Chapter V.
Isolation and characterization of
Listeria
124
5.1 Introduction
Listeria monocytogenes, a cause of listeriosis, is a worldwide zoonotic
pathogen. All members of the genus Listeria are widely distributed in nature
and have been isolated from soil, vegetation, sewage, water, animal feed, fresh
and frozen meat, slaughterhouse wastes and the faeces of healthy animals.
Thus, farm animals and their environment may present an important source of
food contamination and infections for humans (Jemmi and Stephen, 2006;
Swaminathan and Gerner-Scmidt, 2007). The genus-Listeria has two
pathogenic species namely, L. monocytogenes and L. ivanovii. Listeriosis is a
high-risk disease for pregnant women and vulnerable ages of life and primarily
causes abortion, septicaemia or infections of the central nervous system
(Rebagliati et al., 2009). It causes listeriosis in humans characterized by
invasive and non-invasive illness associated with high mortality (20–30%) and
has a propensity to cause severe problems especially in pregnant women,
neonates, the elderly, and immunosuppressed individuals (Vlaemynck et al.,
2000; Liu, 2006).
The public health importance of listeriosis is not always recognized,
particularly since listeriosis is a relatively rare disease compared with other
common foodborne illnesses such as salmonellosis or botulism. However,
because of its high case fatality rate, listeriosis ranks among the most frequent
causes of death due to foodborne illness: second after salmonellosis (Rossi et
al., 2008). It is responsible for the highest hospitalisation rates (91%) amongst
known food-borne pathogens and has also been linked to sporadic episodes
and large outbreaks of human illness worldwide (Jemmi and Stephen, 2006).
Epidemiological data from different countries show that the majority of human
125
outbreaks are associated with three L. monocytogenes serotypes (1/2a, 1/2b and
4b).
The contamination of food by L. monocytogenes occurs along the food
chain from farm-to-fork (Farber and Peterkin, 1991). The ability to persist in
food-processing environments and multiply under refrigeration temperatures
makes L. monocytogenes a significant threat to public health. L.
monocytogenes contamination is one of the leading microbiological causes of
food recalls, mainly of meat, poultry, seafood and dairy products. Prevention
and control measures are based on hazard analysis and critical control point
programmes throughout the food industry, and on specific recommendations
for high-risk groups (Jemmi and Stephen, 2006). Products such as raw milk,
soft cheese produced from raw milk, raw meat products and salads are
frequently implicated in the literature (Johansson et al., 1999; Kathariou, 2002;
Barbuddhe et al., 2011). Cross-contamination, which can occur within the
environment of food-processing equipment, is considered to be a possible
source of Listeria contamination in processed food. Listeria monocytogenes is
able to attach to and survive on various working contact surfaces. One reason
may be its ability to form biofilms (Wong, 1998; Borucki et al., 2003).
Globally, the cases of human listeriosis are on increase which is evident
from the major outbreaks recorded in various countries. The first proof that
milk products could be responsible for listeriosis outbreaks was corroborated
by Fleming et al. (1985) which involved 49 cases, seven of them in the fetus or
in infants and 42 in immunocompromised adults. In major foodborne
outbreaks of listeriosis recorded world over, the vehicle of transmission has
been suggested to be a wide range of foods including vegetables (lettuce,
126
celery and tomatoes) (Ho et al., 1986), Coleslaw (Schlech et al., 1983),
pasteurized milk (Flemming et al., 1985), Mexican style cheese (Linnan et al.,
1988), raw milk cheese (Goulet et al., 1995), liver pates (Kittson, 1992), pork
tongue in aspic (Goulet et al., 1993) and Rillettes i.e. pork pate (Goulet, 1995).
Listeriosis outbreaks have mostly been linked to consumption of raw milk or
cheese made of unpasteurized milk (Fleming et al., 1985; Linnan et al., 1988;
Lyytikainen et al., 2000; Rebagliati et al., 2009). Changes in the manner food
is produced, distributed and stored have created the potential for widespread
outbreaks involving many countries. Incorrect milk pasteurization and its
subsequent contamination are the most possible explanations for the presence
of pathogens in pasteurized milk. Some of the milk borne bacteria from cows
with bovine mastitis may survive the pasteurization and replicate at
refrigeration temperatures. When cattle are infected with L. monocytogenes,
the organism is excreted in the milk. L. monocytogenes is quite resistant to
heat and milk's post-pasteurization storage at a refrigeration temperature might
allow the selective growth of the remaining organisms (Dalton et al., 1997).
Extensive work has been ongoing in many countries during the last decade to
prevent outbreaks and decrease the incidence of listeriosis (Rossi et al., 2008).
The availability of subtyping procedures to track individual strains
involved in listeriosis outbreaks, and to examine the epidemiology and
population genetics of Listeria monocytogenes bacteria is integral to control
and prevention programs aimed at limiting listeriosis (Barbuddhe et al., 2008).
Serotyping may potentially be useful for tracking L. monocytogenes strains
involved in disease outbreaks. Indeed, it has been observed that L.
monocytogenes serotypes 1/2a, 1/2b, and 4b are responsible for 98% of
127
documented human listeriosis cases, whereas serotypes 4a and 4c are rarely
associated with outbreaks of the disease (Wiedmann et al., 1996; Jacquet et al.,
2002). The development of PCR-based serotyping procedures has provided
additional tools for the identification and grouping of L. monocytogenes
(Borucki and Call, 2003; Doumith et al., 2004).
India, the largest producer of milk in the world, also has the highest
number of cattle in the world. In India, the first documentation of isolation of
L. monocytogenes from an animal dates back to 1950 when it was recovered
from an infected sheep in Madras (Vishwanathan and Ayyar, 1950).
