population survey. They tested two D. simulans lines that
retain the ancestral state of lacking the 16aa insertion, but neither of them rescued
hybrid sons. However, in the transgenic assay we find a significant difference in hybrid
lethal activity of the Lhr2 allele with and without the insertion (Table 1 cross 2 vs. cross
4). We also detected a significant difference in the Hmr1 interaction assay (Table 2,
cross 3 vs. cross 5). The lack of any phenotypic effects observed by Nolte et al. (2008)
is most likely because the effect of the 16aa indel is revealed only in a sensitized
background. In this transgenic assay the C-terminal mutation in Lhr2 lowers the lethal
activity of Lhr, providing us with the sensitivity to assess the contribution of the 16aa
deletion.
Differential hybrid lethal activity of Lhr orthologs: coding or regulatory? Lhr
has strongly asymmetric effects on hybrid viability, as mutations in sim-Lhr but not mel-
Lhr produce viable hybrids (Brideau et al. 2006). This finding led to the hypothesis that
the hybrid lethal activity of Lhr is due to coding sequence divergence that is specific to
17
the D. simulans lineage. Surprisingly, we subsequently found that hybrid lethal activity is
an ancestral property shared by the coding sequences of both Lhr orthologs (Brideau
and Barbash, 2011; Maheshwari and Barbash, 2012). The different hybrid rescue
effects of Lhr orthologs instead appear to be largely the consequence of divergent gene
regulation that causes sim-Lhr to be expressed more highly in hybrids than mel-Lhr
(Maheshwari and Barbash, 2012). Our results here are consistent with these findings.
First, we have identified the site of the C-terminal mutation in Lhr2 as critical for HI.
Since this region is nearly identical between D. melanogaster and the sibling species, it
was likely present in the ancestral Lhr allele. Second, our previous transgenic
comparisons of mel-Lhr and sim-Lhr alleles did not exclude the possibility that coding
sequence divergence may make some contribution to functional divergence. Our finding
here that the 16aa indel has a functional effect, but is only detectable on the
background of the C terminal deletion, is indicative that coding sequence divergence
makes a small contribution to differences in the hybrid lethal activity of Lhr. Interestingly
though, since this difference between mel-Lhr and sim-Lhr is an indel it does not
contribute to the signature of adaptive evolution discovered for Lhr (Brideau et al. 2006).
Rigorous identification of incompatible substitutions has only been attempted for
yeast interstrain and interspecific HI genes. Single amino-acid changes have been
identified in each of two interacting genes that cause a defect in mismatch repair (Heck
et al., 2006). In the case of AEP2, a translation factor that causes mito-nuclear
incompatibility between S. cerevisiae and S. bayanus, it was narrowed down to multiple
mutations within a region of 148 aa's. In the case of MRS1, a splicing factor that also
causes mito-nuclear incompatibility between the same two yeast species it was pared
18
down to only 3 non-synonymous substitutions (Chou et al., 2010; Lee et al., 2008).
There is no evidence of selection acting on either of these latter two HI genes and both
have experienced relatively limited sequence divergence. There are at least 6 HI genes
known that are rapidly diverging under selection (Maheshwari and Barbash, 2011;
Presgraves, 2010). Although it is implicitly assumed that this divergence is the basis of
HI, this hypothesis remains largely unexamined.
Functional effects of indels and polymorphisms. While indels are a common
type of sequence variation, they are rarely considered in evolutionary studies. The
reason for this is that their origins and functional consequences are poorly understood.
Analysis of indels within protein sequences supports the view that they affect protein-
folding, and computational analysis of high-throughput protein interaction data sets
suggests that indels modify protein interaction interfaces, thereby significantly rewiring
the interaction networks (Hormozdiari et al., 2009; Zhang et al., 2011). Moreover,
studies comparing patterns of evolution of Catsper1, a sperm-specific calcium channel,
found evidence of positive selection for elevated rates of indel substitutions within its
intracellular domain across multiple primate and rodent species (Podlaha and Zhang,
2003; Podlaha et al., 2005). The authors suggest that the selection for indels might be a
consequence of their effect on the regulation of the Catsper1 channel, which can affect
sperm motility, an important determinant in sperm competition.