Subsequently, it was reported from other animals (Nigam et al., 1999; Malik et
al., 2002; Shakuntala et al., 2006) and from foods (Karunasagar and
Karunasagar, 2000; Barbuddhe, et al., 2002; Kalorey et al., 2008; Barbuddhe
et al., 2011). However, studies on raw milk samples collected at different
levels of collection and processing for L. monocytogenes are largely lacking.
Since the dairy processing industry in India is growing rapidly as in the
developed world, milk borne outbreaks of listeriosis cannot be ruled out. The
association of L. monocytogenes with raw and pasteurized milk, dairy farms
and processing plants contributes to the potential threat of listeriosis.
Human listeriosis is a public health problem of low incidence but high
mortality, requiring prompt diagnosis and adequate antibiotic therapy.
Antibiotic resistance and inefficient empirical treatment of Listeria infections
could be responsible for this increased mortality (Rodas-Sua´rez et al., 2006).
Review of literature published on the prevalence of bacterial foodborne
pathogens in milk and in the dairy environment supports the model in which
the presence of pathogens depends on ingestion of contaminated feed followed
128
by amplification in bovine hosts and fecal dissemination in the farm
environment. The final outcome of this cycle is a constantly maintained
reservoir of foodborne pathogens that can reach humans by direct contact,
ingestion of raw contaminated milk or cheese, or contamination during the
processing of milk products.
In view of the above, the attempt to isolate the pathogenic Listeria
species from milk collected at different levels will reveal the risk of this
foodborne pathogen of public health significance. The unorganized sectors of
India have rarely been analyzed to see the occurrence of this important
pathogen. This chapter deals with the studies on occurrence of pathogenic
Listeria in raw bovine milk with an ultimate aim to ascertain whether the
population in this region is really at risk for listeriosis. The present study also
aimed to use various methods for rapid, economical and reliable detection of
pathogenic L. monocytogenes strains isolated from milk employing in vitro
tests viz., hemolysis on SBA, PI-PLC assay, chromogenic ALOA medium and
PCR targeting virulent associated gene, hlyA gene encoding listeriolysin O
(LLO). The genotypic characterization of L. monocytogenes isolates that were
recovered from milk at different levels of collection was carried out utilizing
PFGE in combination with multiplex serotyping PCR assay to study the
genetic diversity exhibited by these isolates.
5.2 Material and Methods
5.2.1 Bacteria
The standard strains of Listeria monocytogenes (MTCC 657 /NCTC
7973 /ATCC 19111), Listeria monocytogenes (MTCC 1143 /NCTC 11994),
129
Staphylococcus aureus (MTCC 1144), Rhodococcus equi (MTCC 1135) were
obtained from microbial type culture collection and gene bank (MTCC),
Institute of Microbial Technology (IMTECH), Chandigarh, India. Twenty
strains of L. monocytogenes isolated from milk and milk products from Indian
Listeria Culture Collection available at ICAR Research Complex for Goa, Old
Goa were also included in the study. The reference strains of Listeria ivanovii
(NCTC 11846) and L. seeligeri (NCTC 11856) were procured form Division
of Veterinary Public Health, Indian Veterinary Research Institute, Izatnagar.
The strains were tested for their morphological, biochemical and
cultural characteristics. Subsequently, the strains of L. monocytogenes were
tested for their pathogenicity by in vitro tests. Finally, the strains of L.
monocytogenes, L. ivanovii, and S. aureus were tested for their
phosphatidylinositol specific phospholipase-C (PI-PLC) activity by overlay
assay as per the method of Notermans et al. (1991a).
5.2.2 Samples
The details of samples processed are given in section 3.2. A total of 767
milk samples from dairy cows were taken at different levels of collection and
processing (udder, from milking utensils/cans, dairy cooperative society,
receiving dock and market) and were processed for isolation of Listeria.
5.2.3 Isolation
Isolation of Listeria from the milk samples was attempted as per the US
Department of Agriculture (USDA) method described by McClain and Lee
(1988) after making necessary modifications.
130
5.2.3.1 Enrichment
About 10 ml of milk sample was directly inoculated into 90 ml of
University of Vermont Medium-1 (UVM-1) and incubated overnight at 300C.
The enriched UVM-1 inoculum (0.1 ml) was then transferred to UVM-2
medium and again incubated overnight at 300C.
5.2.3.2 Plating on Selective media
The enriched inoculum from UVM-2 was streaked on polymixin acriflavin
lithium chloride ceftazidime aesculin mannitol (PALCAM) agar (Himedia
Labs, Mumbai, India). The inoculated plates were incubated at 370C for 24 –
48 h. Grey green colonies with black sunken centers from PALCAM were
suspected to be of Listeria. The presumed colonies of Listeria (at least 3/plate)
were subcultured for further confirmation.
5.2.4 Confirmation of Isolates
5.2.4.1 Biochemical characterization
From the isolation media, suspected colonies of Listeria were
subcultured on 5% sheep blood agar. Morphologically typical colonies were
verified by Gram’s staining, catalase reaction, tumbling motility at 25OC,
methyl red-Voges Proskauer (MR-VP) reactions, CAMP test with
Staphylococcus aureus and Rhodococcus equi, nitrate reduction, fermentation
of sugars (rhamnose, xylose, mannitol and α-methyl- D-mannopyranoside) and
hemolysis.
131
5.3.2.3 Hemolysis on Sheep Blood Agar
All the Listeria isolates that were confirmed using biochemical tests
were analyzed for the type of hemolysis on Sheep blood agar (SBA) as per the
method described by Seeliger and Jones (1986). The isolates were streaked
onto 5% SBA plates and incubated at 37oC for 24 h and examined for
haemolytic zones around the colonies. The characteristic β-haemolysis in the
form of wider and clear zone of haemolysis represented L. ivanovii while, a
narrow zone of β-haemolysis was the characteristic of L. monocytogenes.