Large structural polymorphisms are not unique to Lhr; other HI genes such as
Hmr and Prdm9 have multiple in-frame indels, as does the segregation distorter
RanGAP (Maheshwari et al., 2008; Oliver et al., 2009; Presgraves, 2007). So far the
primary focus of evolutionary analysis has been single amino-acid substitutions, and
19
indel variation has been largely ignored in the assessment of functional divergence.
Recent high throughput analyses on human tissues has catalogued the occurrence of
coding indels in hundreds of conserved and essential genes as well as in protein
isoforms via alternative splicing, thus highlighting indels as an abundant source of
structural variation (Mills et al., 2011; Wang et al., 2008). Our characterization of an
indel polymorphism in Lhr presents one functional argument supporting the prediction
that coding indels play an important evolutionary role. The low frequency of the deletion
state of the 16aa indel in D. simulans and its monomorphic state in D. melanogaster do
not suggest an obvious role for selection in maintaining it. Our experiments here
nevertheless demonstrate that this indel does affect Lhr function.
Acknowledgments
We thank Greg Smaldone and Shuqing Ji for help scoring flies, and Tawny
Cuykendall, Heather Flores, P. Satyaki, Michael Nachman, and the anonymous
reviewers for helpful comments on the manuscript. Supported by NIH Grant
2R01GM074737.
20
Literature Cited
Barbash, D. A., 2010 Genetic testing of the hypothesis that hybrid male lethality results from a failure in dosage compensation. Genetics 184: 313-‐316.
Bayes, J. J., and H. S. Malik, 2009 Altered heterochromatin binding by a hybrid sterility protein in Drosophila sibling species. Science 326: 1538-‐1541.
Bischof, J., R. K. Maeda, M. Hediger, F. Karch, and K. Basler, 2007 An optimized transgenesis system for Drosophila using germ-‐line-‐specific phiC31 integrases. Proc Natl Acad Sci U S A 104: 3312-‐3317.
Brideau, N. J., and D. A. Barbash, 2011 Functional conservation of the Drosophila hybrid incompatibility gene Lhr. BMC Evol Biol 11: 57.
Brideau, N. J., H. A. Flores, J. Wang, S. Maheshwari, X. Wang, et al., 2006 Two Dobzhansky-‐Muller genes interact to cause hybrid lethality in Drosophila. Science 314: 1292-‐1295.
Chou, J. -‐Y., Y. -‐S. Hung, K. -‐H. Lin, H. -‐Y. Lee, and J. -‐Y. Leu, 2010 Multiple molecular mechanisms cause reproductive isolation between three yeast species. PLoS Biol 8: e1000432.
Greil, F., E. de Wit, H. J. Bussemaker, and B. van Steensel, 2007 HP1 controls genomic targeting of four novel heterochromatin proteins in Drosophila. EMBO J 26: 741-‐751.
Heck, J. A., J. L. Argueso, Z. Gemici, R. G. Reeves, A. Bernard, et al., 2006 Negative epistasis between natural variants of the Saccharomyces cerevisiae MLH1 and PMS1 genes results in a defect in mismatch repair. Proc Natl Acad Sci U S A 103: 3256-‐3261.
Hormozdiari, F., R. Salari, M. Hsing, A. Schönhuth, S. K. Chan, et al., 2009 The effect of insertions and deletions on wirings in protein-‐protein interaction networks: a large-‐scale study. J Comput Biol 16: 159-‐167.
Hutter, P., and M. Ashburner, 1987 Genetic rescue of inviable hybrids between Drosophila melanogaster and its sibling species. Nature 327: 331-‐333.
Ioerger, T. R., A. G. Clark, and T. H. Kao, 1990 Polymorphism at the self-‐incompatibility locus in Solanaceae predates speciation. Proc Natl Acad Sci U S A 87: 9732-‐9735.