5.2.3.4 Christie-Atkins-Munch-Peterson (CAMP) test
All the presumptive Listeria isolates were tested by Christie-Atkins-
Munch-Peterson (CAMP) test as per the method of BIS (1994). Briefly, the
standard strains of Staphylococcus aureus and Rhodococcus equi grown in
BHI broth for 18 h were streaked on sheep blood agar (SBA) plates having 7%
sheep blood in a manner that these were wide apart and parallel to each other.
The test cultures were streaked parallel to one another, but at right angles to
and between the S. aureus and R. equi streaks. After incubation at 370C for 24-
48 h, the plates were examined for hemolysis. L. monocytogenes hemolytic
reactions were enhanced in the zone influenced by the S. aureus streak. The
other species remained non-hemolytic.
5.2.4.2 ALOA assay
Agar Listeria according to Ottaviani and Agosti (ALOA) assay, an
alternative way to assess PI-PLC activity was carried out using Chromogenic
media, ALOA which helped to differentiate pathogenic Listeria spp. (Ottaviani
132
et al., 1997). The biochemically characterized 81 Listeria isolates were assayed
for PI-PLC activity on chromogenic ALOA (Hi-media, Mumbai, India) media.
In brief, the Listeria isolates were grown overnight onto SBA plates at 370C.
The growth of each Listeria isolate harvested from SBA plate was spot
inoculated on ALOA plates. On this medium, all the Listeria species form
bluish green colonies due to the presence of a chromogenic compound X-
glucoside which detects β-glucosidase present in all Listeria species. Typical
colonies of L. monocytogenes in ALOA agar are green-blue, surrounded by an
opaque halo.
5.2.4 Detection of Virulence gene of Listeria
The primers for detection of the hemolysin gene (hlyA) of L.
monocytogenes used in this study were synthesized by Sigma Aldrich, USA.
The primers employed were, forward 5’-GCA GTT GCA AGC GCT TGG
AGT GAA-3’ and reverse 5’-GCA ACG TAT CCT CCA GAG TGA TCG-3’
(Paziak-Domanska et al., 1999). The PCR was standardized for the detection
of the hlyA gene of L. monocytogenes as per the method described (Notermans
et al., 1991) with suitable modifications. In brief, the standard strain of
pathogenic L. monocytogenes (MTCC 1143) was grown overnight in brain
heart infusion broth at 370C. The genomic DNA of all the isolates was
extracted using bacterial DNA extraction kit (Chromous Biotech, Bangalore,
India). The obtained DNA was used as a template in PCR reaction mixture.
Based on optimization trials, the standardized PCR protocol for 50 μl
reaction mixture included 10X PCR buffer (100 mM Tris–HCl buffer, pH 8.3
containing 500 mM KCl, 15 mM MgCl2 and 0.01% gelatin), 0.2 mM dNTP
133
mix, 2 mM MgCl2 and 0.1μM of a primer set containing forward and reverse
primers, one unit of Taq DNA polymerase, 5 μl of DNA template and
sterilized milliQ water to make up the reaction volume. Positive and negative
controls were included in each of the PCR run. The DNA amplification
reaction was performed in Mastercycler epGradient (Eppendorf, Germany)
with a preheated lid. The cycling conditions for PCR included an initial
denaturation of DNA at 950C for 2 min followed by 35 cycles each of 15 s
denaturation at 950C, 30 s annealing at 600C and 1 min 30 s extension at 720C,
followed by a final extension of 10 min at 720C and hold at 40C. The resultant
PCR products were further analyzed by agarose gel electrophoresis, stained
with ethidium bromide (0.5μg/ml) and visualized by a UV transilluminator
(Alphaimager, USA).
5.2.5 Serotyping
Somatic (O) and flagellar (H) antigen-based serotyping was performed
using commercially prepared antisera (Denka Seiken Co., Tokyo, Japan).
Determination of the O-antigen was carried out with heat inactivated bacteria
using the slide agglutination method and that of H-antigen was carried out with
liquid bacterial cultures in a test tube, according to the manufacturer's
instructions.
5.2.6 Serotyping by multiplex PCR (mPCR)
The genomic DNA of all the isolates was extracted using bacterial
DNA extraction kit (Chromous Biotech, Bangalore, India) and were subjected
to mPCR based serotyping (Doumith et al., 2004). The five primer sets for
134
target fragments from genes lmo0737, lmo1118, ORF2819, ORF2110 and prs
were synthesized by Sigma Aldrich, USA. The details of primers used in the
study are given in Table 5.1. The mPCR serotyping was standardized as per
the methodology described by Doumith et al. (2004). Fifty microliter reaction
mixtures were prepared each containing 2 units Taq DNA Polymerase, 10x
PCR Buffer (50 mM TriseHCl, 10 mM KCl, 50 mM Ammonium Sulfate, 2
mM MgCl2), 300 mM dNTP mix, 2 mM MgCl2, 2 mM each of primer
lmo0737, ORF2819, ORF2110 and prs and 10 mg/ml of DNA template. PCR
was performed in Master Cycler Gradient Thermocycler (Eppendorf,
Germany) having a pre-heated lid with an initial denaturation step at 940C for 5
min, 35 cycles of 940C for 30 s, 540C for 1 min 15 s, and 720C for 1 min 15 s,
and one final cycle of 720C for 10 min in thermocycler. Samples were held at
40C until electrophoresis. Eight microliter of PCR product was separated by
electrophoresis in 1.5% agarose gel stained by ethidium bromide.
Table 5.1 Primer sequences for L. monocytogenes used in Multiplex-PCR
serotyping.
Target gene Primer sequence Product size (bp)
lmo0737 Forward 5’-AGGGCTTCAAGGACTTACCC-3’ 691
Reverse 5’-ACGATTTCTGCTTGCCATTC-3’
lmo1118 Forward 5’-AGGGGTCTTAAATCCTGGAA-3’ 906
Reverse 5’-CGGCTTGTTCGGCATACTTA-3’
ORF2819 Forward 5’-AGCAAAATGCCAAAACTCGT -3’ 471
Reverse 5’- CATCACTAAAGCCTCCCATTG-3’
ORF2110 Forward 5’- AGTGGACAATTGATTGGTGAA -3’ 597
Reverse 5- CATCCATCCCTTACTTTGGAC -3’
prs Forward 5’- GCTGAAGAGATTGCGAAAGAAG-3’ 370
Reverse 5’- CAAAGAAACCTTGGATTTGCGG-3’
135
5.2.7 Pulsed field gel electrophoresis analysis
Thirty six Listeria isolates were subjected to PFGE analysis to cover
different sampling areas and different species. PFGE was performed according
to the CDC PulseNet standardized procedure (Graves and Swaminathan, 2001)
used for typing L. monocytogenes by using the CHEF-DRII apparatus (Bio-
Rad Laboratories, Hercules, USA).
5.2.7.1 Preparation of culture
Bacteria were grown on brain heart infusion agar plates at 370C for 16–
18 h. Cells were removed from the plate to plastic tubes containing 3 ml of TE
using a sterile cotton swab and the cell density adjusted to OD 0.79 to 0.81.
The standardized cell suspension (240 μl) was transferred to 1.5 ml
microcentrifuge tubes. Sixty microliters of 10 mg/ml lysozyme solution
(Sigma, St. Louis, MO) was added and mixed with the cells by pipetting up
and down. The mixture was incubated in a waterbath at 370C for 10 min.
5.2.7.2 Casting of Plugs
An equal volume of molten 1.2% PFGE grade agarose, 1% sodium
dodecyl sulfate, 0.2 mg/ml Proteinase K (Sigma, St. Louis, MO) (SSP)
prepared in sterile distilled water and maintained at 53–560C was added to the
cell suspension and mixed by gently pipetting up and down several times. The
mixture (600 μl) was dispensed into two forms (300 μl each) of a sample
reusable plug mold (Bio-Rad, Hercules, CA) and allowed to cool for 5 min.
136
5.2.7.3 Lysis of Cells in Agarose Plugs
The agarose plugs were transferred to 50 ml polypropylene conical
tubes containing 4 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, pH
8.0, 1% sodium lauryl sarcosine, 0.15 mg/ml Proteinase K), incubated for 2 h
at 50–540C in an orbital water bath shaker and shaking at 200 rpm. After
proteolysis, the lysis buffer solution was removed and the plugs were washed
twice with 15 ml of preheated (50–540C) sterile distilled water for 10 min each
followed by four washes with 15 ml of preheated (50–540C) TE buffer for 15
min each in the orbital water bath shaker (50–540C) at 200 rpm.
After the final TE wash, the plugs were sliced (2–2.5 mm slices) using
a Gel-Cutting Fixture and prepared for restriction digestion or stored in 1.5 ml
TE at 40C until ready for restriction.
5.2.7.4 Restriction digestion of agarose plugs
Sample plugs were digested with 25 U of AscI (Fermentas, USA) at
370C for 3 h or 160-200 U of ApaI (New England Biolabs) at 300C for 5 h.
5.2.7.5 Casting Agarose Gel
The gel casting tray was assembled and the comb was fitted. 1%
agarose in 1X TE buffer was prepared and poured when it was 450C into the
gel casting tray and allowed to solidify. Electrophoresis was performed in a
1% agarose gel (in 0.5X Tris-borate EDTA buffer). The agarose gel was
loaded into the electrophoresis chamber containing 2000 ml of 0.5X buffer.
The following electrophoresis conditions were used: voltage, 6 V; initial
137
switch time, 4.0 s; final switch time 40 s; runtime 22 h. Lambda ladder (New
England Biolabs, Beverly, MA) was loaded on the gel.
5.2.7.6 Staining and Documentation of PFGE Agarose Gel
After electrophoresis, the gel was stained for 30 min in 400 ml of 0.5x
TBE containing 25 ml (10 mg/ml) of ethidium bromide and destained by two
washes of 20 to 30 min each using 400 ml of deionized water and
photographed with Alpha Imager. The generated PFGE patterns were analyzed
using the Gel Compare II (Applied Maths) software. The pattern clustering
was performed by the unweighted-pair group algorithm and the Dice
correlation coefficient with a tolerance of 1%. The results of the clustering
analysis were confirmed by visual comparison of the PFGE profiles. A
similarity coefficient of 60% was selected to define the pulsed field type
clusters.
5.2.8 Antibiotic sensitivity
Listeria monocytogenes isolates were tested for their susceptibility to
antimicrobial agents by the standard Kirby- Bauer disc diffusion method
following National Committee for Clinical Laboratory Standards (NCCLS)
guidelines, 1997. Listeria monocytogenes (MTCC 1143) was used as the
reference strain and Escherichia coli (MTCC 443) as the control strain. Also,
L. monocytogenes ATCC 19114, Escherichia coli ATCC 29922, and
Staphylococcus aureus MTCC 1144 strains were used as controls in all assays.