Lachaise, D., J. R. David, F. Lemeunier, L. Tsacas, and M. Ashburner, 1986 The reproductive relationships of Drosophila sechellia with D. mauritiana, D. simulans, and D. melanogaster from the Afrotropical region. Evolution 40: 262-‐271.
Lee, H. -‐Y., J. -‐Y. Chou, L. Cheong, N. -‐H. Chang, S. -‐Y. Yang, et al., 2008 Incompatibility of nuclear and mitochondrial genomes causes hybrid sterility between two yeast species. Cell 135: 1065-‐1073.
Mackay, T. F. C., S. Richards, E. A. Stone, A. Barbadilla, J. F. Ayroles, et al., 2012 The Drosophila melanogaster Genetic Reference Panel. Nature 482: 173-‐178.
21
Maheshwari, S., and D. A. Barbash, 2011 The genetics of hybrid incompatibilities. Annu Rev Genet 45: 331-‐355.
Maheshwari, S., and D. A. Barbash, 2012 Cis-‐by-‐Trans regulatory divergence causes the asymmetric lethal effects of an ancestral hybrid incompatibility gene. PLoS Genet 8: e1002597.
Maheshwari, S., J. Wang, and D. A. Barbash, 2008 Recurrent positive selection of the Drosophila hybrid incompatibility gene Hmr. Mol Biol Evol 25: 2421-‐2430.
McQuilton, P., S. E. St Pierre, J. Thurmond, and FlyBase Consortium, 2012 FlyBase 101-‐-‐the basics of navigating FlyBase. Nucleic Acids Res 40: D706-‐D714.
Mills, R. E., W. S. Pittard, J. M. Mullaney, U. Farooq, T. H. Creasy, et al., 2011 Natural genetic variation caused by small insertions and deletions in the human genome. Genome Res 21: 830-‐839.
Nolte, V., D. Weigel, and C. Schlötterer, 2008 The impact of shared ancestral variation on hybrid male lethality-‐-‐a 16 codon indel in the Drosophila simulans Lhr gene. J Evol Biol 21: 551-‐555.
Oliver, P. L., L. Goodstadt, J. J. Bayes, Z. Birtle, K. C. Roach, et al., 2009 Accelerated evolution of the Prdm9 speciation gene across diverse metazoan taxa. PLoS Genet 5: e1000753.
Podlaha, O., and J. Zhang, 2003 Positive selection on protein-‐length in the evolution of a primate sperm ion channel. Proc Natl Acad Sci U S A 100: 12241-‐12246.
Podlaha, O., D. M. Webb, P. K. Tucker, and J. Zhang, 2005 Positive selection for indel substitutions in the rodent sperm protein catsper1. Mol Biol Evol 22: 1845-‐1852.
Presgraves, D. C., 2007 Does genetic conflict drive rapid molecular evolution of nuclear transport genes in Drosophila? Bioessays 29: 386-‐391.
Presgraves, D. C., 2010 The molecular evolutionary basis of species formation. Nat Rev Genet 11: 175-‐180.
Sturtevant, A. H., 1920 Genetic studies on Drosophila simulans. I. Introduction. Hybrids with Drosophila melanogaster. Genetics 5: 488-‐500.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, et al., 2011 MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731-‐2739.
Ting, C. T., S. C. Tsaur, M. L. Wu, and C. I. Wu, 1998 A rapidly evolving homeobox at the site of a hybrid sterility gene. Science 282: 1501-‐1504.
Wang, E. T., R. Sandberg, S. Luo, I. Khrebtukova, L. Zhang, et al., 2008 Alternative isoform regulation in human tissue transcriptomes. Nature 456: 470-‐476.
22
Watanabe, T. K., 1979 A gene that rescues the lethal hybrids between Drosophila melanogaster and D. simulans. Jpn. J. Genet 54: 325-‐331.
Zhang, Z., J. Huang, Z. Wang, L. Wang, and P. Gao, 2011 Impact of indels on the flanking regions in structural domains. Mol Biol Evol 28: 291-‐301.
23
Fig. 1. A schematic of the Lhr2 constructs. The mel-Lhr-HA and sim-Lhr-HA
constructs are described in (Maheshwari and Barbash, 2012). All other constructs
contain the full sim-Lhr2 coding sequences fused to the HA epitope tag (green) with the
UTRs and genomic DNA from the D. simulans w501 strain. The white boxes represent
the 16 aa indel and C-terminal mutations. Triangles represent replacement of Lhr2 CDS
with sequence from wild type D. simulans Lhr.
Fig. 2. The Lhr2 allele is not an expression mutant or a D. melanogaster
introgression. (A) Quantitative RT-PCR analysis comparing Lhr expression in D.
simulans Lhr2 with D. melanogaster w1118 and D. simulans v strains, both of which are
Lhr+. RNA was isolated from 6-10 hr old embryos. Lhr abundance was measured
relative to rpl32. Expression levels were normalized by setting D. melanogaster w1118
strain to 1. Error bars represent standard error among biological replicates, n≥3. (B) The
evolutionary history of Lhr2 in the melanogaster subgroup was inferred using the
Maximum Parsimony method. The arrowhead indicates the branch on which the 16 aa
insertion originated. The percentage of replicate trees in which the associated taxa
clustered together in the bootstrap test (500 replicates) are shown next to the branches.
Bootstrap values are not shown for the terminal nodes within the D. melanogaster and
D. simulans clades.
Fig. 3. The sim-LHR2 protein interacts with HP1 and localizes to
heterochromatin. (A) Interaction with HP1. Wild type D. simulans LHR was used as a
positive control. Yeast two-hybrid interactions were detected by activation of HIS3 and
growth on media lacking histidine; loading controls [complete media (CM) -Leu -Trp]
contain histidine. (B) Localization of sim-LHR2-HA to heterochromatin in D.
24
melanogaster cycle 12-14 embryos. Top, sim-LHR2-HA was detected with anti-HA
(green) and localizes to apical heterochromatin, detected by TOPRO3 staining (red) of
DNA at the embryo surface. Bottom, immuno-FISH experiment with anti-HA (green)
detecting sim-LHR2-HA in interphase nuclei. LHR2-HA shows no overlap with the 359
bp (red) satellite but partially co-localizes with the dodeca satellite (blue).
Fig. S1. Alignment of D. simulans Lhr2 protein sequence with wild type orthologs.
The 16 aa indel polymorphism and C-terminal mutations are underlined.
25
Table 1: Testing the two major mutations in Lhr2 for suppression of hybrid rescue by D.
simulans Lhr1.
Cro
sses were between D. melanogaster females heterozygous for the different transgenes
(genotype w; φ{ }/+) and D. simulans Lhr1 males. The transgenes carried a copy of the
No. of hybrid males
Cross
Transgenic
construct
No. of
hybrid
females
Genotype 1
+/Lhr1; +/+
Genotype 2
+/Lhr1;φ{ }/+
Relative
viability of
φ{ } males
(%)
1 φ{sim-Lhr-HA} 135 74 0 0
2 φ{sim-Lhr2-HA} 494 226 80 35.4
308 185 75 40.54
3 φ{sim-Lhr2-
HA+Cter}
269 175 0 0
187 104 0 0
4 φ{sim-Lhr2-
HA+16aa}
337 178 28 15.73
224 164 26 15.85
26
w+ gene so the hybrid sons inheriting the transgene, +/Lhr1; φ{ }/+ (genotype 2) were
distinguished from their +/Lhr1; +/+ siblings (genotype 1) by their eye-color. All crosses
were carried out at room temperature. Relative viability is the ratio of the number of
hybrid sons inheriting the transgene (genotype 2) compared to the control class
(genotype 1).
27
Table 2: Testing the two major mutations in Lhr2 for suppression of hybrid rescue by D. melanogaster Hmr1.
Transgenic construct Temp.