All the 37 L. monocytogenes isolates were grown in BHI broth
overnight at 370C. The culture suspension was adjusted to 0.5 McFarland
138
Standard (approximately 1.5 x 108 cells). Within 15 minutes after adjusting the
turbidity of the inoculum suspension, a sterile cotton swab was dipped into the
adjusted suspension. The swab was rotated several times, pressing firmly on
the inner wall of the tube above the fluid level to remove excess inoculum
from the swab. Mueller-Hinton Agar (Hi-media) supplemented with 5% sterile
defibrinated Sheep Blood was used as medium to study the susceptibility to
antibiotics. Commercially available disks (Hi-Media) with the following
antibiotics were used: Tetracycline (30µg/disc), Ciprofloxacin (30µg/disc),
Vancomycin (30µg/disc), Chloramphenicol (30µg/disc), Linezolid (30µg/disc),
Meropenem (10µg/disc), Penicillin (10µg/disc), Gentamycin (10µg/disc),
Trimethoprim (25µg/disc) and Ampicillin (25µg/disc).
5.3 Results and discussion
A total of 767 milk samples collected from dairy cows, collection
centres, receiving dock and market milk were examined for Listeria spp.
throughout the four-year sampling period using two step enrichment followed
by streaking on selective agar. The grey green colonies with black sunken
centers from PALCAM (Fig 5.1), Gram-positive, coccobacillary forms with
characteristic tumbling motility at 20 to 250C were further characterized
biochemically and tested for their pathogenicity. Overall, 10.56% of the
samples (81 of 767) were positive for Listeria species. The catalase positivity
and oxidase negativity was observed in all the 81 isolates.
On further testing, 37 isolates produced acid from rhamnose and α-
methyl D-mannopyranoside but not from xylose, and therefore, were
tentatively designated as L. monocytogenes.
139
On streaking of 81 confirmed Listeria isolates onto SBA (7%), a
varying degree of haemolysis was observed (Fig 5.2). Unlike a typical β-
haemolysis with broad and clear zones exhibited by the isolate of L. ivanovii,
the degree of haemolysis shown by L. monocytogenes isolates was moderate.
A total of 38 isolates showed haemolysis.
On testing of 81 Listeria isolates from milk by CAMP test, 37 L.
monocytogenes isolates showed characteristic enhancement of haemolytic zone
with Staphylococcus aureus while the one L. ivanovii isolate showed enhanced
haemolytic zone typically against Rhodococcus equi (Table 5.2, Fig. 5.3). The
CAMP test, therefore, confirmed the results of biochemical characterization of
L. monocytogenes and L. ivanovii isolates. The enzymatic activity expressed
by L. monocytogenes isolates on ALOA agar was reckoned as high (with 8-9
mm zones), moderate (with 5-6 mm zones) and low (with >4 mm zone) in case
of 11, 18 and 8 isolates, respectively. The only isolate of L. ivanovii showed a
low enzymatic activity. Out of the 81 isolates of Listeria, 38 isolates were
haemolytic, CAMP positive, and exhibited halo formation on ALOA (Fig 5.4).
Based on the biochemical and pathogenicity profiles, 37 isolates were
confirmed as L. monocytogenes (Table 5.2). The prevalence of L.
monocytogenes was worked out to be 4.82%. Other Listeria species confirmed
were L. innocua (5.47%), L. ivanovii (0.13%) and L. grayi (0.13%) (Table
5.3).
The prevalence of L. monocytogenes reported in the present work from
the bovine raw milk samples is less than that reported by Bhilegaonkar et al.
(1997) as 8.1% of the 86 raw milk samples tested in Northern India.
Barbuddhe et al. (2002) reported 6.25% and 26.13% prevalence of L.
140
Fig 5.3. L. monocytogenes
showing positive CAMP
test.
141
Fig 5.1. Colonies of Listeria species on PALCAM agar.
Fig 5.2. L. monocytogenes isolates showing haemolysis Fig 5.4. L. monocytogenes on sheep blood agar isolates showing positive PI-PLC activity on ALOA agar.
monocytogenes and Listeria spp., respectively in 64 raw buffalo milk sampled in Northern
India. In a larger survey (2060 samples) in Central India, Kalorey et al (2008) reported L.
monocytogenes from 5.1% raw milk samples. The incidence of contaminated milk samples
varies among countries, being 1.2% in Denmark of 1,132,958 raw milk samples (Jensen et
al., 1996), 3.62% in Spain
Table 5.2. Biochemical and pathogenicity profiles of pathogenic Listeria isolates.
Isolate
No.
Biochemical profile Pathogenicity profile
Sugar fermentation
Species
identified
In-vitro tests Serogroup
Xyl
ose
Rha
mno
se
α- m
ethy
l
D-m
anno
pyr
anno
side
CAMP
with
S/R
Haemolysis
on SBA
PI-
PLC
Assay
hlyA
gene
LM5 - + + Lm +S + + + 1/2a,3a,3c
LM11 - + + Lm +S ++ +++ + 1/2a,3a,3c
LM12 - + + Lm +S + + + 1/2a,3a,3c
LM13 - + + Lm +S ++ +++ + 1/2a,3a,3c
LM14 - + + Lm +S + + + 1/2a,3a,3c
LM15 - + + Lm +S + ++ + 1/2b,3b
LM19 - + + Lm +S ++ ++ + 1/2a,3a,3c
LM21 - + + Lm +S + ++ + 1/2a,3a,3c
LM22 - + + Lm +S + + + 1/2a,3a,3c
LM23 - + + Lm +S ++ ++ + 1/2a,3a,3c
142
LM24 - + + Lm +S + + + 1/2a,3a,3c
LM25 - + + Lm +S + + + 1/2a,3a,3c
LM26 - + + Lm +S + + + 1/2a,3a,3c
LM28 - + + Lm +S + + + 1/2a,3a,3c
LM31 - + + Lm +S + + + 1/2a,3a,3c
LM39 - + + Lm +S + + + 1/2a,3a,3c
LM40 - + + Lm +S + + + 4b,4d,4e
LM41 - + + Lm +S + + + 1/2a,3a,3c
LM42 - + + Lm +S + + + 1/2a,3a,3c
LM45 - + + Lm +S + + + 1/2a,3a,3c
LM723 + - - Li +R +++ + + -
LM54 - + + Lm +S + + + 4b,4d,4e
LM55 - + + Lm +S + + + 1/2b,3b
LM56 - + + Lm +S + + + 1/2b,3b
LM378 - + + Lm +S ++ +++ + 1/2b,3b
LM381 - + + Lm +S + + + 1/2b,3b
LM453 - + + Lm +S ++ +++ + 1/2a,3a,3c
143
144
LM481 - + + Lm +S + + + 1/2b,3b
LM492 - + + Lm +S + ++ + 1/2a,3a,3c
LM501 - + + Lm +S ++ ++ + 1/2a,3a,3c
LM511 - + + Lm +S + ++ + 1/2b,3b
LM568 - + + Lm +S + + + 1/2a,3a,3c
LM574 - + + Lm +S ++ ++ + 1/2a,3a,3c
LM584 - + + Lm +S + + + 1/2a,3a,3c
LM588 - + + Lm +S + + + 1/2a,3a,3c
LM591 - + + Lm +S + + + 1/2a,3a,3c
LM734 - + + Lm +S + + + 1/2b,3b
LM760 - + + Lm +S + + + 1/2a,3a,3c
CAMP : Christie, Atkins, Munch- Petersen test
+S : Enhanced zone of haemolysis with Staphylococcus aureus Lm : Listeria monocytogenes
+R : Enhanced zone of haemolysis with Rhodococcus equi Li : Listeria ivnovii
PI-PLC : Phosphatidylinositol-specific phospholipase-C SBA : Sheep blood agar V
of 774 samples (Gaya, et al., 1998) and 3.48% as calculated by Ryser and
Marth (1991) in the USA. In a study in UK, the incidence of Listeria from
milk processing equipments was found to be 18.8% (6.3% L. monocytogenes),
while in the environment and raw milk was 54.7% (40.6% L. monocytogenes)
and 44.4% (22.2% L. monocytogenes), respectively (Kells and Gilmour, 2004).
The variation in the number of Listeria spp. from different studies carried out
could also be due to the diverse isolation and enumeration methods. The ability
of L. monocytogenes to grow at low temperatures is important in the
bacterium’s persistence in food processing environments. Further biofilms
forming abilities (Di Bonaventura et al., 2008) and sanitizer resistance
(Lunden et al., 2003) contribute to the persistence of L. monocytogenes in food
processing environments.
In the present study, maximum isolates were recovered from samples
collected from market (Table 5.3) followed by samples at the milk processing
unit.
Table 5.3. Isolation of Listeria at different levels of collection and processing.
Level No. of Lm Lin Liva Lg
Samples
Udder 126 3 8 0 0
Milk cans 126 5 4 0 0
Milk receiving 126 3 5 0 0
centres
Processing unit 269 10 19 1 0
Market 120 16 6 0 1
Total 767 37 42 1 1
145
The foodborne pathogens in raw milk originate from the farm
environment and direct excretion from animals’ infected udder and poor silage
quality, whereas, in dairy plants the pathogens may enter via contaminated raw
milk, colonize the dairy plant environment and consequently contaminate dairy
products. Important sources of contamination during the handling and
processing might be the workers as well (Bemrah et al., 1998; Kousta et al.,
2010). Listeria shed in the faeces (Van Kessel et al., 2004). The prolonged
excretion of the organism in milk, the apparently normal appearance of the
milk in majority cases and the consumption of raw milk, especially on farms,
could be important factors in the transmission and epidemiology of Listeria
infection. We believe that the sources of contamination of Listeria spp. in raw
milk are probably insufficient hygiene during milking so also storage and
transport of milk. L. monocytogenes may directly contaminate milk as a
consequence of listerial mastitis, encephalitis or Listeria related abortion in
cattle. Rawool et al. (2007) reported overall occurrence of L. monocytogenes in
0.55% of 243 cattle and buffaloes with subclinical mastitis in India.
Haemolysis, CAMP test, PI-PLC assay and PCR besides biochemical
confirmation for characterization of the isolates were employed in the present
study. The confirmation methods employed here seems to be adequate. Among
the virulence genes of Listeria, the hlyA gene has been used most commonly
for confirmation of the isolates (Aznar and Alarcón, 2002). All the isolates
were subjected to PCR assay for amplification of the hlyA gene. It allowed
amplification of the hlyA gene of L. monocytogenes to its respective 456 bp
product represented by a single band in the corresponding region of the DNA
marker ladder (Fig 5.5). Out of 81 Listeria isolates the hlyA gene was detected
146
in 37 isolates. All other Listeria spp. isolates were negative in PCR analysis.
Conventional culture-based methods are labour intensive and time consuming.
Based on the results, it can be concluded that detection of PI-PLC activity by
ALOA simultaneously with PCR targeting hlyA gene can be used for detecting
the pathogenic strains of L. monocytogenes.
1 2 3 4 5 6 7 8 9 10 M
456 bp
Fig 5.5. Amplification of the hlyA gene in Listeria monocyotgenes isolates.
Lane 1: Negative control; Lanes 2-9: Listeria monocytogenes isolates;
Lane 10: Listeria monocytogenes MTCC 1143.