No. of hybrid females
No. of hybrid males Relative viability of φ{ } males (%)
Genotype 1 Hmr1/Y; +/+
Genotype 2
Hmr1/Y; φ{ }/+
1 φ{mel-Lhr-HA} RT 446 78 25 32.1
RT 324 67 30 44.8
18 °C 462 184 127 69.0
18 °C 689 265 140 52.8
2 φ{sim-Lhr-HA} RT 305 55 1 1.8
RT 180 35 0 0.0
18 °C 692 283 90 31.8
18 °C 504 198 111 56.1
3 φ{sim-Lhr2-HA} RT 354 79 114 144.3
RT 361 80 111 138.8
18 °C 782 264 283 107.2
18 °C 742 253 250 98.8
4 φ{sim-Lhr2-HA+Cter}
RT 226 47 1 2.1
RT 382 59 0 0.0
18 °C 561 236 106 44.9
18 °C 393 197 74 37.6
5 φ{sim-Lhr2-HA+16aa }
RT 86 32 34 106.3
RT 182 52 57 109.6
18 °C 538 253 214 84.6
18 °C 373 191 155 81.2
28
The different Lhr transgenes were tested for interaction with an Hmr hypomorphic allele,
Hmr1. D. melanogaster w Hmr1 v; ɸ{transgene, w+}/+ females were mated to D.
mauritiana Iso105 males. Hybrid male progeny that inherit the transgene are orange
eyed (genotype 2), while the sibling brothers are white eyed (genotype 1). Relative
viability is the ratio of the number of hybrid sons inheriting the transgene compared to
the control class.
29
Table S1: Primers used in the Materials and Methods.
No. Sequence Capitalized
region
405 caccatgagtaccgacagcgccgaggaa
405 tcatgttctcagcgtaggccg
409 gtagctttctcttggcgctctt
410 gtaagtgaactgaagctgcgttgg
664 tcgcatAAGCTTctggcaggtggtaaccgatacgg HindIII
691 tactatAAGCTTtggttgttccacacgactttatcg HindIII
728
TGCATAGTCCGGGACGTCATAGGGATAGCCCGCA
TAGTCAGGAACATCGTATGGGTACATtgttctcagcgtag
gccg
3xHA tag
729
CCCTATGACGTCCCGGACTATGCAGGATCCTATC
CATATGACGTTCCAGATTACGCTtgactttctttcgtataaaa
tgc
3xHA tag
882 tgtcgcccgcggaacgtcgcc
938 cgtttcctcggcgctgtcggtactcat
939 atgagtaccgacagcgccgaggaaacg
30
940 tcatgttctcagcgtaggccgcctgg
941 ccaggcggcctacgctgagaacatga
942 ccaTTATAGCTTATTCTTTTATTGGCACTTGctacgttgg
gtcttatgttgcg Cter fill-in
943 CAAGTGCCAATAAAAGAATAAGCTATAAtggtgttagca
atgaatcaaatgatgtc Cter fill-in
945 GATTTGCAATTTGTGTACATCGTTCATCTCCCGCC
ACAGAGGTTCAGTgatttgccctttggcagccgc 16aa fill-in
946 ACTGAACCTCTGTGGCGGGAGATGAACGATGTAC
ACAAATTGCAAATCcctgaacctctgtttcgggtg 16aa fill-in
φ{sim-Lhr2-HA + Cter}
9 aa
φ{sim-Lhr2-HA +16aa}
16 aa
φ{sim-Lhr2-HA}Cter mut16 aa deletion
Lhr2
φ{mel-Lhr-HA}16 aa deletion
Lhr
Lhrφ{sim-Lhr-HA}
Fig. 1
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Lhr e
xpre
ssio
n le
vel
A B
Fig. 2
D. melanogaster D. simulans D. simulans Lhr2
D. simulans
1s
12s
5s
2s
11s
3s
9s
4s
8s
6s
10s
D. sechellia
D. mauritianaD. simulans Lhr2
D. melanogaster
3m
10m
4m
6m
5m
1m
12m
11m
8m
9m
2m
7m
99
6178
38
D. yakuba