Serotyping
Typing of L. monocytogenes is important in epidemiological studies for
investigation of foodborne outbreaks (i.e. comparing clinical and food
isolates), and in the food-processing environment, to identify the source or
sources of contamination and routes of dissemination. A rapid multiplex-PCR
serotyping assay has been developed which separated the four major L.
monocytogenes serovars into distinct groups (Doumith et al., 2004). The
performance of this assay was evaluated through a multicenter typing study
(Doumith et al., 2005). This assay was employed in the present investigation to
serotype L. monocytogenes isolates recovered from milk. The profiles of
147
148
multiplex-PCR serotyping of standard Listeria strains (Fig 5.6) and L.
monocytogenes isolates recovered from milk are depicted in Table 5.4. Out of
37 L. monocytogenes isolates, a larger proportion of isolates (26) belonged to
the group corresponding to serovars 1/2a, 1/2c, 3a, and 3c. Serogroup
corresponding to serovars 4b, 4d and 4e was detected in two strains while
serogroup 1/2b, 3b, 4b, 4d, and 4e was detected in nine strains (Table 5.2; 5.4).
Using conventional serotyping, the isolates were assigned to serotypes 1/ 2a
(26), 1/2b (9) and 4b (2). Our data showed that most of the isolates belonged to
1/2a, which was considered as a sporadic cause for human listeriosis (Liu,
2006). Studies have found that serotype 1 ⁄ 2a was the predominant serotype of
L. monocytogenes food and environmental isolates (Lukinmaa et al. 2003;
Gilbreth et al. 2005; Corcoran et al. 2006). Serotyping of 196 L.
monocytogenes isolates from food sources revealed 3 serovars with 1/2a to be
dominant serovar presented by 94.4% of the isolates (Rivoal et al., 2010).
Serotyping of 145 L. monocytogenes isolates from foods and food processing
environments revealed serovar 1/2a to be the most frequent (57.4%) serovar
(O’Connor et al., 2010). Our earlier studies indicated predominance of L.
monocytogenes serotype 4b in human clinical isolates (Kalekar et al., 2011)
and 1/2a in isolates from milk processing environments (Doijad et al., 2011).
The observation indicates the potential of milk and milk products to serve as
vehicles of transmission of virulent L. monocytogenes. Serotyping of L.
monocytogenes isolates using conventional and PCR methods revealed
serotypes 1/2a, 1/2b, and 4b to the extent of 78% of the typeable strains (Fox et
al., 2009). The strains were isolated from the dairy farm environment and in
particular the milking facility.
Table 5.4. Serotypes of L. monocytogenes isolates recovered from milk.
Strains Serotype No of strains
Standard NCTC 11994 4b, 4d, 4e 1
Standard MTCC 1143 4b, 4d, 4e 1
L. monocytogenes 4b, 4d, 4e 2
L. monocytogenes 1/2b, 3b, 4b, 4d, 4e 9
L. monocytogenes 1/2a, 1/2c, 3a, 3c. 26
Fig 5.6. Serotype profile of Listeria species by multiplex-PCR serotyping Lanes 1-5
L. monocytogenes isolates, Lane 6 – L. monocytogenes, 4b (NCTC 11994), Lane 7-
L. innocua, Lane 8 – Negative control, M – DNA ladder
149
PFGE
Multiplex PCR and PFGE analysis are currently used by several public and
private laboratories for serogrouping and subtyping L. monocytogenes. PFGE is
considered the gold standard method for subtyping foodborne pathogens, because
of its high discriminatory power and reproducibility. Thirty six Listeria isolates
were subjected to PFGE analysis to cover different sampling areas and different
species.
PFGE discriminated the L. monocytogenes isolates into 5 ApaI and 4 AscI
PFGE patterns (pulsotypes) at 80% similarity, but could differentiate serovars
within MPCR serogroups, in which isolates from different serovars displaying the
same pulsotype were found (Figs 5.7; 5.8 and 5.9).
Dendrogram analysis showed that PFGE yielded a good binary division into
genetic lineages I (serotypes 1/2b, 3b, 4b, and 4e) and II (serotypes 1/2a, 1/2c, 3a
and 3c) a result that is consistent with previous studies (Gilbreth et al., 2005;
Nadon et al., 2001) and further confirm that these two lineages represent distinct
subgroups. Our data also showed that there was a nearly complete correlation
between pulsotypes and serotypes with identical PFGE patterns belonged to the
same serotype.
A total of 25 L. monocytogenes isolates recovered from milk and milk
products at different places in India were subjected to PFGE (Fig 5.10). The
isolates originated from different geographic regions. All isolates were investigated
by multiplex PCR, allowing serovar predictions and DNA macrorestriction patterns
were determined by pulsed field gel electrophoresis (PFGE) employing ApaI and
150
AscI enzymes. A larger proportion of isolates belonged to PCR group
corresponding to serovars 4b, 4d and 4e (92.68%). PCR group corresponding to
serovars 1/2a and 3a was detected in three strains. DNA macrorestriction pattern
analysis of PCR groups showed that isolates had a very low diversity. PFGE
analysis of isolates showed that the profiles constitute a homogeneous population.
Isolates showed just two pulsotypes. In spite of the fact that the isolates were
completely independent, the distribution of L. monocytogenes genotypes was
relatively homogeneous, suggesting the existence of resident strains.
Fig 5.7. Dendrogram of Listeria monocytogenes isolates obtained from milk samples with ApaI digestion
151
Fig 5.8. Dendrogram of Listeria monocytogenes isolates with AscI digestion.
152
Fig 5.9. AscI and ApaI profiles of selected Listeria monocytogenes isolates.
M 1 2 3 4 5 6 7 8 9 10 11 12 M 13 14 15 16 17 18 19 20 21 22 23 24 25 M
AscI ApaI
Fig 5.10. PFGE analysis of Listeria monocytogenes strains isolated from milk and milk products at different locations in India. The cultures were maintained under Indian Listeria Culture Collection. Lanes M: Lambda DNA marker, Lanes 1 to 22 isolates of L. monocytogenes
153
The application of PFGE in the characterization of L. monocytogenes
isolated from the food can provide a valuable insight into the presence of endemic
strains and can provide valuable information on potential sites of cross-
contamination. Epidemiological tracking of strains over a period of time is required
to enable more precise identification of sites of cross-contamination, or critical
control points, and to enable to take some measures to avoid of the persistence of
individual strains within the processing environment.
Antibiotic sensitivity
The first emergence of multi resistant strains of L. monocytogenes has been
reported in France (Poyart-Salmeron et al. 1990). L. monocytogenes is widely
susceptible to clinically relevant classes of antibiotics active against Gram-positive
bacteria, with the exception of natural in vitro resistance to older quinolones,
fosfomycin, and expanded-spectrum cephalosporins, (Troxler et al., 2000). The
treatment of choice is currently based on a synergistic association of high doses of
amino-penicillin (ampicillin or amoxicillin) and gentamicin (Temple and Nahata,
2000; Hof, 2004). Rifampin, vancomycin, linezolid, and carbapenems have been
proposed as possible alternatives, trimethoprim is generally used in case of
intolerance of beta-lactams (Temple and Nahata, 2000; Hof, 2004). The importance
of continuous monitoring of environmental, food and clinical Listeria isolates for
antibiotic resistance is emphasized by the slow and gradual emergence of
antimicrobial-resistant strains.
154
Results of disc diffusion assay were recorded as per the guidelines of
NCCLS, 1997. All the 37 L. monocytogenes isolates were subjected to antibiotic
sensitivity testing using disc diffusion method. Seven antibiotics, tetracycline,
ciprofloxacin, chloramphenicol, linezolid, meropenem, gentamycin, and
trimethoprim exhibited complete sensitivity (Table, 5.5; Fig 5.11). However, the
isolates showed variable resistance against ampicillin (16.21%), vancomycin
(21.62%) and penicillin (43.24%). L. monocytogenes rarely develops acquired
resistance to antibiotics. However, some studies have recently reported an increased
rate of resistance to one or several clinically relevant antibiotics in strains of
Listeria isolated from food, the environment, or patients with listeriosis (Walsh et
al., 2001; Srinivasan et al., 2005; Conter et al., 2009). A recent study revealed a
high level of resistance in L. monocytogenes isolated from dairy farms (Srinivasan
et al., 2005). An increase in antimicrobial resistance of L. monocytogenes, which
may be linked to over-use of antibiotics in animals and humans (Davies, 1998; Rao,
1998), is a major public health concern owing to the high mortality rates associated
with listeriosis (Li et al., 2007). Results of the present study are in accordance with
above findings as we found all of the L. monocytogenes isolates recovered from
milk were sensitive to seven of the antibiotics (Hof, 1991; Charpentier and
Courvalin, 1999). In our study, out of 37 L. monocytogenes isolates, 16 were found
resistant to penicillin, 8 to vancomycin and 6 to ampicillin. A review of antibiotic
resistance in Listeria spp. (Charpentier and Courvalin, 1999) reported no cases of
resistance to penicillin in strains of Listeria spp. from human, food and
environmental sources. In a study to test the susceptibility of 120 L. monocytogenes
155
strains isolated from food and food-processing environments to 19 antibiotics
currently used in veterinary and human therapy, resistance to at least one antibiotic
was reported in 11.7% strains. Resistance to ampicilin and vancomycin was also
reported (Conter et al., 2009).
Table 5.5. Per cent sensitivity/resistance of L. monocytogenes isolates.
Sr.
no.
Antibiotic
with concentration
(n=37)
S
No. %
R
No. %
1 Ampicillin (A)
(25 µg/disc) 31 84.21 6 15.79
2 Ciprofloxacin
(30µg/disc) 37 100 0
3 Cloramphenicol
(30µg/disc) 37 100 0
4 Gentamicin
(10µg/disc) 37 100 0
5 Linezolid
(30µg/disc) 37 100 0
6 Meropenem
(10µg/disc) 37 100 0
7 Penicillin
(10µg/disc) 21 57.89 16 42.11
8 Tetracycline (T)
(30µg/disc) 37 100 0
9 Trimethoprim
(25µg/disc) 37 100 0
10 Vancomycin
(30µg/disc) 29 78.95 8 21.05
156
Conclusions
Despite the high incidence of contamination of raw milk, it carries a low risk of
listeriosis transmission because of the heat treatment prior to consumption. However,
considering the level of incidence of L. monocytogenes in raw milk, it seems likely that L.
monocytogenes may be transferred to milk products or milk that have not been correctly
pasteurized or that have been contaminated post pasteurization with raw milk. A number of
farms sampled supply raw milk to the milk industry that produces market milk. This study
demonstrates the prevalence of L. monocytogenes in the dairy farm environment and the
need for good hygiene practices to prevent its entry into the food chain.
The occurrence of L. monocytogenes in raw bovine milk is of great concern from
public health point of view as it can serve as a source for the transmission of human
listeriosis. This occurrence could be as a result of unhygienic conditions and improper
husbandary practices. This calls for an urgent need of hygienic measures to be adopted at
farm level as well as at dairies. In addition, to minimize human listeriosis, milk needs to be
properly pasteurized to ensure destruction of L. monocytogenes.
In conclusion effective food safety interventions to reduce or control foodborne
pathogens are needed throughout the food continuum, from the farm to the end user.
Current production and processing procedures for livestock and their products do not have
sufficiently robust food safety interventions to ensure pathogen free raw milk and products.
Since there is no single widely accepted food safety intervention that will eliminate
pathogen contamination of fresh and minimally processed foods, the application of
effective food safety interventions must be at the farm and additional interventions need to
be thereafter at subsequent stages of food processing, packaging, distribution, retail, and
home or food service establishments.
157